Homologs in group_962

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04660 FBDBKF_04660 88.5 Morganella morganii S1 rimO 30S ribosomal protein S12 methylthiotransferase RimO
EHELCC_05950 EHELCC_05950 88.5 Morganella morganii S2 rimO 30S ribosomal protein S12 methylthiotransferase RimO
NLDBIP_06270 NLDBIP_06270 88.5 Morganella morganii S4 rimO 30S ribosomal protein S12 methylthiotransferase RimO
LHKJJB_03150 LHKJJB_03150 88.5 Morganella morganii S3 rimO 30S ribosomal protein S12 methylthiotransferase RimO
HKOGLL_06625 HKOGLL_06625 88.5 Morganella morganii S5 rimO 30S ribosomal protein S12 methylthiotransferase RimO
F4V73_RS09110 F4V73_RS09110 86.7 Morganella psychrotolerans rimO 30S ribosomal protein S12 methylthiotransferase RimO

Distribution of the homologs in the orthogroup group_962

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_962

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F137 0.0 912 100 0 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Proteus mirabilis (strain HI4320)
Q6D3N6 0.0 813 88 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MF19 0.0 811 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cronobacter sakazakii (strain ATCC BAA-894)
B7LMZ9 0.0 808 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B2TV93 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q323V7 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella boydii serotype 4 (strain Sb227)
B1LMD0 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain SMS-3-5 / SECEC)
B6I8F5 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain SE11)
B7NAI1 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AEI4 0.0 806 87 0 441 1 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain K12)
B1IXD2 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY97 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O9:H4 (strain HS)
B1X7X6 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain K12 / DH10B)
B7M7B0 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O8 (strain IAI1)
B7NNR8 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSC6 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AEI5 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O157:H7
B7LCB8 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain 55989 / EAEC)
A7ZJQ2 0.0 806 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83LT1 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella flexneri
Q1RE90 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain UTI89 / UPEC)
Q8FJK5 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJL3 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A974 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O1:K1 / APEC
B7MQT8 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O81 (strain ED1a)
B7MGU2 0.0 804 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3Z3U9 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella sonnei (strain Ss046)
Q0T6C8 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella flexneri serotype 5b (strain 8401)
Q8ZQM1 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TQZ6 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella schwarzengrund (strain CVM19633)
B5BBX8 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi A (strain AKU_12601)
B4T0B2 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella newport (strain SL254)
B5QXV6 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella enteritidis PT4 (strain P125109)
B5FPB9 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella dublin (strain CT_02021853)
Q57RA8 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella choleraesuis (strain SC-B67)
B5F0X7 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella agona (strain SL483)
A6T6T1 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYQ3 0.0 803 87 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Klebsiella pneumoniae (strain 342)
Q8Z861 0.0 801 86 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella typhi
B5R840 0.0 801 86 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MIP6 0.0 800 86 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5PGP7 0.0 800 86 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MSQ9 0.0 799 86 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TCV0 0.0 799 86 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella heidelberg (strain SL476)
A8AIT5 0.0 794 85 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4SKK7 0.0 771 81 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aeromonas salmonicida (strain A449)
A0KHZ9 0.0 771 81 0 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7VKK2 0.0 736 77 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BRW2 0.0 734 77 4 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2T4 0.0 734 77 4 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3H2N3 0.0 734 77 4 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q9KNW0 0.0 728 75 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CKN9 0.0 728 75 2 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pasteurella multocida (strain Pm70)
B0US28 0.0 728 76 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Histophilus somni (strain 2336)
Q0I4D9 0.0 728 76 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Histophilus somni (strain 129Pt)
A5F514 0.0 725 75 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VLD6 0.0 723 75 2 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q15UT4 0.0 717 76 0 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7MG88 0.0 714 75 0 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio vulnificus (strain YJ016)
Q65QA6 0.0 713 77 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8D4N8 0.0 710 75 0 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio vulnificus (strain CMCP6)
A1RNY7 0.0 697 72 1 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain W3-18-1)
B3PGP3 0.0 696 74 1 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cellvibrio japonicus (strain Ueda107)
A0L1C8 0.0 694 72 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain ANA-3)
Q0HZF3 0.0 694 72 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain MR-7)
Q0HEK0 0.0 694 72 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain MR-4)
A9KZF7 0.0 693 71 1 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS195)
Q8EA37 0.0 693 72 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A4Y2Z8 0.0 692 71 1 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WIP6 0.0 692 71 1 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS185)
A3D958 0.0 689 71 1 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1U488 0.0 685 72 1 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2SBG3 0.0 684 74 0 430 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hahella chejuensis (strain KCTC 2396)
A1S2T9 0.0 682 71 0 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B4RYE6 0.0 676 72 0 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q9I541 0.0 658 71 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02I76 0.0 658 71 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7VS95 0.0 657 70 1 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9IFP1 0.0 657 69 1 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7W1U6 0.0 657 70 1 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q484J7 0.0 655 72 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4XT11 0.0 654 70 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas mendocina (strain ymp)
Q1I6D1 0.0 654 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas entomophila (strain L48)
A4VKC4 0.0 654 70 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stutzerimonas stutzeri (strain A1501)
Q7WQS2 0.0 653 70 1 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B1JD88 0.0 650 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain W619)
A6VA58 0.0 650 71 3 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain PA7)
B0KTL0 0.0 650 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain GB-1)
Q4KHA5 0.0 650 71 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q88NL0 0.0 649 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VZS9 0.0 649 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A3M659 0.0 649 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VMU3 0.0 649 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain SDF)
B2I330 0.0 649 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain ACICU)
B0V6E8 0.0 648 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AYE)
B7H1U1 0.0 648 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AB307-0294)
B7I9V4 0.0 647 67 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AB0057)
Q6FCH4 0.0 646 68 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2RQI7 0.0 644 69 1 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3KH22 0.0 644 70 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas fluorescens (strain Pf0-1)
Q31G14 0.0 644 68 1 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3SI16 0.0 642 68 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thiobacillus denitrificans (strain ATCC 25259)
Q2Y7J7 0.0 642 68 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q48FA7 0.0 641 69 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZWM9 0.0 639 69 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas syringae pv. syringae (strain B728a)
Q7NYA1 0.0 638 68 2 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87Y01 0.0 635 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21FE3 0.0 633 68 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q60CM4 0.0 629 65 1 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q47CF0 0.0 626 65 1 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dechloromonas aromatica (strain RCB)
Q1H0X3 0.0 625 66 1 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q82VY8 0.0 623 66 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A1K487 0.0 623 66 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Azoarcus sp. (strain BH72)
Q8XYX0 0.0 621 65 4 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1LNN2 0.0 621 65 4 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q472G1 0.0 619 64 4 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B6IRQ0 0.0 619 67 1 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodospirillum centenum (strain ATCC 51521 / SW)
Q39FU0 0.0 618 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0AG95 0.0 617 67 1 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B4EAF5 0.0 617 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B3R4X7 0.0 617 64 4 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q1BGU5 0.0 616 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia orbicola (strain AU 1054)
B1JT65 0.0 616 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia orbicola (strain MC0-3)
Q0BEZ5 0.0 616 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K7Q6 0.0 616 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia cenocepacia (strain HI2424)
B2UFU5 0.0 615 65 4 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ralstonia pickettii (strain 12J)
B1YR17 0.0 615 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia ambifaria (strain MC40-6)
Q13Z56 0.0 614 64 6 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia xenovorans (strain LB400)
B2T3U5 0.0 614 64 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A4JEL4 0.0 614 65 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0KBP2 0.0 613 65 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5P1L3 0.0 613 64 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B2JG80 0.0 612 64 6 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q8P7P7 0.0 611 65 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RR62 0.0 611 65 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain B100)
Q4UWF3 0.0 611 65 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain 8004)
Q8PJ10 0.0 611 65 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas axonopodis pv. citri (strain 306)
A9AH21 0.0 610 64 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia multivorans (strain ATCC 17616 / 249)
B2SWC0 0.0 610 65 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q5GXP5 0.0 609 65 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P0S4 0.0 609 65 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BRJ5 0.0 608 65 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q2W2S4 0.0 608 65 2 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q4FRH4 0.0 607 66 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B2FP10 0.0 607 64 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stenotrophomonas maltophilia (strain K279a)
Q1QA11 0.0 607 65 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2SWB9 0.0 607 64 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5ZXP6 0.0 606 64 1 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B4SQX0 0.0 605 64 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stenotrophomonas maltophilia (strain R551-3)
Q5WYL5 0.0 604 64 1 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Lens)
A5VUQ0 0.0 602 65 1 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A5IGM4 0.0 602 64 1 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Corby)
Q98MN9 0.0 602 64 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5X765 0.0 602 64 1 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Paris)
Q63UQ8 0.0 601 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain K96243)
A3NA26 0.0 601 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 668)
Q3JRT1 0.0 601 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 1710b)
A3NVU2 0.0 601 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 1106a)
Q8FW94 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella suis biovar 1 (strain 1330)
A9WYN5 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YC29 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBK6 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q577W6 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus biovar 1 (strain 9-941)
Q2YKI5 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus (strain 2308)
B2SB89 0.0 600 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus (strain S19)
A1V4H3 0.0 598 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain SAVP1)
Q62JZ1 0.0 598 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain ATCC 23344)
A2S2C9 0.0 598 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain NCTC 10229)
A3MK46 0.0 598 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain NCTC 10247)
A6X529 0.0 598 65 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q0A8I9 0.0 597 63 0 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B1ZEV4 0.0 594 64 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A5WGF2 0.0 594 62 4 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter sp. (strain PRwf-1)
A6SXU1 0.0 594 65 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Janthinobacterium sp. (strain Marseille)
B7L2K9 0.0 593 64 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A9W8D2 0.0 592 64 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum extorquens (strain PA1)
A4G6D4 0.0 588 65 5 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Herminiimonas arsenicoxydans
A8I0G1 0.0 588 65 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A4YUI3 0.0 588 64 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium sp. (strain ORS 278)
A5EJ58 0.0 588 63 1 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q6N6E2 0.0 584 64 1 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B0UQE6 0.0 584 63 1 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacterium sp. (strain 4-46)
A2SG87 0.0 584 61 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B3QIV5 0.0 583 64 1 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain TIE-1)
Q89LG9 0.0 582 63 1 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q136X7 0.0 581 64 1 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisB5)
Q2IW68 0.0 580 63 1 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain HaA2)
A7INV0 0.0 579 63 1 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q214L6 0.0 577 63 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisB18)
A4SXC8 0.0 577 64 5 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1Y223 0.0 574 61 5 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q2NDN5 0.0 573 61 6 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Erythrobacter litoralis (strain HTCC2594)
Q07M57 0.0 572 62 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisA53)
A1TMP4 0.0 571 62 7 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paracidovorax citrulli (strain AAC00-1)
A9IUA4 0.0 570 62 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bartonella tribocorum (strain CIP 105476 / IBS 506)
A9BVZ2 0.0 570 61 7 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Delftia acidovorans (strain DSM 14801 / SPH-1)
B1M6H4 0.0 569 62 1 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q12A25 0.0 568 63 5 426 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polaromonas sp. (strain JS666 / ATCC BAA-500)
B7J3M4 0.0 568 61 3 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A0Q4U9 0.0 567 60 3 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. novicida (strain U112)
A1WAJ7 0.0 565 60 8 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidovorax sp. (strain JS42)
Q5NPC9 0.0 564 63 2 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B2IHC3 0.0 564 61 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A5V3Z4 0.0 563 64 3 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q0C0U1 0.0 563 61 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hyphomonas neptunium (strain ATCC 15444)
B5EK28 0.0 563 60 3 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
A1VQ18 0.0 561 62 5 423 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polaromonas naphthalenivorans (strain CJ2)
Q6G5E0 0.0 560 61 2 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B0U054 0.0 559 60 3 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q5LUV8 0.0 558 62 3 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B1XUT6 0.0 558 61 5 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q2GA32 0.0 557 60 6 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B6JF93 0.0 556 62 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q1GV83 0.0 555 61 5 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A1WMV5 0.0 553 61 5 423 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Verminephrobacter eiseniae (strain EF01-2)
A8LI17 0.0 553 61 3 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q21X03 0.0 551 61 5 428 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q72JG1 0.0 550 61 3 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q28TN0 0.0 548 60 4 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Jannaschia sp. (strain CCS1)
Q5SJ39 0.0 548 61 3 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A4WRD4 0.0 548 63 4 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A3PIG0 0.0 544 63 4 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q1J1F6 0.0 543 59 7 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q3J3Y8 0.0 540 62 4 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q169Q9 0.0 539 60 4 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1GIY4 0.0 537 60 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ruegeria sp. (strain TM1040)
A1B3K8 0.0 537 60 4 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paracoccus denitrificans (strain Pd 1222)
Q9RYW7 0.0 526 56 6 469 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0BNJ1 7.3e-174 496 64 1 346 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. holarctica (strain OSU18)
A7NA32 7.3e-174 496 64 1 346 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5D2R3 3.59e-112 340 42 11 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q67NX5 3.94e-104 321 41 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B5YKD1 1.48e-103 317 40 8 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q18BJ2 9.2e-103 316 41 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridioides difficile (strain 630)
A4J5U4 5.18e-102 314 40 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q2JSD0 5.69e-102 314 40 9 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain JA-3-3Ab)
Q2JK17 6.2e-102 315 40 9 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8DIL8 2.44e-101 312 40 8 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q0AXI3 6.92e-101 311 39 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A6TRJ4 9.42e-101 311 39 10 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkaliphilus metalliredigens (strain QYMF)
Q55803 1.03e-100 310 39 10 451 2 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8RA52 1.47e-100 310 41 11 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q6MGT1 3.14e-100 310 40 9 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q7UK39 5.75e-100 310 40 13 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q1IPQ5 1.07e-99 310 39 12 491 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Koribacter versatilis (strain Ellin345)
A0L887 1.29e-99 309 40 9 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B2IVR7 4.19e-99 306 39 11 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B3QSS3 4.46e-99 306 39 9 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B0K9N5 8.78e-99 305 38 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8YXJ1 1.22e-98 305 39 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2RJK1 2.55e-98 304 42 14 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A9WDA3 3.03e-98 305 39 14 469 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q3A8J5 8.62e-98 303 39 16 478 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q1DC90 1.07e-97 304 38 11 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Myxococcus xanthus (strain DK1622)
A4XLD9 1.1e-97 303 37 11 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A0Q0P6 1.28e-97 303 38 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium novyi (strain NT)
Q747R0 1.37e-97 303 40 11 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0K1C1 1.52e-97 302 38 11 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermoanaerobacter sp. (strain X514)
Q3MFH1 2.93e-97 301 38 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A3PAG5 3.47e-97 302 39 12 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9301)
Q7V3H3 4.04e-97 301 38 11 463 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A3DDZ7 4.97e-97 301 37 9 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A7NIS8 5.34e-97 302 36 10 472 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q24W37 5.47e-97 301 38 12 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfitobacterium hafniense (strain Y51)
A6LSR6 6.35e-97 301 38 11 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q6AQ27 6.75e-97 301 39 9 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q6MBU9 7.47e-97 301 38 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Protochlamydia amoebophila (strain UWE25)
A2BNP5 9.16e-97 301 38 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain AS9601)
A5N854 9.66e-97 300 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q2IM41 1.94e-96 300 42 11 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter dehalogenans (strain 2CP-C)
B2V4I1 3.56e-96 299 38 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Alaska E43 / Type E3)
B1WUD1 1.09e-95 297 37 11 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Crocosphaera subtropica (strain ATCC 51142 / BH68)
B1XPZ7 1.37e-95 297 39 12 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3ACX5 2.56e-95 296 38 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B2TJ67 3.11e-95 296 37 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Eklund 17B / Type B)
Q935Y2 3.55e-95 296 38 12 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5N1N6 4.65e-95 296 38 12 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
B3EAM2 4.85e-95 296 39 11 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A2BU62 5.04e-95 296 38 12 463 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9515)
A9KLS2 6.16e-95 295 39 11 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9AZS3 7.73e-95 296 37 12 479 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B4UKQ2 1.03e-94 296 42 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter sp. (strain K)
Q31D78 1.11e-94 295 38 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9312)
B0JJS5 1.84e-94 294 38 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9BCV9 2.27e-94 295 37 10 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9211)
Q10Y85 2.36e-94 294 37 8 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichodesmium erythraeum (strain IMS101)
O67016 3.17e-94 293 42 10 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aquifex aeolicus (strain VF5)
A1ATL9 6.34e-94 293 39 13 463 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B0TIH8 9.26e-94 293 40 12 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A6GZF6 9.69e-94 292 40 11 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A9F1Y8 9.75e-94 294 39 13 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sorangium cellulosum (strain So ce56)
A8G2A6 1.1e-93 293 38 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9215)
A5UQQ2 1.19e-93 293 37 11 468 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseiflexus sp. (strain RS-1)
B7JV66 1.34e-93 292 38 10 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8XJS9 2.47e-93 291 38 12 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain 13 / Type A)
Q0TPS8 2.47e-93 291 38 12 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A0M3K8 2.49e-93 291 39 11 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A5GQP4 3.4e-93 293 38 9 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain RCC307)
Q0SSE5 4.93e-93 291 38 12 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain SM101 / Type A)
Q7U477 6.01e-93 291 37 7 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Parasynechococcus marenigrum (strain WH8102)
B7KDB6 7.02e-93 290 38 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Gloeothece citriformis (strain PCC 7424)
A5FA30 7.27e-93 290 38 8 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q7V8Z5 8.15e-93 291 38 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9313)
B1ZW93 1.31e-92 290 37 11 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B2V8N8 1.59e-92 289 40 15 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurihydrogenibium sp. (strain YO3AOP1)
Q11XC6 1.92e-92 289 38 14 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A2C661 3.06e-92 290 37 8 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9303)
A5GBX9 3.14e-92 289 39 12 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geotalea uraniireducens (strain Rf4)
Q3AH63 4.12e-92 289 37 7 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9605)
Q028J0 5.92e-92 288 38 12 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Solibacter usitatus (strain Ellin6076)
Q3B002 8.87e-92 288 37 7 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9902)
A7H6G8 2.68e-91 287 40 11 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter sp. (strain Fw109-5)
A8MLX7 4.11e-91 286 37 12 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkaliphilus oremlandii (strain OhILAs)
Q9Z8T3 4.14e-91 286 39 11 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia pneumoniae
B4S8Z6 5.76e-91 285 39 12 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B4SBD5 5.79e-91 285 37 7 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q39QQ6 6.32e-91 285 38 12 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q0I735 7.67e-91 286 37 9 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9311)
Q7NDB8 1.06e-90 285 37 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q254N4 3.36e-90 284 38 12 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia felis (strain Fe/C-56)
B5ED60 8.19e-90 283 38 13 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q8A9A2 9.48e-90 282 38 14 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A6L5E7 2.22e-89 281 37 13 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A5IL80 2.74e-89 281 35 7 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q3ASP1 2.91e-89 281 38 7 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium chlorochromatii (strain CaD3)
Q9X2H6 2.95e-89 280 35 7 441 1 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q895I7 3.47e-89 281 38 11 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium tetani (strain Massachusetts / E88)
Q97I40 3.65e-89 281 36 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B1I310 9.33e-89 280 38 11 466 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulforudis audaxviator (strain MP104C)
B1LAG0 1.3e-88 279 35 6 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga sp. (strain RQ2)
B1II37 2.58e-88 278 37 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Okra / Type B1)
A7GFZ4 3.17e-88 278 37 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q8KCL7 3.78e-88 278 38 11 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A6LAJ6 4.32e-88 278 35 10 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A8F8W3 5.57e-88 277 36 6 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q5L5W7 5.96e-88 278 38 12 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia abortus (strain DSM 27085 / S26/3)
A5GNW7 1.04e-87 278 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain WH7803)
A5I4I1 2.96e-87 276 37 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FVY1 2.96e-87 276 37 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain ATCC 19397 / Type A)
B0CB83 3.46e-87 276 36 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acaryochloris marina (strain MBIC 11017)
Q7VE92 3.61e-87 275 36 11 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q823A0 3.62e-87 276 36 11 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A6LM59 2.18e-86 273 36 9 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B7ID25 2.35e-86 273 37 10 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosipho africanus (strain TCF52B)
B3EPX5 2.98e-86 273 38 11 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeobacteroides (strain BS1)
A0LIM0 3.87e-86 273 37 11 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q64TK5 5.28e-86 272 37 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides fragilis (strain YCH46)
Q5LCF8 5.28e-86 272 37 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B1KWJ5 5.67e-86 273 37 10 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Loch Maree / Type A3)
B2ULZ9 9.35e-86 272 37 12 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B3QMN0 1.35e-85 271 37 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B3EDL2 1.46e-85 271 38 9 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B2A3C0 3.01e-85 271 35 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B4U6U1 4.67e-85 269 38 10 411 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hydrogenobaculum sp. (strain Y04AAS1)
Q2LQ68 1e-82 265 36 11 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophus aciditrophicus (strain SB)
B3DYX1 1.01e-82 264 34 8 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylacidiphilum infernorum (isolate V4)
A4SFH7 1.26e-82 263 35 8 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B2KB59 3.4e-81 259 35 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Elusimicrobium minutum (strain Pei191)
B2RHD7 1.24e-80 258 34 13 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A9A0B5 5.46e-80 257 35 11 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q7MXM3 7.17e-80 256 34 13 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A9BEU9 1.03e-79 256 35 11 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Petrotoga mobilis (strain DSM 10674 / SJ95)
B5YF65 1.33e-79 256 34 8 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q3B317 3.37e-79 255 36 10 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1BHA0 1.4e-78 253 37 8 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A7HMK2 2.16e-78 253 34 8 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q72PC8 2.42e-78 253 34 8 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F710 6.28e-78 251 34 8 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q6A908 7.37e-77 250 33 11 483 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q04R21 1.94e-75 245 33 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q04ZD0 2.75e-75 244 33 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
B0SPT9 3.36e-75 245 34 10 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SGD8 3.36e-75 245 34 10 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q1MQJ5 1.72e-74 243 35 12 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Lawsonia intracellularis (strain PHE/MN1-00)
A8ERB7 3.09e-74 242 34 12 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aliarcobacter butzleri (strain RM4018)
Q47RT4 1.41e-73 241 33 12 478 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermobifida fusca (strain YX)
Q2J750 2.95e-73 242 34 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A6Q526 4.19e-73 239 34 11 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratiruptor sp. (strain SB155-2)
Q726F7 5.1e-73 238 37 14 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1V9Z2 6.66e-73 238 37 14 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratidesulfovibrio vulgaris (strain DP4)
Q82K95 1.2e-72 239 31 10 482 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A4X4R3 8.45e-72 238 31 8 490 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A8M773 1.08e-71 237 31 13 504 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salinispora arenicola (strain CNS-205)
O86812 1.42e-71 237 31 11 480 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q315T9 1.14e-70 233 37 11 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A4FLZ0 3.88e-70 233 31 10 476 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q9ZEN7 3.74e-69 229 35 10 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B1GZH1 1.37e-68 227 31 11 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Endomicrobium trichonymphae
B1VXY2 7.71e-68 227 32 14 474 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A0RQM9 6.59e-67 223 33 11 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter fetus subsp. fetus (strain 82-40)
A6W833 3.16e-66 223 32 13 479 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q73JG6 3.81e-66 222 33 13 471 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q0RDV0 4.28e-66 224 33 10 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A6QCC6 7.59e-66 220 31 14 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurovum sp. (strain NBC37-1)
A0LV11 1.08e-65 221 31 12 467 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A1W162 1.11e-65 220 34 12 430 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FNC1 2.03e-65 219 33 12 430 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q0P8G1 4.18e-65 218 33 12 430 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7ZE21 4.36e-65 218 35 19 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter concisus (strain 13826)
Q5HSX7 6.19e-65 218 34 12 430 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni (strain RM1221)
Q7VGL0 1.49e-64 217 31 8 426 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q30PS0 2.56e-64 216 32 10 415 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A7H5G3 1.01e-63 214 33 12 430 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1SJ39 1.47e-63 215 31 15 473 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nocardioides sp. (strain ATCC BAA-499 / JS614)
A7I0P9 2.22e-63 213 34 15 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B3CV38 2.59e-62 211 32 12 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Orientia tsutsugamushi (strain Ikeda)
A5CC78 1.57e-61 209 31 12 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Orientia tsutsugamushi (strain Boryong)
B1VDD8 5.72e-61 210 31 10 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B3E0M0 1.4e-60 207 29 9 427 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylacidiphilum infernorum (isolate V4)
A0QVX5 2.02e-60 208 31 13 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q83FT9 3.75e-60 206 31 13 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Tropheryma whipplei (strain Twist)
B1MD05 4.86e-60 207 32 14 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q83HG3 4.98e-60 206 31 13 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Tropheryma whipplei (strain TW08/27)
Q4JV79 1.37e-59 206 32 9 439 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium jeikeium (strain K411)
B1VXU5 2.33e-59 205 31 10 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A1T7U2 1.62e-58 203 33 9 393 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q2N950 2.34e-58 201 31 12 447 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Erythrobacter litoralis (strain HTCC2594)
A0LV00 2.8e-58 202 31 12 441 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
O69963 3.93e-58 202 31 10 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
D5ZT17 4.41e-58 201 31 10 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces viridosporus (strain ATCC 14672 / DSM 40746 / JCM 4963 / KCTC 9882 / NRRL B-12104 / FH 1290)
A4TCM9 5.8e-58 201 31 12 453 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium gilvum (strain PYR-GCK)
A1UEZ3 2.16e-57 200 32 11 400 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain KMS)
Q82KC4 2.32e-57 199 30 10 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B2UT98 2.48e-57 198 32 10 420 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain Shi470)
Q6NGR0 3.08e-57 199 30 15 472 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q1BA19 3.26e-57 199 32 11 400 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain MCS)
Q73HW8 3.69e-57 197 30 7 439 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Wolbachia pipientis wMel
Q3A594 6.1e-57 197 29 7 397 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A3PYF3 6.89e-57 199 32 11 401 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain JLS)
B0T155 7.25e-57 197 31 15 467 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Caulobacter sp. (strain K31)
A7HZ82 1.03e-56 197 31 16 465 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
O66638 3.5e-56 195 29 9 453 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aquifex aeolicus (strain VF5)
B6JLW7 5.05e-56 194 31 10 428 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain P12)
Q1GRE9 1.09e-55 194 33 11 391 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q9ZLA9 1.28e-55 193 31 9 418 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain J99 / ATCC 700824)
Q3ACA4 1.37e-55 193 31 12 450 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B2IIK5 1.53e-55 195 31 9 404 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1CTD7 2.46e-55 192 31 9 428 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain HPAG1)
A4FAJ1 3.59e-55 193 32 10 397 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q17XY7 3.78e-55 192 32 10 414 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter acinonychis (strain Sheeba)
A6WWX6 3.88e-55 192 32 14 438 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q6ALW9 4.17e-55 192 32 13 453 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A0JUY6 4.21e-55 194 32 10 391 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Arthrobacter sp. (strain FB24)
Q2J2K9 4.81e-55 192 29 13 474 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain HaA2)
A4QEV7 5.05e-55 194 31 14 459 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium glutamicum (strain R)
Q8FPD5 5.17e-55 194 32 11 397 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q47RR8 7.44e-55 192 30 10 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Thermobifida fusca (strain YX)
B5Z796 8.84e-55 191 31 10 420 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain G27)
A8F716 1.1e-54 191 30 11 448 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B1LWE8 2.04e-54 190 30 15 462 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
P54462 3.55e-54 190 31 6 389 1 mtaB Threonylcarbamoyladenosine tRNA methylthiotransferase MtaB Bacillus subtilis (strain 168)
B3CLG9 3.76e-54 189 31 6 392 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
P67086 4.4e-54 191 29 10 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O25434 4.88e-54 189 31 10 420 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain ATCC 700392 / 26695)
Q8NP67 4.98e-54 191 31 14 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0S1P3 5.93e-54 191 31 13 432 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodococcus jostii (strain RHA1)
Q5FPF1 1.06e-53 189 31 14 461 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Gluconobacter oxydans (strain 621H)
P9WK05 1.67e-53 190 29 10 445 1 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK04 1.67e-53 190 29 10 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U685 1.67e-53 190 29 10 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KM71 1.67e-53 190 29 10 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A5VTA1 1.76e-53 188 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A8GQ03 1.94e-53 187 29 12 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia akari (strain Hartford)
A8F011 1.96e-53 187 29 12 455 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia canadensis (strain McKiel)
A1SNG0 2.33e-53 189 30 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8FXU4 2.33e-53 188 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis biovar 1 (strain 1330)
A9M9Y3 2.33e-53 188 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57AB1 2.33e-53 188 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQS8 2.33e-53 188 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain 2308)
B2S9E5 2.33e-53 188 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain S19)
B5YKW2 2.88e-53 187 31 12 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A0PT87 3e-53 189 31 9 394 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium ulcerans (strain Agy99)
B2HL08 3.25e-53 189 31 9 394 3 miaB2 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 2 Mycobacterium marinum (strain ATCC BAA-535 / M)
B0CK00 3.73e-53 187 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
B7IFC4 6.36e-53 186 31 7 398 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Thermosipho africanus (strain TCF52B)
A1R550 6.5e-53 188 32 11 392 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Paenarthrobacter aurescens (strain TC1)
B3PZB6 7.05e-53 187 30 10 404 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium etli (strain CIAT 652)
A5CSL5 7.35e-53 188 30 12 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A8GTT8 7.54e-53 186 29 11 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia rickettsii (strain Sheila Smith)
B0BVC7 7.54e-53 186 29 11 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia rickettsii (strain Iowa)
B2UQE7 9.49e-53 186 27 10 466 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
A9VYZ9 9.9e-53 186 28 13 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum extorquens (strain PA1)
B1ZJR5 1.27e-52 186 28 12 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A6QCD0 1.72e-52 185 29 8 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sulfurovum sp. (strain NBC37-1)
Q5YT08 1.84e-52 186 32 10 398 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nocardia farcinica (strain IFM 10152)
Q8YEA2 2.22e-52 185 31 12 422 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A7IGB2 2.29e-52 186 30 10 412 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B5ZMY1 2.46e-52 185 30 10 416 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q92G77 2.5e-52 185 29 11 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UK06 2.56e-52 185 29 11 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q13EK7 2.94e-52 185 29 14 466 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain BisB5)
A8F2U6 3e-52 184 29 11 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia massiliae (strain Mtu5)
Q8RG43 3.31e-52 184 29 12 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2KD88 4.54e-52 184 30 10 404 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B2HGN2 4.71e-52 186 30 10 448 3 miaB1 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 1 Mycobacterium marinum (strain ATCC BAA-535 / M)
B0RGZ1 6.89e-52 186 31 9 395 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clavibacter sepedonicus
Q11BD9 9.3e-52 184 30 15 467 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Chelativorans sp. (strain BNC1)
Q30PR1 1.2e-51 182 30 9 403 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A9WQ47 1.33e-51 184 30 14 453 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B5Y8R7 1.35e-51 182 29 7 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15730
Feature type CDS
Gene rimO
Product 30S ribosomal protein S12 methylthiotransferase RimO
Location 3495155 - 3496486 (strand: -1)
Length 1332 (nucleotides) / 443 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_962
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00919 Uncharacterized protein family UPF0004
PF04055 Radical SAM superfamily
PF18693 TRAM domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0621 Translation, ribosomal structure and biogenesis (J) J tRNA A37 methylthiotransferase MiaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14441 ribosomal protein S12 methylthiotransferase [EC:2.8.4.4] - -

Protein Sequence

MSQTNQVPKIGFVSLGCPKNLVDSERILTELRTEGYQVVPTYDDADLVIVNTCGFIDSAVQESLEAIGEALDENGKVIVTGCLGAKENQIREVHPKVLEITGPHSYEQVLSHIHHYVPKPSHNPFTSLVPEQGVKLTPRHYAYLKISEGCNHRCTFCIIPSMRGDLDSRPIGEVLNEAKRLVNAGVKELLVISQDTSAYGVDTKHQTGFWDGMPVKTSMVSLCEQLAKLGIWVRLHYVYPYPHVDEVIPLMAEGKILPYLDIPLQHASPKVLKLMKRPGSVERTLERVKRWREICPELTLRSTFIVGFPGETEEDFQMLLDFLTEARLDRVGCFKYSPVEGAKANELPDQVPEEVKEERYHRFMQLQQQISTERLQEKIGKVLPVIIDEVDEEGAIGRSMADAPEIDGAVYLNEQFDVEPGQIVRVLIEHADEYDLWGTIVEQ

Flanking regions ( +/- flanking 50bp)

TGAGATACAACCACTATTTGTTATTTATTAAAAGTATTGAGAACACGAGCATGTCGCAAACAAATCAAGTGCCTAAAATTGGATTCGTTTCTTTAGGTTGTCCTAAAAATTTGGTGGACTCTGAACGTATCCTCACCGAACTGCGTACAGAAGGTTATCAAGTTGTTCCTACCTATGATGATGCTGATTTAGTCATCGTCAATACCTGTGGCTTTATTGATAGCGCAGTACAAGAATCTCTTGAAGCCATTGGCGAAGCACTCGATGAAAACGGTAAAGTTATCGTCACTGGTTGTTTAGGTGCCAAAGAAAATCAAATCCGTGAAGTTCACCCAAAAGTGCTGGAAATCACCGGCCCTCATAGTTATGAACAAGTGTTATCACATATTCATCACTATGTTCCCAAACCTTCCCATAACCCATTTACCAGCTTGGTTCCCGAGCAGGGCGTTAAATTAACCCCTCGTCATTACGCTTATCTAAAAATTTCTGAAGGTTGTAATCACCGTTGTACTTTTTGCATTATTCCTTCAATGCGAGGTGATTTAGACAGTCGCCCAATTGGTGAAGTGTTAAATGAAGCGAAAAGATTAGTCAATGCTGGGGTGAAAGAGTTACTGGTTATCTCACAAGATACTTCCGCTTATGGAGTTGATACCAAACATCAAACCGGTTTTTGGGATGGTATGCCCGTTAAAACCAGTATGGTCAGTTTATGTGAACAACTGGCAAAATTAGGGATTTGGGTACGTTTACATTATGTTTACCCTTATCCACATGTGGATGAGGTTATTCCATTAATGGCAGAAGGCAAAATTTTGCCTTATTTAGATATTCCGCTACAACACGCTAGCCCGAAAGTGCTGAAATTAATGAAGCGCCCAGGCTCTGTTGAGCGTACTTTAGAGCGTGTAAAACGTTGGCGAGAAATTTGTCCTGAATTAACGTTACGTTCAACCTTTATTGTCGGTTTCCCGGGAGAAACAGAAGAAGATTTCCAAATGCTATTGGATTTCTTAACCGAAGCTCGTTTAGATCGCGTGGGTTGTTTTAAGTATAGCCCCGTTGAAGGTGCGAAAGCGAATGAATTACCTGATCAAGTTCCTGAAGAGGTAAAAGAAGAGCGTTACCATCGTTTTATGCAACTACAGCAACAAATTTCCACCGAGCGTCTGCAAGAGAAAATAGGTAAAGTTTTACCGGTTATCATTGATGAAGTGGATGAAGAAGGTGCTATTGGCCGTAGTATGGCGGATGCACCGGAAATTGATGGTGCTGTTTACCTTAATGAGCAGTTTGATGTCGAGCCAGGACAGATTGTACGTGTGCTAATTGAGCATGCCGATGAATATGATCTGTGGGGTACCATCGTCGAACAATAATTTATCCTGTGTACAGCGTGATAACTATTCTATTGCGCTGTTACACATTG