Homologs in group_892

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_05950 EHELCC_05950 100.0 Morganella morganii S2 rimO 30S ribosomal protein S12 methylthiotransferase RimO
NLDBIP_06270 NLDBIP_06270 100.0 Morganella morganii S4 rimO 30S ribosomal protein S12 methylthiotransferase RimO
LHKJJB_03150 LHKJJB_03150 100.0 Morganella morganii S3 rimO 30S ribosomal protein S12 methylthiotransferase RimO
HKOGLL_06625 HKOGLL_06625 100.0 Morganella morganii S5 rimO 30S ribosomal protein S12 methylthiotransferase RimO
F4V73_RS09110 F4V73_RS09110 96.0 Morganella psychrotolerans rimO 30S ribosomal protein S12 methylthiotransferase RimO
PMI_RS15730 PMI_RS15730 88.5 Proteus mirabilis HI4320 rimO 30S ribosomal protein S12 methylthiotransferase RimO

Distribution of the homologs in the orthogroup group_892

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_892

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F137 0.0 822 88 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Proteus mirabilis (strain HI4320)
B2TV93 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q323V7 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella boydii serotype 4 (strain Sb227)
Q6D3N6 0.0 792 85 1 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7LMZ9 0.0 792 86 2 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LMD0 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain SMS-3-5 / SECEC)
B6I8F5 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain SE11)
B7NAI1 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AEI4 0.0 792 87 1 435 1 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain K12)
B1IXD2 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY97 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O9:H4 (strain HS)
B1X7X6 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain K12 / DH10B)
B7M7B0 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O8 (strain IAI1)
B7NNR8 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSC6 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AEI5 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O157:H7
B7LCB8 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain 55989 / EAEC)
A7ZJQ2 0.0 792 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83LT1 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella flexneri
Q1RE90 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli (strain UTI89 / UPEC)
Q8FJK5 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJL3 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A974 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O1:K1 / APEC
B7MQT8 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O81 (strain ED1a)
B7MGU2 0.0 791 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3Z3U9 0.0 790 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella sonnei (strain Ss046)
Q0T6C8 0.0 790 87 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shigella flexneri serotype 5b (strain 8401)
Q8ZQM1 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TQZ6 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella schwarzengrund (strain CVM19633)
B5BBX8 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi A (strain AKU_12601)
B4T0B2 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella newport (strain SL254)
B5QXV6 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella enteritidis PT4 (strain P125109)
B5FPB9 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella dublin (strain CT_02021853)
Q57RA8 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella choleraesuis (strain SC-B67)
B5F0X7 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella agona (strain SL483)
A7MF19 0.0 790 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cronobacter sakazakii (strain ATCC BAA-894)
Q8Z861 0.0 789 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella typhi
B5R840 0.0 788 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PGP7 0.0 788 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MIP6 0.0 788 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TCV0 0.0 787 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella heidelberg (strain SL476)
A9MSQ9 0.0 786 86 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A8AIT5 0.0 785 85 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6T6T1 0.0 782 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYQ3 0.0 782 84 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Klebsiella pneumoniae (strain 342)
A0KHZ9 0.0 765 81 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SKK7 0.0 761 80 1 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aeromonas salmonicida (strain A449)
A5F514 0.0 720 74 2 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KNW0 0.0 720 74 2 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0BRW2 0.0 713 75 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2T4 0.0 713 75 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3H2N3 0.0 712 75 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0US28 0.0 708 74 3 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Histophilus somni (strain 2336)
Q0I4D9 0.0 708 74 3 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Histophilus somni (strain 129Pt)
Q7VKK2 0.0 707 74 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VLD6 0.0 706 74 3 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7MG88 0.0 705 75 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio vulnificus (strain YJ016)
Q15UT4 0.0 705 74 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9CKN9 0.0 705 73 3 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pasteurella multocida (strain Pm70)
Q8D4N8 0.0 701 75 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Vibrio vulnificus (strain CMCP6)
Q65QA6 0.0 691 75 3 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B3PGP3 0.0 689 74 2 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cellvibrio japonicus (strain Ueda107)
A1RNY7 0.0 688 72 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain W3-18-1)
A9KZF7 0.0 684 72 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS195)
Q0HZF3 0.0 684 71 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain MR-7)
Q0HEK0 0.0 684 71 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain MR-4)
A6WIP6 0.0 684 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS185)
A4Y2Z8 0.0 683 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EA37 0.0 682 72 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0L1C8 0.0 681 71 1 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella sp. (strain ANA-3)
A3D958 0.0 681 71 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1U488 0.0 680 72 3 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1S2T9 0.0 673 72 1 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2SBG3 0.0 671 73 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hahella chejuensis (strain KCTC 2396)
B4RYE6 0.0 666 73 1 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q7VS95 0.0 650 72 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1U6 0.0 650 72 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A9IFP1 0.0 649 71 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A4VKC4 0.0 648 71 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stutzerimonas stutzeri (strain A1501)
Q9I541 0.0 647 71 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02I76 0.0 647 71 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7WQS2 0.0 645 71 2 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B7I9V4 0.0 644 69 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AB0057)
Q3SI16 0.0 644 70 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thiobacillus denitrificans (strain ATCC 25259)
B0V6E8 0.0 642 69 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AYE)
A3M659 0.0 642 69 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VMU3 0.0 642 69 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain SDF)
B2I330 0.0 642 69 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain ACICU)
B7H1U1 0.0 642 69 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baumannii (strain AB307-0294)
A4XT11 0.0 641 70 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas mendocina (strain ymp)
Q31G14 0.0 641 68 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q484J7 0.0 639 71 1 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1I6D1 0.0 639 70 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas entomophila (strain L48)
A6VA58 0.0 637 70 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas aeruginosa (strain PA7)
Q4KHA5 0.0 637 70 3 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2RQI7 0.0 635 69 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B1JD88 0.0 634 69 3 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain W619)
Q88NL0 0.0 634 70 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VZS9 0.0 634 70 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q6FCH4 0.0 634 69 4 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0KTL0 0.0 633 70 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas putida (strain GB-1)
Q2Y7J7 0.0 632 68 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7NYA1 0.0 632 68 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3KH22 0.0 630 70 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas fluorescens (strain Pf0-1)
Q21FE3 0.0 628 67 3 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q48FA7 0.0 625 69 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZWM9 0.0 625 69 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas syringae pv. syringae (strain B728a)
Q60CM4 0.0 622 66 2 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1H0X3 0.0 621 67 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B6IRQ0 0.0 620 68 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodospirillum centenum (strain ATCC 51521 / SW)
Q87Y01 0.0 619 68 4 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q47CF0 0.0 619 66 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dechloromonas aromatica (strain RCB)
Q82VY8 0.0 619 67 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1LNN2 0.0 615 64 6 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8XYX0 0.0 613 65 5 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0AG95 0.0 612 68 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A1K487 0.0 612 66 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Azoarcus sp. (strain BH72)
B2SWC0 0.0 611 67 5 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q8P7P7 0.0 610 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RR62 0.0 610 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain B100)
Q4UWF3 0.0 610 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas campestris pv. campestris (strain 8004)
Q8PJ10 0.0 610 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas axonopodis pv. citri (strain 306)
Q5GXP5 0.0 609 67 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P0S4 0.0 609 67 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2UFU5 0.0 607 64 5 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ralstonia pickettii (strain 12J)
Q3BRJ5 0.0 607 68 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q4FRH4 0.0 605 65 3 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q5P1L3 0.0 605 66 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q1QA11 0.0 605 65 3 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q472G1 0.0 602 63 6 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B3R4X7 0.0 601 64 5 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q1BGU5 0.0 600 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia orbicola (strain AU 1054)
B1JT65 0.0 600 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia orbicola (strain MC0-3)
Q39FU0 0.0 600 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A0K7Q6 0.0 600 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia cenocepacia (strain HI2424)
B2T3U5 0.0 600 63 6 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2JG80 0.0 600 63 6 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0KBP2 0.0 600 64 5 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9AH21 0.0 600 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia multivorans (strain ATCC 17616 / 249)
B4EAF5 0.0 600 64 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q13Z56 0.0 599 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paraburkholderia xenovorans (strain LB400)
Q2W2S4 0.0 599 65 2 439 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q98MN9 0.0 598 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0BEZ5 0.0 598 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YR17 0.0 598 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia ambifaria (strain MC40-6)
A4JEL4 0.0 597 63 7 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q5ZXP6 0.0 596 65 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2SWB9 0.0 595 63 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B2FP10 0.0 592 64 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stenotrophomonas maltophilia (strain K279a)
A5WGF2 0.0 592 62 4 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Psychrobacter sp. (strain PRwf-1)
Q5WYL5 0.0 591 65 2 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Lens)
B4SQX0 0.0 590 65 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Stenotrophomonas maltophilia (strain R551-3)
A3NA26 0.0 590 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 668)
Q3JRT1 0.0 590 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 1710b)
A3NVU2 0.0 590 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain 1106a)
Q63UQ8 0.0 589 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia pseudomallei (strain K96243)
A5IGM4 0.0 588 64 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Corby)
Q5X765 0.0 588 64 2 433 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Legionella pneumophila (strain Paris)
Q0A8I9 0.0 588 65 1 435 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1V4H3 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain SAVP1)
Q62JZ1 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain ATCC 23344)
A2S2C9 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain NCTC 10229)
A3MK46 0.0 587 62 6 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Burkholderia mallei (strain NCTC 10247)
A5VUQ0 0.0 587 64 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FW94 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella suis biovar 1 (strain 1330)
A9WYN5 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YC29 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBK6 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q577W6 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus biovar 1 (strain 9-941)
Q2YKI5 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus (strain 2308)
B2SB89 0.0 585 65 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella abortus (strain S19)
A6X529 0.0 582 64 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A6SXU1 0.0 582 63 5 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Janthinobacterium sp. (strain Marseille)
A4G6D4 0.0 580 63 4 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Herminiimonas arsenicoxydans
B1ZEV4 0.0 580 64 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B7L2K9 0.0 578 64 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A9W8D2 0.0 578 64 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylorubrum extorquens (strain PA1)
B0UQE6 0.0 576 63 4 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacterium sp. (strain 4-46)
A8I0G1 0.0 575 64 2 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A4YUI3 0.0 574 63 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium sp. (strain ORS 278)
A5EJ58 0.0 573 63 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A5V3Z4 0.0 568 64 2 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A2SG87 0.0 567 60 5 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q6N6E2 0.0 567 63 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q89LG9 0.0 567 63 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2NDN5 0.0 566 61 6 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Erythrobacter litoralis (strain HTCC2594)
B3QIV5 0.0 566 63 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain TIE-1)
B7J3M4 0.0 566 62 2 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q214L6 0.0 565 62 2 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisB18)
A7INV0 0.0 565 62 2 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B1M6H4 0.0 564 62 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A4SXC8 0.0 564 65 5 419 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q136X7 0.0 563 63 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisB5)
Q2IW68 0.0 562 63 3 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain HaA2)
A9BVZ2 0.0 558 60 6 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Delftia acidovorans (strain DSM 14801 / SPH-1)
Q5NPC9 0.0 557 61 1 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q07M57 0.0 557 61 2 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopseudomonas palustris (strain BisA53)
A1TMP4 0.0 557 64 5 422 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paracidovorax citrulli (strain AAC00-1)
B1Y223 0.0 557 59 5 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A9IUA4 0.0 556 61 3 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bartonella tribocorum (strain CIP 105476 / IBS 506)
B5EK28 0.0 556 61 2 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
A0Q4U9 0.0 555 59 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. novicida (strain U112)
A8LI17 0.0 554 62 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q0C0U1 0.0 554 61 2 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hyphomonas neptunium (strain ATCC 15444)
Q1J1F6 0.0 553 61 7 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q1GV83 0.0 553 62 4 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B2IHC3 0.0 553 60 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A1WAJ7 0.0 553 60 7 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidovorax sp. (strain JS42)
B6JF93 0.0 552 62 3 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q12A25 0.0 551 61 5 426 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q72JG1 0.0 550 61 2 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B0U054 0.0 550 59 3 434 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B1XUT6 0.0 549 60 6 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q6G5E0 0.0 548 60 5 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A1VQ18 0.0 547 60 5 429 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Polaromonas naphthalenivorans (strain CJ2)
Q5SJ39 0.0 546 61 2 431 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q2GA32 0.0 546 60 5 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A4WRD4 0.0 546 64 4 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q5LUV8 0.0 545 62 4 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q21X03 0.0 541 61 5 426 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q28TN0 0.0 541 60 5 438 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Jannaschia sp. (strain CCS1)
A3PIG0 0.0 541 63 4 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3J3Y8 0.0 536 63 4 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q169Q9 0.0 532 60 5 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A1WMV5 0.0 531 59 5 428 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Verminephrobacter eiseniae (strain EF01-2)
Q1GIY4 0.0 531 60 6 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Ruegeria sp. (strain TM1040)
A1B3K8 0.0 531 61 6 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Paracoccus denitrificans (strain Pd 1222)
Q9RYW7 0.0 526 57 6 467 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0BNJ1 1.9e-170 488 58 4 391 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. holarctica (strain OSU18)
A7NA32 1.9e-170 488 58 4 391 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5D2R3 2.29e-111 338 42 10 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q6MGT1 2.16e-104 320 40 9 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A9WDA3 9.42e-104 319 40 10 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q2JK17 4.92e-103 317 40 8 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain JA-2-3B'a(2-13))
Q18BJ2 5.48e-103 317 39 8 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridioides difficile (strain 630)
Q0AXI3 8.26e-103 316 40 11 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2JSD0 2.48e-102 315 40 9 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain JA-3-3Ab)
Q67NX5 2.7e-102 316 41 14 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q55803 3.8e-102 314 40 9 452 2 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A4J5U4 6.94e-102 313 41 9 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8DIL8 9.15e-102 313 40 9 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q1DC90 2.85e-101 313 40 11 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Myxococcus xanthus (strain DK1622)
A7NIS8 4.85e-101 313 39 10 472 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q8RA52 7.27e-101 311 41 13 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q24W37 1.38e-100 310 40 11 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfitobacterium hafniense (strain Y51)
A4XLD9 6.18e-100 308 38 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q8YXJ1 8.36e-100 308 38 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MFH1 2.51e-99 307 39 9 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B2IVR7 3.26e-99 306 39 10 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q3A8J5 4.49e-99 306 40 15 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2RJK1 5.81e-99 306 42 14 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A2BNP5 1.85e-98 305 38 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain AS9601)
B5YKD1 1.99e-98 304 38 9 436 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B1XPZ7 2.18e-98 305 38 9 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A3PAG5 3.07e-98 305 38 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9301)
Q1IPQ5 3.9e-98 306 38 12 490 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Koribacter versatilis (strain Ellin345)
B0K9N5 4.06e-98 303 38 11 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q7UK39 4.61e-98 305 38 13 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A6TRJ4 4.87e-98 304 38 10 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkaliphilus metalliredigens (strain QYMF)
Q7V3H3 5.2e-98 304 38 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q31D78 5.2e-98 304 37 10 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9312)
Q6MBU9 6.14e-98 305 37 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Protochlamydia amoebophila (strain UWE25)
A9F1Y8 1.29e-97 304 41 14 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sorangium cellulosum (strain So ce56)
A9AZS3 1.43e-97 303 38 13 480 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B0K1C1 2.41e-97 301 38 13 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermoanaerobacter sp. (strain X514)
Q11XC6 2.51e-97 301 40 13 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B1WUD1 5.4e-97 301 38 11 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Crocosphaera subtropica (strain ATCC 51142 / BH68)
B0JJS5 6.28e-97 301 39 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B3QSS3 1.55e-96 300 39 9 446 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A5N854 2.03e-96 300 38 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q2IM41 3.7e-96 300 42 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter dehalogenans (strain 2CP-C)
A0L887 4.72e-96 300 38 9 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q5N1N6 7.85e-96 298 39 12 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q935Y2 8.94e-96 298 39 12 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B7KDB6 9.28e-96 298 38 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Gloeothece citriformis (strain PCC 7424)
Q7U477 1e-95 298 40 12 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Parasynechococcus marenigrum (strain WH8102)
Q747R0 1.12e-95 298 39 12 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A8G2A6 1.25e-95 298 37 11 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9215)
B4S8Z6 1.48e-95 297 40 11 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A9KLS2 1.6e-95 297 38 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B2V4I1 2.06e-95 297 38 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Alaska E43 / Type E3)
Q3AH63 2.08e-95 297 40 12 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9605)
B7JV66 2.2e-95 297 39 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Rippkaea orientalis (strain PCC 8801 / RF-1)
O67016 3.43e-95 296 42 13 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aquifex aeolicus (strain VF5)
Q7V8Z5 3.48e-95 297 40 12 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9313)
A5UQQ2 3.52e-95 297 39 11 467 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Roseiflexus sp. (strain RS-1)
A2BU62 6.45e-95 296 38 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9515)
A2C661 1.1e-94 296 40 12 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9303)
A1ATL9 1.12e-94 295 41 17 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q10Y85 1.29e-94 295 36 8 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichodesmium erythraeum (strain IMS101)
A6LSR6 1.43e-94 295 38 12 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A5FA30 1.67e-94 294 39 11 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A3DDZ7 2.49e-94 295 37 10 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B2TJ67 2.8e-94 294 38 13 456 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Eklund 17B / Type B)
Q0I735 3.95e-94 295 39 12 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9311)
B3EAM2 7.96e-94 293 39 13 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A5GQP4 1.09e-93 294 40 12 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain RCC307)
B4UKQ2 1.44e-93 293 42 12 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter sp. (strain K)
Q3B002 4.5e-93 291 40 12 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain CC9902)
Q6AQ27 5.16e-93 291 39 10 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B1ZW93 6.88e-93 291 39 11 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A0M3K8 7.53e-93 290 38 13 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q3ACX5 9.17e-93 290 36 10 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A6GZF6 1.12e-92 290 39 12 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B0TIH8 1.47e-92 290 41 11 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A7H6G8 1.68e-92 290 40 9 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Anaeromyxobacter sp. (strain Fw109-5)
A5GNW7 2.15e-92 290 38 9 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Synechococcus sp. (strain WH7803)
A9BCV9 3.1e-92 289 38 12 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain MIT 9211)
A0Q0P6 3.42e-92 289 36 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium novyi (strain NT)
Q8XJS9 2.81e-91 286 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain 13 / Type A)
Q0TPS8 2.81e-91 286 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SSE5 4.98e-91 286 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium perfringens (strain SM101 / Type A)
A5GBX9 5.26e-91 286 38 12 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geotalea uraniireducens (strain Rf4)
A6LAJ6 1.35e-90 284 37 13 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B5ED60 2e-90 284 37 12 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q254N4 2.07e-90 285 36 11 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia felis (strain Fe/C-56)
Q8KCL7 3.61e-90 283 38 9 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9Z8T3 4.74e-90 284 37 11 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia pneumoniae
Q7NDB8 1.06e-89 282 36 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q39QQ6 1.07e-89 282 38 13 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B2V8N8 2.16e-89 281 38 14 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurihydrogenibium sp. (strain YO3AOP1)
Q028J0 2.62e-89 282 37 12 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Solibacter usitatus (strain Ellin6076)
A8F8W3 2.7e-89 281 37 7 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B3QMN0 6.89e-89 280 38 9 457 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B1LAG0 8.36e-89 280 36 7 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga sp. (strain RQ2)
Q97I40 1.33e-88 280 35 7 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A5IL80 2.15e-88 278 36 8 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X2H6 2.45e-88 278 36 8 442 1 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8A9A2 2.54e-88 278 37 14 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B4U6U1 3.02e-88 277 39 11 412 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Hydrogenobaculum sp. (strain Y04AAS1)
A8MLX7 3.48e-88 278 36 13 449 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Alkaliphilus oremlandii (strain OhILAs)
A5I4I1 4.04e-88 278 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FVY1 4.04e-88 278 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain ATCC 19397 / Type A)
B4SBD5 8.33e-88 277 38 10 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A7GFZ4 1.32e-87 277 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q895I7 1.38e-87 277 36 11 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium tetani (strain Massachusetts / E88)
B1II37 2.18e-87 276 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Okra / Type B1)
B2A3C0 2.26e-87 276 36 10 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B1I310 6.48e-87 275 37 9 461 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulforudis audaxviator (strain MP104C)
B3EPX5 6.52e-87 275 39 12 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeobacteroides (strain BS1)
A6LM59 7.24e-87 275 37 10 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q823A0 8.42e-87 275 36 11 458 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A6L5E7 1.79e-86 273 36 16 460 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q5L5W7 2.05e-86 274 36 11 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlamydia abortus (strain DSM 27085 / S26/3)
B0CB83 4.3e-86 273 36 9 452 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acaryochloris marina (strain MBIC 11017)
B1KWJ5 7.88e-86 272 37 9 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Clostridium botulinum (strain Loch Maree / Type A3)
Q64TK5 1.07e-85 271 36 12 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides fragilis (strain YCH46)
Q5LCF8 1.07e-85 271 36 12 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q3ASP1 3.23e-85 270 37 7 441 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium chlorochromatii (strain CaD3)
A4SFH7 2.24e-84 268 36 10 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B7ID25 7.39e-84 266 36 8 437 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermosipho africanus (strain TCF52B)
A9A0B5 1.39e-83 266 37 10 450 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B3DYX1 2.42e-83 266 35 8 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Methylacidiphilum infernorum (isolate V4)
B2KB59 2.77e-83 265 35 8 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Elusimicrobium minutum (strain Pei191)
Q7VE92 3.72e-83 265 35 10 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B2ULZ9 6.95e-83 265 36 12 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q2LQ68 7.38e-83 265 36 12 464 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophus aciditrophicus (strain SB)
B3EDL2 7.62e-83 264 38 9 442 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B5YF65 4.19e-82 263 35 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A0LIM0 6.2e-82 262 36 11 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2RHD7 1.11e-81 261 37 14 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q7MXM3 6.97e-81 259 37 14 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A9BEU9 5.14e-79 254 34 10 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Petrotoga mobilis (strain DSM 10674 / SJ95)
Q1MQJ5 2.11e-78 253 36 14 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Lawsonia intracellularis (strain PHE/MN1-00)
Q3B317 3.56e-78 252 36 10 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1BHA0 2.56e-77 250 36 8 443 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q47RT4 2.57e-77 251 35 10 476 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Thermobifida fusca (strain YX)
Q82K95 7.63e-77 251 33 10 482 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A7HMK2 2.11e-76 248 33 9 451 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q72PC8 9.99e-76 246 34 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F710 3.07e-75 244 34 9 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A1V9Z2 4.51e-75 244 37 14 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratidesulfovibrio vulgaris (strain DP4)
Q726F7 4.76e-75 244 37 14 445 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q6A908 5.24e-75 245 33 12 477 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Cutibacterium acnes (strain DSM 16379 / KPA171202)
A8M773 1.03e-73 243 32 14 503 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salinispora arenicola (strain CNS-205)
A4X4R3 2.07e-73 242 32 12 489 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q04R21 1.49e-72 238 34 10 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A8ERB7 1.5e-72 238 35 11 412 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Aliarcobacter butzleri (strain RM4018)
Q04ZD0 1.83e-72 238 34 10 448 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q2J750 3.35e-72 239 35 9 432 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q315T9 4.4e-72 236 37 13 440 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
O86812 8.51e-72 237 32 11 480 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B1VXY2 3.56e-70 233 32 12 485 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A6Q526 4.1e-70 231 33 13 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nitratiruptor sp. (strain SB155-2)
A4FLZ0 1.02e-69 232 32 9 465 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q9ZEN7 1.15e-68 228 35 10 422 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B0SPT9 1.2e-68 228 33 11 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SGD8 1.2e-68 228 33 11 459 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A6W833 2.17e-68 228 33 12 486 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B1GZH1 3.41e-68 226 31 11 454 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Endomicrobium trichonymphae
A0LV11 2.17e-67 225 33 11 468 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B1VXU5 4.06e-67 225 34 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A6QCC6 3.21e-66 221 31 12 447 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurovum sp. (strain NBC37-1)
B1VDD8 5.72e-66 223 32 9 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
D5ZT17 6.56e-66 222 33 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces viridosporus (strain ATCC 14672 / DSM 40746 / JCM 4963 / KCTC 9882 / NRRL B-12104 / FH 1290)
A1SJ39 7.54e-66 221 30 12 484 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q73JG6 1.62e-65 220 32 12 462 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
O69963 2.07e-65 221 33 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q30PS0 4.59e-65 218 30 11 444 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A0RQM9 7.62e-65 218 34 11 417 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter fetus subsp. fetus (strain 82-40)
Q82KC4 9.59e-65 219 32 11 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A0QVX5 1.97e-64 218 33 11 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q83FT9 2.92e-64 217 32 9 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Tropheryma whipplei (strain Twist)
Q83HG3 3.32e-64 217 32 9 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Tropheryma whipplei (strain TW08/27)
A7I0P9 1.09e-63 214 35 14 416 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q7VGL0 1.58e-63 214 32 11 411 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q0RDV0 3.18e-63 216 34 11 455 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A7ZE21 4.44e-63 213 33 16 453 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter concisus (strain 13826)
Q4JV79 1.5e-62 214 32 11 442 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium jeikeium (strain K411)
Q47RR8 2.35e-62 213 32 10 443 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Thermobifida fusca (strain YX)
A1T7U2 2.87e-62 213 33 11 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1W162 2.89e-62 211 33 13 418 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FNC1 7.47e-62 210 33 12 418 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HSX7 7.88e-62 210 33 13 418 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni (strain RM1221)
A4TCM9 8.48e-62 211 32 11 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycolicibacterium gilvum (strain PYR-GCK)
B1MD05 1.03e-61 211 33 11 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A0LV00 1.34e-61 211 32 10 437 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q0P8G1 1.48e-61 209 33 12 418 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B2UT98 4.79e-61 207 33 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain Shi470)
Q2N950 6.86e-61 207 32 12 447 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Erythrobacter litoralis (strain HTCC2594)
A0JUY6 1.64e-60 208 31 10 444 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Arthrobacter sp. (strain FB24)
A7H5G3 2.08e-60 206 33 13 418 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1SNG0 6.15e-60 206 31 11 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8FPD5 7.55e-60 207 31 11 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q17XY7 9.75e-60 204 32 10 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter acinonychis (strain Sheeba)
B6JLW7 1.8e-59 204 32 9 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain P12)
A9WQ47 2.59e-59 205 32 13 457 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q6NGR0 2.64e-59 205 30 15 468 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q1BA19 3.89e-59 205 32 15 479 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain MCS)
Q9ZLA9 3.97e-59 202 32 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain J99 / ATCC 700824)
A1UEZ3 5.43e-59 204 32 15 479 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain KMS)
Q1CTD7 6.05e-59 202 32 9 424 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain HPAG1)
A1R550 2.05e-58 202 31 13 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Paenarthrobacter aurescens (strain TC1)
A4FAJ1 2.5e-58 202 30 11 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q5YT08 3.01e-58 202 33 13 445 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Nocardia farcinica (strain IFM 10152)
B5Z796 5.76e-58 199 32 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain G27)
B2HL08 6.22e-58 202 30 9 449 3 miaB2 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 2 Mycobacterium marinum (strain ATCC BAA-535 / M)
A4QEV7 6.44e-58 202 30 9 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium glutamicum (strain R)
A3PYF3 6.51e-58 202 31 14 480 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium sp. (strain JLS)
A0PT87 6.97e-58 202 30 9 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium ulcerans (strain Agy99)
B3CV38 7.67e-58 199 30 10 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Orientia tsutsugamushi (strain Ikeda)
A5CSL5 1.31e-57 201 31 10 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B3E0M0 1.38e-57 199 29 13 437 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylacidiphilum infernorum (isolate V4)
A7HZ82 2.04e-57 199 33 13 464 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q6ALW9 2.21e-57 198 31 13 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A5CC78 2.94e-57 198 30 10 452 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Orientia tsutsugamushi (strain Boryong)
B0RGZ1 3.36e-57 200 31 10 448 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Clavibacter sepedonicus
O25434 3.55e-57 197 32 8 408 3 rimO Ribosomal protein uS12 methylthiotransferase RimO Helicobacter pylori (strain ATCC 700392 / 26695)
Q2J2K9 3.95e-57 198 32 16 463 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodopseudomonas palustris (strain HaA2)
Q8NP67 4e-57 199 30 9 446 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1ZJR5 9.78e-57 196 31 14 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
P67086 1.3e-56 198 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B7GQG0 1.31e-56 197 31 13 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
A8F011 1.65e-56 196 31 12 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia canadensis (strain McKiel)
B0CK00 1.86e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VTA1 1.94e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AB1 1.96e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQS8 1.96e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain 2308)
B2S9E5 1.96e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella abortus (strain S19)
Q8FXU4 2.18e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella suis biovar 1 (strain 1330)
A9M9Y3 2.18e-56 196 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B3PZB6 2.2e-56 196 31 11 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium etli (strain CIAT 652)
Q5FPF1 3.17e-56 196 31 9 456 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Gluconobacter oxydans (strain 621H)
A8GTT8 3.51e-56 195 31 13 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia rickettsii (strain Sheila Smith)
B0BVC7 3.51e-56 195 31 13 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia rickettsii (strain Iowa)
P9WK05 5.02e-56 197 30 10 449 1 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK04 5.02e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U685 5.02e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KM71 5.02e-56 197 30 10 449 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q3ACA4 5.46e-56 194 31 12 450 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q1GRE9 6.3e-56 194 32 14 409 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A9VYZ9 7.48e-56 194 31 15 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum extorquens (strain PA1)
A8F2U6 1.22e-55 194 31 13 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia massiliae (strain Mtu5)
Q2KD88 1.25e-55 194 31 13 447 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q92G77 1.27e-55 194 31 13 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8YEA2 1.32e-55 194 33 16 430 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A1A280 2e-55 194 30 13 448 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A6WWX6 2.21e-55 193 32 14 436 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q92SI7 3.57e-55 193 31 13 464 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium meliloti (strain 1021)
B7KVE0 3.72e-55 192 31 14 451 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q4UK06 3.75e-55 192 31 14 460 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B6JCT6 4.31e-55 193 31 17 468 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q0S1P3 5.49e-55 193 32 13 432 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhodococcus jostii (strain RHA1)
Q8G4H4 5.61e-55 192 31 13 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium longum (strain NCC 2705)
B3DQX6 5.62e-55 193 31 13 454 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bifidobacterium longum (strain DJO10A)
B1LWE8 9.33e-55 191 30 14 464 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A6W848 1e-54 193 31 12 462 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q6AE03 1.75e-54 192 31 10 439 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Leifsonia xyli subsp. xyli (strain CTCB07)
Q11BD9 1.86e-54 191 31 14 461 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Chelativorans sp. (strain BNC1)
B2GKH0 2.7e-54 192 31 13 458 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A8GQ03 3.31e-54 190 30 13 455 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rickettsia akari (strain Hartford)
B5ZMY1 3.47e-54 190 32 10 406 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
O66638 4.09e-54 189 30 6 406 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Aquifex aeolicus (strain VF5)
B2IIK5 4.61e-54 191 31 8 398 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A7IGB2 5.55e-54 190 32 12 407 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A8F716 5.68e-54 189 29 9 448 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B0T155 6.05e-54 189 31 15 451 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Caulobacter sp. (strain K31)
Q8RG43 6.99e-54 189 28 13 457 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6G0N1 8.26e-54 189 31 12 425 3 miaB tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase Bartonella quintana (strain Toulouse)
B2HGN2 9.77e-54 191 30 11 449 3 miaB1 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase 1 Mycobacterium marinum (strain ATCC BAA-535 / M)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_04660
Feature type CDS
Gene rimO
Product 30S ribosomal protein S12 methylthiotransferase RimO
Location 130950 - 132290 (strand: -1)
Length 1341 (nucleotides) / 446 (amino acids)

Contig

Accession contig_4
Length 199551 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_892
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00919 Uncharacterized protein family UPF0004
PF04055 Radical SAM superfamily
PF18693 TRAM domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0621 Translation, ribosomal structure and biogenesis (J) J tRNA A37 methylthiotransferase MiaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14441 ribosomal protein S12 methylthiotransferase [EC:2.8.4.4] - -

Protein Sequence

MSQNTNTVPKVGFVSLGCPKNLVDSERILTELRTDGYQVVPSYDDADVVIVNTCGFIDSAVQESLEAIGEALAENGKVIVTGCLGAKEDQIREVHPKVLEITGPHSYEQVLANVRKYVPKPAHDPFTSLVPEQGVKLTPRHYAYLKISEGCNHRCTFCIIPSMRGDLDSRPVGEVLSEAQRLVEAGVKELLVISQDTSAYGADIKHRTGFRDGLPVKTSMIGLCEQLSQLGVWVRLHYVYPYPHVDDVIPLMAEGKILPYLDIPLQHASPRILKLMKRPGAVERTLERIKRWREICPELTLRSTFIVGFPGETEEDFQMLLDFLTEARLDRVGCFKYSPVEGAHANELPDQVPEEIKEERYHRFMQLQQQISAERLAEKIGRTLPVIIDEVDDEEGAVGRSMADAPEIDGMVYLNGEFDVQPGDIVMVNIEHADEYDLWGSVVREA

Flanking regions ( +/- flanking 50bp)

TGCAGCCGGAAATATCCTGCTGCATCCTGCTCTTTTGAGTAAATGAGCTTATGTCGCAAAATACCAACACAGTGCCGAAAGTCGGTTTCGTTTCTTTAGGCTGCCCGAAAAACCTGGTGGATTCCGAGCGGATTCTGACTGAACTGCGCACGGACGGCTATCAGGTTGTGCCGAGCTATGATGATGCCGATGTGGTGATCGTCAATACCTGCGGTTTCATTGACAGTGCTGTGCAGGAATCCCTGGAAGCAATCGGCGAGGCACTGGCGGAAAACGGTAAAGTGATCGTGACCGGGTGTCTGGGTGCGAAAGAAGACCAGATCCGTGAAGTGCACCCGAAGGTGCTGGAAATCACCGGTCCGCACAGCTATGAGCAGGTGCTGGCGAATGTCCGCAAATATGTGCCGAAACCGGCGCATGATCCGTTCACCAGCCTGGTGCCGGAGCAGGGCGTGAAACTGACACCGCGCCATTACGCGTATCTGAAAATTTCTGAAGGTTGTAATCACCGCTGCACATTCTGCATTATCCCGTCCATGCGCGGCGATCTGGACAGCCGTCCTGTCGGTGAGGTGCTGAGTGAAGCGCAGCGCCTGGTTGAAGCCGGTGTGAAAGAGCTGCTGGTGATCTCCCAGGATACCTCTGCCTATGGCGCTGATATCAAACACCGCACCGGTTTCCGCGATGGTTTGCCGGTGAAAACCAGCATGATCGGTCTGTGTGAGCAGTTATCTCAGCTCGGTGTGTGGGTACGTCTGCATTACGTGTATCCGTATCCGCATGTGGATGATGTGATCCCGCTGATGGCGGAAGGCAAAATCCTGCCGTATCTGGATATTCCGTTACAGCATGCCAGCCCGCGTATTCTGAAACTGATGAAACGCCCGGGTGCCGTTGAGCGCACACTGGAGCGCATCAAACGCTGGCGCGAAATCTGTCCGGAACTGACACTGCGTTCCACCTTTATTGTCGGCTTCCCGGGTGAAACCGAAGAAGACTTTCAGATGCTGCTGGACTTCCTGACAGAAGCCCGTCTGGATCGCGTCGGCTGCTTTAAATACAGTCCGGTGGAAGGGGCGCATGCCAACGAATTACCGGATCAGGTGCCGGAAGAGATCAAAGAAGAGCGCTATCACCGCTTTATGCAGTTACAGCAGCAGATCTCCGCAGAGCGTCTGGCTGAAAAAATCGGCCGTACACTGCCGGTGATCATTGATGAAGTTGATGACGAAGAGGGCGCTGTCGGCCGCAGTATGGCGGATGCGCCGGAAATCGACGGTATGGTATATCTCAACGGTGAATTTGATGTGCAGCCGGGGGATATTGTGATGGTGAATATTGAACATGCCGATGAGTATGATCTCTGGGGCAGCGTGGTGCGCGAAGCATGACAAACAGTGACAACCGCCTGACCGGACGCCTGATGTTCGGTAATGACCCG