Homologs in group_892

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04660 FBDBKF_04660 96.0 Morganella morganii S1 rimO 30S ribosomal protein S12 methylthiotransferase RimO
EHELCC_05950 EHELCC_05950 96.0 Morganella morganii S2 rimO 30S ribosomal protein S12 methylthiotransferase RimO
NLDBIP_06270 NLDBIP_06270 96.0 Morganella morganii S4 rimO 30S ribosomal protein S12 methylthiotransferase RimO
LHKJJB_03150 LHKJJB_03150 96.0 Morganella morganii S3 rimO 30S ribosomal protein S12 methylthiotransferase RimO
HKOGLL_06625 HKOGLL_06625 96.0 Morganella morganii S5 rimO 30S ribosomal protein S12 methylthiotransferase RimO
PMI_RS15730 PMI_RS15730 86.7 Proteus mirabilis HI4320 rimO 30S ribosomal protein S12 methylthiotransferase RimO

Distribution of the homologs in the orthogroup group_892

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_892

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F137 0.0 812 86 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Proteus mirabilis (strain HI4320)
Q6D3N6 0.0 781 84 1 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2TV93 0.0 776 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q323V7 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella boydii serotype 4 (strain Sb227)
B1LMD0 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain SMS-3-5 / SECEC)
B6I8F5 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain SE11)
B7NAI1 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AEI4 0.0 775 85 1 435 1 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain K12)
B1IXD2 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY97 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O9:H4 (strain HS)
B1X7X6 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain K12 / DH10B)
B7M7B0 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O8 (strain IAI1)
B7NNR8 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSC6 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AEI5 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O157:H7
B7LCB8 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain 55989 / EAEC)
A7ZJQ2 0.0 775 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LMZ9 0.0 775 84 2 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MF19 0.0 775 83 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cronobacter sakazakii (strain ATCC BAA-894)
Q8ZQM1 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TQZ6 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella schwarzengrund (strain CVM19633)
B5BBX8 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi A (strain AKU_12601)
B4T0B2 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella newport (strain SL254)
B5QXV6 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella enteritidis PT4 (strain P125109)
B5FPB9 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella dublin (strain CT_02021853)
Q57RA8 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella choleraesuis (strain SC-B67)
B5F0X7 0.0 774 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella agona (strain SL483)
Q83LT1 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella flexneri
Q1RE90 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain UTI89 / UPEC)
Q8FJK5 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJL3 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A974 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O1:K1 / APEC
B7MQT8 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O81 (strain ED1a)
B7MGU2 0.0 774 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3Z3U9 0.0 773 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella sonnei (strain Ss046)
Q0T6C8 0.0 773 85 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella flexneri serotype 5b (strain 8401)
Q8Z861 0.0 773 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella typhi
B5R840 0.0 771 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MIP6 0.0 771 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5PGP7 0.0 770 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MSQ9 0.0 769 83 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TCV0 0.0 769 83 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella heidelberg (strain SL476)
A8AIT5 0.0 768 83 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6T6T1 0.0 768 82 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYQ3 0.0 767 82 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Klebsiella pneumoniae (strain 342)
A0KHZ9 0.0 766 81 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SKK7 0.0 763 80 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aeromonas salmonicida (strain A449)
A5F514 0.0 716 74 2 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KNW0 0.0 715 73 2 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0BRW2 0.0 703 73 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2T4 0.0 703 73 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q15UT4 0.0 702 73 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B3H2N3 0.0 702 73 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q7VKK2 0.0 701 73 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B3PGP3 0.0 699 75 2 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cellvibrio japonicus (strain Ueda107)
Q0I4D9 0.0 696 72 3 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Histophilus somni (strain 129Pt)
A6VLD6 0.0 695 72 3 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CKN9 0.0 695 72 3 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pasteurella multocida (strain Pm70)
B0US28 0.0 695 72 3 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Histophilus somni (strain 2336)
Q7MG88 0.0 690 73 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio vulnificus (strain YJ016)
Q8D4N8 0.0 687 73 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio vulnificus (strain CMCP6)
A1RNY7 0.0 682 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain W3-18-1)
Q65QA6 0.0 680 74 3 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A9KZF7 0.0 679 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS195)
A4Y2Z8 0.0 679 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WIP6 0.0 678 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS185)
Q0HZF3 0.0 678 71 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain MR-7)
Q0HEK0 0.0 678 71 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain MR-4)
A0L1C8 0.0 676 70 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain ANA-3)
A3D958 0.0 676 70 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8EA37 0.0 674 71 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1U488 0.0 672 71 3 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2SBG3 0.0 670 72 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hahella chejuensis (strain KCTC 2396)
A1S2T9 0.0 669 71 1 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B4RYE6 0.0 663 72 1 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q7VS95 0.0 656 72 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1U6 0.0 656 72 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQS2 0.0 651 72 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A4VKC4 0.0 647 70 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stutzerimonas stutzeri (strain A1501)
Q484J7 0.0 644 72 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A9IFP1 0.0 644 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q9I541 0.0 643 70 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02I76 0.0 643 70 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain UCBPP-PA14)
A4XT11 0.0 640 69 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas mendocina (strain ymp)
Q2RQI7 0.0 637 69 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q31G14 0.0 637 67 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4KHA5 0.0 636 69 3 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3SI16 0.0 635 69 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thiobacillus denitrificans (strain ATCC 25259)
Q2Y7J7 0.0 635 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A6VA58 0.0 634 69 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain PA7)
B7I9V4 0.0 634 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AB0057)
A3M659 0.0 632 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VMU3 0.0 632 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain SDF)
B2I330 0.0 632 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain ACICU)
B0V6E8 0.0 632 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AYE)
B7H1U1 0.0 632 67 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AB307-0294)
Q1I6D1 0.0 631 69 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas entomophila (strain L48)
Q21FE3 0.0 630 67 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3KH22 0.0 630 69 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas fluorescens (strain Pf0-1)
B0KTL0 0.0 628 69 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain GB-1)
Q82VY8 0.0 628 67 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B1JD88 0.0 628 68 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain W619)
Q88NL0 0.0 625 68 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VZS9 0.0 625 68 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q6FCH4 0.0 625 67 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7NYA1 0.0 624 66 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1H0X3 0.0 623 66 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q48FA7 0.0 622 68 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZWM9 0.0 621 68 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas syringae pv. syringae (strain B728a)
Q60CM4 0.0 620 66 2 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B6IRQ0 0.0 620 67 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodospirillum centenum (strain ATCC 51521 / SW)
Q47CF0 0.0 619 66 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dechloromonas aromatica (strain RCB)
Q87Y01 0.0 617 67 4 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0AG95 0.0 614 68 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2SWC0 0.0 612 67 5 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q1LNN2 0.0 612 64 6 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1K487 0.0 612 66 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Azoarcus sp. (strain BH72)
Q8P7P7 0.0 612 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RR62 0.0 612 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain B100)
Q4UWF3 0.0 612 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain 8004)
Q5GXP5 0.0 610 67 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P0S4 0.0 610 67 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5P1L3 0.0 610 66 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8XYX0 0.0 609 64 5 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2UFU5 0.0 604 64 5 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ralstonia pickettii (strain 12J)
Q8PJ10 0.0 604 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas axonopodis pv. citri (strain 306)
Q3BRJ5 0.0 601 67 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q472G1 0.0 600 63 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B3R4X7 0.0 599 63 5 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q5ZXP6 0.0 598 64 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B2JG80 0.0 598 63 6 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0KBP2 0.0 598 64 5 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1BGU5 0.0 598 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia orbicola (strain AU 1054)
A0K7Q6 0.0 598 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia cenocepacia (strain HI2424)
B1JT65 0.0 597 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia orbicola (strain MC0-3)
Q39FU0 0.0 597 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B2T3U5 0.0 597 63 6 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B4EAF5 0.0 597 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q2W2S4 0.0 596 64 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q13Z56 0.0 596 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia xenovorans (strain LB400)
Q5WYL5 0.0 596 64 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Lens)
Q98MN9 0.0 595 63 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A9AH21 0.0 595 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BEZ5 0.0 595 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YR17 0.0 594 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia ambifaria (strain MC40-6)
A5IGM4 0.0 593 64 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Corby)
Q5X765 0.0 593 64 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Paris)
A4JEL4 0.0 593 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q4FRH4 0.0 593 63 3 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QA11 0.0 592 63 3 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0A8I9 0.0 592 65 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B2FP10 0.0 591 64 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stenotrophomonas maltophilia (strain K279a)
A5WGF2 0.0 590 61 4 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter sp. (strain PRwf-1)
Q2SWB9 0.0 590 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B4SQX0 0.0 589 64 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stenotrophomonas maltophilia (strain R551-3)
Q63UQ8 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain K96243)
A3NA26 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 668)
Q3JRT1 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 1710b)
A3NVU2 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 1106a)
A5VUQ0 0.0 586 64 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FW94 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella suis biovar 1 (strain 1330)
A9WYN5 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YC29 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBK6 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q577W6 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus biovar 1 (strain 9-941)
Q2YKI5 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus (strain 2308)
B2SB89 0.0 585 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus (strain S19)
A1V4H3 0.0 584 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain SAVP1)
Q62JZ1 0.0 584 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain ATCC 23344)
A2S2C9 0.0 584 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain NCTC 10229)
A3MK46 0.0 584 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain NCTC 10247)
A6X529 0.0 582 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A6SXU1 0.0 580 62 5 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Janthinobacterium sp. (strain Marseille)
B0UQE6 0.0 579 63 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacterium sp. (strain 4-46)
B1ZEV4 0.0 578 64 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B7L2K9 0.0 576 63 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A4G6D4 0.0 576 62 4 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Herminiimonas arsenicoxydans
A9W8D2 0.0 575 63 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum extorquens (strain PA1)
A8I0G1 0.0 573 63 2 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A2SG87 0.0 572 60 5 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A4YUI3 0.0 571 63 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium sp. (strain ORS 278)
Q89LG9 0.0 570 63 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A4SXC8 0.0 570 66 5 419 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A5EJ58 0.0 569 62 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A7INV0 0.0 569 62 2 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B1M6H4 0.0 565 62 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q214L6 0.0 565 62 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisB18)
Q2NDN5 0.0 564 60 6 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Erythrobacter litoralis (strain HTCC2594)
B7J3M4 0.0 562 61 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q6N6E2 0.0 561 62 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A9IUA4 0.0 561 61 3 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bartonella tribocorum (strain CIP 105476 / IBS 506)
B3QIV5 0.0 561 62 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain TIE-1)
B1Y223 0.0 560 60 5 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B2IHC3 0.0 557 60 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A9BVZ2 0.0 556 60 6 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Delftia acidovorans (strain DSM 14801 / SPH-1)
Q6G5E0 0.0 556 61 5 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q07M57 0.0 555 61 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisA53)
A0Q4U9 0.0 555 59 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. novicida (strain U112)
B6JF93 0.0 555 62 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q136X7 0.0 555 62 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisB5)
Q2IW68 0.0 555 62 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain HaA2)
A5V3Z4 0.0 555 61 2 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q72JG1 0.0 552 61 2 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B1XUT6 0.0 552 61 6 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q1J1F6 0.0 552 60 6 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A1TMP4 0.0 551 63 5 422 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paracidovorax citrulli (strain AAC00-1)
B5EK28 0.0 551 60 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
Q1GV83 0.0 551 62 5 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A8LI17 0.0 550 61 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A1WAJ7 0.0 550 59 7 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidovorax sp. (strain JS42)
Q5SJ39 0.0 550 61 2 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q12A25 0.0 549 61 5 426 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5NPC9 0.0 548 59 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B0U054 0.0 546 58 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q5LUV8 0.0 545 62 4 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A1VQ18 0.0 544 60 5 429 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polaromonas naphthalenivorans (strain CJ2)
Q0C0U1 0.0 542 59 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hyphomonas neptunium (strain ATCC 15444)
A4WRD4 0.0 542 63 4 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q21X03 0.0 540 61 5 426 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2GA32 0.0 539 59 5 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A3PIG0 0.0 539 63 4 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q28TN0 0.0 538 60 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Jannaschia sp. (strain CCS1)
Q3J3Y8 0.0 535 62 4 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q169Q9 0.0 533 60 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A1WMV5 0.0 530 59 5 428 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Verminephrobacter eiseniae (strain EF01-2)
A1B3K8 0.0 530 61 6 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paracoccus denitrificans (strain Pd 1222)
Q1GIY4 0.0 530 60 6 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ruegeria sp. (strain TM1040)
Q9RYW7 0.0 528 57 6 467 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0BNJ1 3.69e-170 487 63 1 345 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. holarctica (strain OSU18)
A7NA32 3.69e-170 487 63 1 345 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5D2R3 5.96e-110 334 41 9 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q18BJ2 4.92e-103 317 39 8 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridioides difficile (strain 630)
A9WDA3 2.68e-102 315 40 12 469 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q2JK17 4.12e-102 315 40 7 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6MGT1 8.02e-102 314 39 9 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A7NIS8 1.96e-101 314 38 10 472 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q0AXI3 2.7e-101 312 40 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q55803 3.33e-101 312 40 9 452 2 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1DC90 4.53e-101 313 40 11 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Myxococcus xanthus (strain DK1622)
Q2JSD0 1.04e-100 311 39 9 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain JA-3-3Ab)
Q67NX5 1.38e-100 311 42 15 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8DIL8 2.05e-100 310 39 9 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A4XLD9 5.14e-100 308 38 9 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q24W37 5.31e-100 309 40 11 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfitobacterium hafniense (strain Y51)
Q7UK39 1.92e-99 308 39 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8YXJ1 5.96e-99 306 38 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A4J5U4 6.58e-99 306 39 9 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B5YKD1 1.7e-98 304 39 9 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8RA52 4.83e-98 303 40 10 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3MFH1 7.86e-98 303 38 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3A8J5 8.52e-98 303 40 15 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B2IVR7 1.02e-97 303 38 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1IPQ5 1.06e-97 305 37 12 492 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Koribacter versatilis (strain Ellin345)
Q5N1N6 1.14e-97 303 39 12 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q2RJK1 1.14e-97 302 42 13 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B0JJS5 1.17e-97 302 40 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q935Y2 1.54e-97 303 39 12 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6TRJ4 3.78e-97 301 38 10 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkaliphilus metalliredigens (strain QYMF)
B7KDB6 6.13e-97 301 38 9 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Gloeothece citriformis (strain PCC 7424)
B0K9N5 1.21e-96 300 37 7 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A9AZS3 2.07e-96 300 37 12 480 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A5UQQ2 4.41e-96 300 38 12 467 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseiflexus sp. (strain RS-1)
A0L887 4.87e-96 300 38 8 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B4S8Z6 6.3e-96 298 40 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B0K1C1 7.76e-96 298 38 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermoanaerobacter sp. (strain X514)
O67016 8.01e-96 298 42 12 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aquifex aeolicus (strain VF5)
A6LSR6 1.15e-95 298 38 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B2V4I1 1.2e-95 298 38 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Alaska E43 / Type E3)
Q7U477 1.42e-95 298 39 10 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Parasynechococcus marenigrum (strain WH8102)
Q6MBU9 2.47e-95 298 37 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Protochlamydia amoebophila (strain UWE25)
A9F1Y8 3.36e-95 298 40 13 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sorangium cellulosum (strain So ce56)
B3QSS3 3.49e-95 296 38 9 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q747R0 3.52e-95 296 39 10 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A3DDZ7 3.98e-95 296 37 9 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B2TJ67 5.1e-95 296 38 12 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Eklund 17B / Type B)
B1XPZ7 7.9e-95 295 37 8 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A5N854 1.33e-94 295 38 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q7V3H3 1.49e-94 295 36 10 463 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A2BNP5 1.89e-94 295 36 10 463 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain AS9601)
B1WUD1 3.06e-94 294 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2IM41 3.12e-94 295 41 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter dehalogenans (strain 2CP-C)
A3PAG5 5.44e-94 293 37 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9301)
Q31D78 7.27e-94 293 36 10 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9312)
A5GQP4 1.36e-93 294 39 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain RCC307)
A5FA30 1.62e-93 292 38 9 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q11XC6 2.22e-93 291 37 10 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q10Y85 2.27e-93 291 36 7 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichodesmium erythraeum (strain IMS101)
A5GNW7 3.38e-93 292 38 9 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain WH7803)
A9KLS2 3.42e-93 291 37 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B7JV66 4.65e-93 291 39 9 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rippkaea orientalis (strain PCC 8801 / RF-1)
Q7V8Z5 6.22e-93 291 39 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9313)
Q3AH63 6.45e-93 291 39 10 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9605)
A1ATL9 8.85e-93 290 40 15 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A2C661 1.25e-92 291 39 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9303)
B3EAM2 1.71e-92 290 39 12 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q0I735 1.82e-92 290 39 11 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9311)
Q6AQ27 2.86e-92 289 39 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A0M3K8 4.17e-92 289 37 10 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A2BU62 8.56e-92 288 37 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9515)
A6GZF6 1.13e-91 287 38 9 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q3B002 1.24e-91 288 38 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9902)
A0Q0P6 1.58e-91 287 36 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium novyi (strain NT)
B4UKQ2 1.65e-91 288 41 12 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter sp. (strain K)
A8G2A6 2.46e-91 287 36 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9215)
B0TIH8 1.01e-90 285 40 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A7H6G8 1.28e-90 285 40 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter sp. (strain Fw109-5)
A9BCV9 2.23e-90 285 38 11 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9211)
Q97I40 2.78e-90 284 36 7 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A5GBX9 3.45e-90 284 39 10 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geotalea uraniireducens (strain Rf4)
B5ED60 3.45e-90 284 38 12 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q8XJS9 6.44e-90 283 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain 13 / Type A)
Q0TPS8 6.44e-90 283 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3ACX5 6.8e-90 283 36 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0SSE5 8.33e-90 283 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain SM101 / Type A)
B1LAG0 1.18e-89 281 37 6 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga sp. (strain RQ2)
Q7NDB8 2.98e-89 281 36 8 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A5IL80 3.61e-89 280 37 7 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X2H6 3.65e-89 280 37 7 440 1 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A7GFZ4 3.68e-89 281 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1II37 3.68e-89 281 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Okra / Type B1)
Q8KCL7 3.81e-89 280 38 9 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9Z8T3 4.19e-89 281 37 11 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia pneumoniae
Q254N4 4.32e-89 281 36 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia felis (strain Fe/C-56)
B1ZW93 6.16e-89 281 38 11 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A5I4I1 2.8e-88 278 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FVY1 2.8e-88 278 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain ATCC 19397 / Type A)
B2V8N8 3.5e-88 278 38 13 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurihydrogenibium sp. (strain YO3AOP1)
B3QMN0 3.81e-88 278 38 9 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q39QQ6 4.26e-88 278 38 13 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A6LAJ6 6.91e-88 277 37 12 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q028J0 7.14e-88 278 37 12 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Solibacter usitatus (strain Ellin6076)
B4SBD5 7.56e-88 277 38 9 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B1KWJ5 1.5e-87 277 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Loch Maree / Type A3)
A8MLX7 1.99e-87 276 36 13 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkaliphilus oremlandii (strain OhILAs)
B3EPX5 3.85e-87 276 39 11 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeobacteroides (strain BS1)
A8F8W3 4.19e-87 275 37 7 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q895I7 4.85e-87 275 36 11 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium tetani (strain Massachusetts / E88)
B4U6U1 5.4e-87 274 39 10 411 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hydrogenobaculum sp. (strain Y04AAS1)
Q8A9A2 7.34e-87 275 36 12 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B2A3C0 9.04e-87 275 36 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A6L5E7 3.24e-86 273 36 14 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q823A0 3.78e-86 273 35 10 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q64TK5 3.81e-86 273 37 11 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides fragilis (strain YCH46)
Q5LCF8 3.81e-86 273 37 11 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6LM59 4e-86 273 37 8 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q5L5W7 8.63e-86 273 36 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia abortus (strain DSM 27085 / S26/3)
A4SFH7 3.73e-85 270 36 10 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B0CB83 4.33e-85 270 35 9 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acaryochloris marina (strain MBIC 11017)
B1I310 6.26e-85 270 37 9 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulforudis audaxviator (strain MP104C)
Q3ASP1 6.42e-85 270 37 7 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium chlorochromatii (strain CaD3)
Q7VE92 1.66e-83 266 35 9 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B3EDL2 2.27e-83 265 38 8 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A9A0B5 8.4e-83 264 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B7ID25 9.61e-83 264 36 8 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosipho africanus (strain TCF52B)
B3DYX1 1.74e-82 264 34 8 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylacidiphilum infernorum (isolate V4)
Q2LQ68 2.88e-82 263 36 13 463 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophus aciditrophicus (strain SB)
A0LIM0 8.01e-82 262 36 13 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2ULZ9 8.62e-82 262 37 12 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B2KB59 1.55e-81 261 34 8 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Elusimicrobium minutum (strain Pei191)
B5YF65 1.5e-80 258 34 8 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B2RHD7 3.44e-79 255 35 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q3B317 4.02e-79 255 36 9 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q7MXM3 2.66e-78 253 35 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A9BEU9 4.66e-78 252 35 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Petrotoga mobilis (strain DSM 10674 / SJ95)
A1BHA0 9.17e-78 251 36 9 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A7HMK2 1.3e-77 251 34 9 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q1MQJ5 1.03e-76 248 35 12 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Lawsonia intracellularis (strain PHE/MN1-00)
Q47RT4 3.6e-75 246 34 10 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermobifida fusca (strain YX)
Q72PC8 3.35e-74 242 34 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q6A908 5.22e-74 243 34 12 477 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q82K95 5.3e-74 243 32 11 482 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8F710 1.16e-73 241 33 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q726F7 2.66e-73 239 37 15 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1V9Z2 3.41e-73 239 37 15 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratidesulfovibrio vulgaris (strain DP4)
O86812 1.34e-72 239 32 12 480 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8ERB7 6.53e-72 236 35 14 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aliarcobacter butzleri (strain RM4018)
A4X4R3 8.2e-72 238 31 12 491 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q04R21 1.48e-71 235 33 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A8M773 1.52e-71 237 31 14 503 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salinispora arenicola (strain CNS-205)
Q04ZD0 1.56e-71 235 33 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
A6Q526 2.62e-70 232 33 13 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratiruptor sp. (strain SB155-2)
A4FLZ0 2.97e-70 233 32 9 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q2J750 5.49e-70 233 33 13 494 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q315T9 5.49e-70 231 37 13 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B1VXY2 4.92e-69 230 32 13 485 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A6W833 7.83e-69 229 33 12 486 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B0SPT9 3.95e-68 226 32 9 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SGD8 3.95e-68 226 32 9 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q9ZEN7 1.19e-67 225 35 10 422 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B1GZH1 1.51e-67 224 31 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Endomicrobium trichonymphae
Q73JG6 5.5e-66 221 32 12 467 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A6QCC6 5.5e-66 221 30 10 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurovum sp. (strain NBC37-1)
A0RQM9 2.37e-65 219 33 12 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter fetus subsp. fetus (strain 82-40)
A1SJ39 3.96e-65 219 30 11 484 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nocardioides sp. (strain ATCC BAA-499 / JS614)
B1VXU5 8.78e-65 219 33 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A0LV11 9.19e-65 218 32 10 466 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q30PS0 1.58e-64 217 31 11 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
D5ZT17 3.27e-64 218 33 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces viridosporus (strain ATCC 14672 / DSM 40746 / JCM 4963 / KCTC 9882 / NRRL B-12104 / FH 1290)
B1VDD8 7.16e-64 218 32 9 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
A0QVX5 7.35e-64 217 33 11 447 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O69963 8.43e-64 217 32 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A7I0P9 1.36e-63 214 35 16 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q83FT9 2.06e-63 215 32 9 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Tropheryma whipplei (strain Twist)
Q83HG3 3.08e-63 214 32 9 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Tropheryma whipplei (strain TW08/27)
Q82KC4 5.62e-63 214 32 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A1T7U2 7.31e-62 212 32 11 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B1MD05 9.47e-62 211 33 11 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q0RDV0 1.42e-61 212 34 11 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A1W162 1.56e-61 209 33 11 415 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7ZE21 1.57e-61 209 33 17 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter concisus (strain 13826)
Q47RR8 1.98e-61 210 31 10 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Thermobifida fusca (strain YX)
A4TCM9 2.18e-61 211 32 11 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium gilvum (strain PYR-GCK)
Q4JV79 2.55e-61 210 33 11 439 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium jeikeium (strain K411)
Q7VGL0 4.48e-61 208 33 8 362 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q5HSX7 8.12e-61 207 33 12 417 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni (strain RM1221)
A8FNC1 1.21e-60 207 33 11 415 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A0LV00 1.26e-60 208 32 10 437 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q0P8G1 1.85e-60 206 33 11 415 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q6NGR0 5.68e-60 207 30 15 468 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A7H5G3 1.36e-59 204 33 11 415 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1SNG0 1.85e-58 202 30 11 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8FPD5 2.07e-58 203 30 11 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A1UEZ3 2.27e-58 203 32 15 479 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain KMS)
A0JUY6 2.86e-58 202 31 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Arthrobacter sp. (strain FB24)
Q1BA19 3.24e-58 202 32 15 479 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain MCS)
B2UT98 3.55e-58 200 32 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain Shi470)
Q2N950 8.37e-58 199 31 12 447 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Erythrobacter litoralis (strain HTCC2594)
B3CV38 1.87e-57 198 30 9 450 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Orientia tsutsugamushi (strain Ikeda)
A3PYF3 3.01e-57 200 31 15 480 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain JLS)
B2HL08 3.39e-57 200 30 9 449 3 miaB2 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 2 Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PT87 3.54e-57 200 30 9 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium ulcerans (strain Agy99)
A5CC78 8.49e-57 197 29 9 450 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Orientia tsutsugamushi (strain Boryong)
Q17XY7 1.01e-56 196 32 10 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter acinonychis (strain Sheeba)
Q8FXU4 1.07e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis biovar 1 (strain 1330)
A9M9Y3 1.07e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57AB1 1.07e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQS8 1.07e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain 2308)
B2S9E5 1.07e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain S19)
A9WQ47 1.17e-56 198 31 13 461 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B6JLW7 1.2e-56 196 31 9 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain P12)
B0CK00 1.21e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VTA1 1.36e-56 197 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q5YT08 1.39e-56 197 32 13 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nocardia farcinica (strain IFM 10152)
P67086 1.56e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B3E0M0 1.56e-56 196 27 10 435 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylacidiphilum infernorum (isolate V4)
Q9ZLA9 2.16e-56 195 32 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain J99 / ATCC 700824)
A1R550 2.24e-56 197 31 12 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Paenarthrobacter aurescens (strain TC1)
B1ZJR5 2.31e-56 196 31 14 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A4FAJ1 3.07e-56 196 30 11 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
P9WK05 4.39e-56 197 30 10 449 1 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK04 4.39e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U685 4.39e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KM71 4.39e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q1CTD7 4.51e-56 194 31 9 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain HPAG1)
A5CSL5 5.3e-56 196 30 9 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A9VYZ9 5.52e-56 194 31 15 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum extorquens (strain PA1)
Q2J2K9 8.14e-56 194 31 15 461 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain HaA2)
B3PZB6 8.59e-56 194 31 13 464 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium etli (strain CIAT 652)
Q8YEA2 9.42e-56 194 33 19 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A6WWX6 9.87e-56 194 32 14 447 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A4QEV7 1.31e-55 196 29 11 455 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium glutamicum (strain R)
B0RGZ1 1.59e-55 195 30 9 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clavibacter sepedonicus
Q3ACA4 2.3e-55 192 30 12 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7HZ82 2.49e-55 193 32 10 462 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q6ALW9 2.72e-55 192 30 11 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5FPF1 2.75e-55 193 31 9 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Gluconobacter oxydans (strain 621H)
B7KVE0 2.86e-55 192 31 14 451 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q2KD88 3.07e-55 193 31 13 457 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B5Z796 4.62e-55 192 31 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain G27)
Q8RG43 1.48e-54 191 28 13 450 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8NP67 1.51e-54 192 29 11 455 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O25434 2.45e-54 190 31 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain ATCC 700392 / 26695)
B7GQG0 3.07e-54 191 30 15 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B1LWE8 3.68e-54 190 30 14 464 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B5ZMY1 4.14e-54 190 31 13 455 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A8F716 4.75e-54 189 29 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B6JCT6 4.75e-54 190 31 16 467 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A8F011 5.65e-54 189 30 12 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia canadensis (strain McKiel)
B2IIK5 7.5e-54 191 30 8 407 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1GRE9 7.55e-54 189 31 14 416 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B2V930 9.5e-54 188 29 10 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
A1A280 1.64e-53 189 31 16 457 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q92SI7 1.66e-53 189 29 11 461 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium meliloti (strain 1021)
O66638 2.2e-53 187 30 8 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aquifex aeolicus (strain VF5)
Q4UK06 2.49e-53 187 30 13 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GTT8 2.52e-53 187 30 12 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia rickettsii (strain Sheila Smith)
B0BVC7 2.52e-53 187 30 12 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia rickettsii (strain Iowa)
Q0S1P3 2.67e-53 189 31 13 436 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodococcus jostii (strain RHA1)
A6QCD0 3e-53 187 30 11 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sulfurovum sp. (strain NBC37-1)
Q6AE03 3.45e-53 189 30 9 441 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Leifsonia xyli subsp. xyli (strain CTCB07)
A1B8C4 5.12e-53 187 30 13 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Paracoccus denitrificans (strain Pd 1222)
Q8G4H4 5.97e-53 187 30 15 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium longum (strain NCC 2705)
B3DQX6 6.83e-53 187 30 15 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium longum (strain DJO10A)
B2HGN2 7.5e-53 188 32 15 460 3 miaB1 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 1 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q92G77 8.36e-53 186 30 12 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q30PR1 9.35e-53 186 29 8 428 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q73W15 1.11e-52 187 29 9 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A8F2U6 1.26e-52 186 30 12 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia massiliae (strain Mtu5)
A6W848 1.33e-52 187 31 12 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q11BD9 1.62e-52 186 31 14 461 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Chelativorans sp. (strain BNC1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09110
Feature type CDS
Gene rimO
Product 30S ribosomal protein S12 methylthiotransferase RimO
Location 1904705 - 1906045 (strand: -1)
Length 1341 (nucleotides) / 446 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_892
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00919 Uncharacterized protein family UPF0004
PF04055 Radical SAM superfamily
PF18693 TRAM domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0621 Translation, ribosomal structure and biogenesis (J) J tRNA A37 methylthiotransferase MiaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14441 ribosomal protein S12 methylthiotransferase [EC:2.8.4.4] - -

Protein Sequence

MSQNTNTVPKVGFVSLGCPKNLVDSERILTELRTDGYQVVPSYDDADVVIVNTCGFIDSAVQESLEAIGEALAENGKVIVTGCLGAKEDQIRQVHPNVLEITGPHSYEQVLASVRKYVPKPAHDPFTSLVPAQGVKLTPRHYAYLKISEGCNHRCTFCIIPSMRGDLDSRPVGEVLGEAQRLVESGVKELLVISQDTSAYGADIKHRTGFRDGLPVKTSMIGLCEQLSQLGVWIRLHYVYPYPHVDDVIPLMAEGKVLPYLDIPLQHASPRILKLMKRPGAVERTLERIKRWREICPELTLRSTFIVGFPGETEEDFQMLLDFLTEARLDRVGCFKYSPVEGAKANELPDPVPEEIQEERYHRFMQLQQKISTERLAEKIGRVLPVIIDEVDEDEGAVGRSMADAPEIDGMVYLNGEFDVQPGDIVMVKIEHSDEYDLWGSVVREA

Flanking regions ( +/- flanking 50bp)

GATTTTGCAGTAACGTACTGTGTATCCTGCCTTTTTGAGTAAATGAGCTTATGTCGCAAAATACCAACACCGTGCCGAAAGTCGGTTTCGTCTCTTTAGGCTGCCCGAAAAACTTAGTGGACTCCGAACGTATCCTGACTGAACTGCGTACTGATGGTTATCAGGTCGTGCCGAGTTATGACGATGCCGATGTGGTGATCGTCAATACCTGTGGCTTTATCGACAGCGCTGTGCAGGAGTCGCTGGAAGCTATCGGCGAGGCGCTGGCAGAAAATGGTAAAGTCATTGTTACCGGGTGTCTGGGCGCGAAAGAAGATCAAATCCGTCAGGTGCATCCGAACGTGCTGGAGATAACCGGTCCGCACAGCTATGAGCAAGTGCTGGCGAGTGTCCGTAAATATGTGCCGAAACCGGCGCATGACCCGTTCACCAGCCTGGTGCCGGCGCAGGGTGTGAAACTGACCCCGCGTCATTATGCGTATCTGAAGATTTCAGAGGGCTGTAATCACCGCTGCACATTCTGCATTATTCCGTCCATGCGCGGCGATCTCGACAGCCGTCCGGTAGGCGAAGTGCTGGGTGAAGCTCAGCGCCTGGTTGAGTCCGGCGTAAAAGAGTTGCTGGTGATTTCGCAGGATACATCCGCTTATGGTGCGGATATCAAACACCGCACCGGGTTCCGCGATGGTCTGCCGGTGAAAACCAGTATGATCGGTCTGTGTGAACAGTTGTCACAACTGGGTGTCTGGATCCGCCTGCATTATGTGTATCCGTATCCGCATGTGGATGATGTGATCCCGCTGATGGCTGAAGGTAAAGTGCTGCCGTATCTGGATATTCCGTTACAGCACGCCAGCCCGCGTATTCTTAAATTAATGAAACGTCCGGGCGCGGTAGAGCGCACACTTGAGCGCATCAAACGCTGGCGGGAAATTTGTCCGGAACTGACACTGCGCTCTACCTTTATTGTCGGCTTCCCGGGTGAAACAGAAGAAGATTTTCAGATGCTGCTGGATTTCCTGACCGAAGCGCGTCTGGATCGCGTTGGCTGCTTTAAATACAGCCCGGTGGAAGGTGCAAAGGCAAACGAATTGCCGGACCCTGTACCGGAAGAGATTCAGGAAGAGCGCTATCATCGCTTTATGCAGTTACAGCAGAAGATTTCTACCGAACGTCTGGCAGAAAAAATCGGTCGTGTTCTGCCGGTGATTATTGATGAAGTGGATGAAGATGAAGGTGCTGTCGGGCGCAGCATGGCAGATGCGCCGGAAATTGACGGTATGGTTTATCTGAACGGTGAGTTCGATGTGCAGCCCGGTGATATTGTGATGGTTAAGATTGAACATTCGGATGAGTACGATCTCTGGGGCAGTGTGGTGCGCGAAGCATGACAGCCGGTGACAACCGTGTGTTTAACCGGCTGATGTTCGGTAACGATCCC