Homologs in group_305

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08170 FBDBKF_08170 97.4 Morganella morganii S1 ilvE branched-chain amino acid transaminase
EHELCC_13355 EHELCC_13355 97.8 Morganella morganii S2 ilvE branched-chain-amino-acid transaminase
NLDBIP_13695 NLDBIP_13695 97.4 Morganella morganii S4 ilvE branched-chain amino acid transaminase
LHKJJB_12860 LHKJJB_12860 97.4 Morganella morganii S3 ilvE branched-chain amino acid transaminase
HKOGLL_12170 HKOGLL_12170 97.4 Morganella morganii S5 ilvE branched-chain amino acid transaminase
PMI_RS08325 PMI_RS08325 28.7 Proteus mirabilis HI4320 - D-amino-acid transaminase
PMI_RS16410 PMI_RS16410 89.6 Proteus mirabilis HI4320 - branched-chain amino acid transaminase

Distribution of the homologs in the orthogroup group_305

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_305

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1A5 0.0 568 87 0 306 1 ilvE Branched-chain-amino-acid aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1A6 0.0 568 87 0 306 3 ilvE Branched-chain-amino-acid aminotransferase Salmonella typhi
P0AB80 0.0 567 86 0 306 1 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli (strain K12)
P0AB81 0.0 567 86 0 306 3 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AB82 0.0 567 86 0 306 3 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli O157:H7
O27481 2.39e-121 353 57 1 296 3 ilvE Putative branched-chain-amino-acid aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O86428 4.42e-102 304 49 2 302 1 ilvE Branched-chain-amino-acid aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O67733 1.29e-74 234 40 6 307 3 ilvE Probable branched-chain-amino-acid aminotransferase Aquifex aeolicus (strain VF5)
O29329 2.86e-65 209 39 4 285 1 ilvE Putative branched-chain-amino-acid aminotransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58414 1.22e-62 202 39 4 294 3 ilvE Putative branched-chain-amino-acid aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1RIJ2 5.7e-57 188 37 5 272 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia bellii (strain RML369-C)
Q92I26 6.33e-56 186 36 4 261 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULR3 1.32e-55 185 36 4 261 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9AKE5 2.97e-52 176 33 4 262 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P54691 2.54e-50 171 33 9 318 3 ilvE Probable branched-chain-amino-acid aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O05970 3.03e-50 171 33 4 262 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia prowazekii (strain Madrid E)
Q8CQ78 9.85e-45 158 33 7 319 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRJ8 1.43e-44 158 33 7 319 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P63513 5.95e-43 154 32 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MW2)
Q6GBT3 5.95e-43 154 32 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MSSA476)
P99138 5.95e-43 154 32 6 316 1 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain N315)
P63512 5.95e-43 154 32 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIC1 5.95e-43 154 32 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain COL)
Q6GJB4 1.78e-42 152 32 6 316 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MRSA252)
O86505 7.1e-38 140 33 11 322 3 ilvE Probable branched-chain-amino-acid aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9ASR4 1.24e-33 132 32 7 288 2 At5g27410 Branched-chain-amino-acid aminotransferase-like protein 2 Arabidopsis thaliana
P54694 1.37e-32 124 30 8 294 3 dat D-alanine aminotransferase Staphylococcus haemolyticus
K7QHS5 2.01e-32 127 31 10 307 1 BCAT2 Branched-chain amino acid aminotransferase 2, chloroplastic Humulus lupulus
Q8W0Z7 8.44e-32 127 32 8 292 2 At3g05190 Branched-chain-amino-acid aminotransferase-like protein 1 Arabidopsis thaliana
O31461 9.56e-32 124 29 8 313 1 ilvE Branched-chain-amino-acid transaminase 1 Bacillus subtilis (strain 168)
P9WQ75 1e-31 124 31 11 324 1 ilvE Branched-chain-amino-acid aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ74 1e-31 124 31 11 324 3 ilvE Branched-chain-amino-acid aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9FYA6 2.79e-31 124 29 9 305 1 BCAT5 Branched-chain-amino-acid aminotransferase 5, chloroplastic Arabidopsis thaliana
Q9M401 5.47e-31 123 30 9 306 1 BCAT3 Branched-chain-amino-acid aminotransferase 3, chloroplastic Arabidopsis thaliana
O32954 3.94e-29 117 29 12 324 3 ilvE Probable branched-chain-amino-acid aminotransferase Mycobacterium leprae (strain TN)
Q8CS41 9.18e-29 114 29 7 293 3 dat D-alanine aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNG0 9.18e-29 114 29 7 293 3 dat D-alanine aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0R066 9.57e-29 116 31 12 328 1 ilvE Branched-chain-amino-acid aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P54692 1.06e-28 114 27 6 290 3 dat D-alanine aminotransferase Bacillus licheniformis
P19938 1.1e-28 114 27 6 290 1 dat D-alanine aminotransferase Bacillus sp. (strain YM-1)
Q9LPM9 1.37e-27 113 29 11 314 1 BCAT6 Branched-chain-amino-acid aminotransferase 6 Arabidopsis thaliana
Q9ZJF1 1.5e-27 112 29 10 310 3 ilvE Branched-chain-amino-acid aminotransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q5HF24 1.94e-27 111 27 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain COL)
Q8NW24 2.19e-27 110 27 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MW2)
Q6GFV1 2.19e-27 110 27 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MRSA252)
Q6G8H7 2.26e-27 110 27 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MSSA476)
P39576 2.54e-27 112 27 9 326 1 ilvK Branched-chain-amino-acid aminotransferase 2 Bacillus subtilis (strain 168)
P99090 2.67e-27 110 27 6 286 1 dat D-alanine aminotransferase Staphylococcus aureus (strain N315)
P63511 2.67e-27 110 27 6 286 3 dat D-alanine aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9LPM8 6.13e-27 111 30 9 306 5 BCAT7 Putative branched-chain-amino-acid aminotransferase 7 Arabidopsis thaliana
Q9M439 1.18e-26 111 28 10 310 1 BCAT2 Branched-chain-amino-acid aminotransferase 2, chloroplastic Arabidopsis thaliana
Q9LE06 3.21e-26 109 27 9 304 1 BCAT4 Methionine aminotransferase BCAT4 Arabidopsis thaliana
O26004 8.69e-26 107 30 10 290 3 ilvE Branched-chain-amino-acid aminotransferase Helicobacter pylori (strain ATCC 700392 / 26695)
P54693 1.53e-25 106 27 6 284 3 dat D-alanine aminotransferase Lysinibacillus sphaericus
K7QKH1 2.37e-25 107 30 10 293 1 BCAT1 Branched-chain amino acid aminotransferase 1, mitochondrial Humulus lupulus
A7SLW1 5.26e-25 106 27 10 320 3 v1g246094 Branched-chain-amino-acid aminotransferase Nematostella vectensis
Q71Z49 8.74e-24 101 26 7 293 3 dat D-alanine aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
O07597 1.08e-23 101 28 9 287 3 dat D-alanine aminotransferase Bacillus subtilis (strain 168)
Q92B90 1.14e-23 101 26 7 293 3 dat D-alanine aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q93Y32 1.26e-23 102 30 11 297 1 BCAT1 Branched-chain-amino-acid aminotransferase 1, mitochondrial Arabidopsis thaliana
P0DJL9 3.43e-23 99 27 7 298 3 dat D-alanine aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2JZ74 3.57e-23 99 27 7 298 3 dat D-alanine aminotransferase Listeria monocytogenes serotype 1/2a (strain 10403S)
A0A179HME7 4.49e-22 98 26 10 326 2 lcsP Aminotransferase lcsP Purpureocillium lilacinum
P54689 2.5e-20 92 28 13 325 3 ilvE Branched-chain-amino-acid aminotransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q54N47 2.86e-20 93 28 14 306 3 bcaA Branched-chain-amino-acid aminotransferase Dictyostelium discoideum
O14370 8.7e-20 92 28 13 334 1 eca39 Branched-chain-amino-acid aminotransferase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5AV02 2.4e-19 90 27 13 333 2 atnH Branched-chain-amino-acid aminotransferase atnH Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AV04 6.59e-19 89 26 12 329 2 atnJ Aminotransferase atnJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P74921 1.36e-18 87 28 9 272 1 ilvE Probable branched-chain-amino-acid aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
K0E3V3 3.7e-18 87 24 12 326 1 htyB Transaminase htyB Aspergillus rugulosus
P47176 1.15e-17 85 26 12 324 1 BAT2 Branched-chain-amino-acid aminotransferase, cytosolic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P24288 2.39e-17 85 29 11 286 1 Bcat1 Branched-chain-amino-acid aminotransferase, cytosolic Mus musculus
Q5EA40 2.78e-17 84 27 11 284 2 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Bos taurus
O35854 4.28e-17 84 26 11 291 1 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial Rattus norvegicus
P54687 4.91e-17 84 26 13 328 1 BCAT1 Branched-chain-amino-acid aminotransferase, cytosolic Homo sapiens
P54688 5.33e-17 84 28 12 283 2 bcat-1 Branched-chain-amino-acid aminotransferase, cytosolic Caenorhabditis elegans
O35855 7.6e-17 83 26 12 293 1 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial Mus musculus
P38891 9.74e-17 83 27 14 314 1 BAT1 Branched-chain-amino-acid aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P28821 1.27e-16 81 24 6 286 3 pabC Aminodeoxychorismate lyase Bacillus subtilis (strain 168)
Q5REP0 1.61e-16 82 26 11 294 2 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Pongo abelii
Q9GKM4 1.78e-16 82 27 15 325 2 BCAT1 Branched-chain-amino-acid aminotransferase, cytosolic Ovis aries
O15382 4.94e-16 81 26 11 294 1 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Homo sapiens
P54690 1.36e-15 80 28 13 287 1 Bcat1 Branched-chain-amino-acid aminotransferase, cytosolic Rattus norvegicus
C9K7B6 5.99e-15 77 24 11 317 2 AMT5 Transaminase AMT5 Alternaria alternata
A9UZ24 1.21e-14 77 25 13 323 3 37018 Branched-chain-amino-acid aminotransferase Monosiga brevicollis
C9K7D8 1.23e-14 77 24 11 317 3 AMT5-2 Transaminase AMT5-2 Alternaria alternata
Q9KQI0 1.8e-14 75 28 4 182 3 pabC Aminodeoxychorismate lyase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
S7ZEI5 5.6e-14 75 23 7 272 1 poxL Aminotransferase poxL Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A1W5T1Y5 2.2e-13 73 23 7 272 1 poxL Aminotransferase poxL Penicillium oxalicum
S0DS11 7.77e-13 71 24 10 310 1 apf4 Aminotransferase apf4 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S3DQP8 2.5e-11 67 26 10 263 1 gloG Branched-chain amino acid aminotransferase gloG Glarea lozoyensis (strain ATCC 20868 / MF5171)
I1R9B6 6.43e-11 65 23 12 324 3 FGRAMPH1_01T00157 Aminotransferase FGSG_00049 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9Y885 8.17e-11 65 23 10 309 3 TOXF Aminotransferase TOXF Cochliobolus carbonum
P28305 6.12e-09 59 23 6 240 1 pabC Aminodeoxychorismate lyase Escherichia coli (strain K12)
Q56693 2.3e-08 57 24 8 260 3 pabC Aminodeoxychorismate lyase Vibrio harveyi
Q8L493 1.06e-07 56 22 5 264 1 DAAT D-amino-acid transaminase, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS18700
Feature type CDS
Gene -
Product branched-chain amino acid transaminase
Location 6249 - 7175 (strand: 1)
Length 927 (nucleotides) / 308 (amino acids)

Contig

Accession term accessions NZ_VXKB01000010 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 36620 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_305
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01063 Amino-transferase class IV

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0115 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)		 EH Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase

Kegg Ortholog Annotation(s)

Protein Sequence

MTKKADFIWFNDEMVPWAEAKVHVMCHAMHYGTSVFEGIRCYDSHKGPVVFRHREHMQRLHDSAKIYRMPMDYSVDELMEACRATLRKNNLSSGYIRPLVFIGDVGMGVNPPQGYKTDVIIAAFPWGAYLGEEALDEGIDAMVSSWNRVAPNTIPTAAKAGGNYLSSLLVGSEARRHGYQEGIALDVHGYISEGAGENLFEVKNNILFTPPFTSSALPGITRDAILTLAKDLGYEIREQTLSRESLYLADEVFMTGTAAEVTPVRSVDGIQVGIGRCGPVTKEIQQAFFGLFTGKTEDKWGWLDPVNP

Flanking regions ( +/- flanking 50bp)

AAAAGAGAAAATTATCAGCACATTAGCCGTGCGATCTAAGGAAAATAACAATGACAAAAAAAGCTGATTTTATTTGGTTCAATGATGAGATGGTTCCGTGGGCTGAAGCAAAAGTTCACGTTATGTGTCATGCAATGCATTACGGGACATCGGTTTTTGAAGGGATCCGCTGTTACGATTCCCACAAAGGACCGGTTGTTTTCCGCCATCGTGAGCACATGCAGCGCCTGCATGATTCGGCAAAAATCTATCGTATGCCAATGGATTATTCCGTGGATGAATTGATGGAAGCCTGCCGTGCAACGTTACGCAAAAATAATCTGAGCAGTGGTTATATCCGCCCGCTGGTGTTTATTGGTGATGTCGGAATGGGTGTGAATCCGCCGCAGGGCTATAAAACAGATGTCATCATTGCAGCATTCCCGTGGGGCGCTTATTTGGGAGAGGAAGCGCTGGATGAAGGTATTGATGCCATGGTGTCCTCCTGGAACCGCGTTGCACCGAATACCATCCCGACGGCCGCTAAAGCCGGCGGTAACTATCTTTCTTCTCTGCTGGTCGGCAGTGAAGCCCGCCGTCACGGCTATCAGGAAGGTATCGCACTGGATGTACACGGCTATATCTCTGAAGGTGCCGGTGAAAACTTGTTTGAAGTGAAAAACAATATTCTCTTTACGCCGCCGTTTACCTCATCTGCGCTGCCGGGAATTACCCGTGATGCCATTCTGACTCTGGCAAAAGATCTGGGTTATGAGATTCGTGAGCAGACGCTATCCCGTGAATCGCTTTATCTTGCCGATGAAGTCTTTATGACCGGCACAGCGGCAGAAGTAACACCGGTGCGCAGTGTGGATGGTATTCAGGTTGGTATCGGGCGCTGCGGTCCTGTGACCAAAGAGATCCAGCAAGCGTTCTTCGGGCTGTTTACAGGTAAGACAGAAGACAAATGGGGCTGGTTAGATCCGGTAAATCCATAATAACGAAACGGATACTGATCCACGGGCGGGACGTTCCCCCGCCTGATTTT