Homologs in group_274

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08065 FBDBKF_08065 76.1 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_13895 EHELCC_13895 76.1 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_14340 NLDBIP_14340 76.1 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_08510 LHKJJB_08510 76.1 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_08060 HKOGLL_08060 76.1 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS12515 F4V73_RS12515 32.2 Morganella psychrotolerans - helix-turn-helix transcriptional regulator
F4V73_RS12930 F4V73_RS12930 76.1 Morganella psychrotolerans - helix-turn-helix transcriptional regulator

Distribution of the homologs in the orthogroup group_274

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_274

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76241 1.8e-32 122 30 3 237 2 nimR HTH-type transcriptional regulator NimR Escherichia coli (strain K12)
Q8NRR3 8.69e-08 55 31 2 106 2 ripA HTH-type transcriptional regulator RipA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FQS2 5.5e-07 53 28 2 109 3 ripA HTH-type transcriptional regulator RipA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q66FF1 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRS7 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis (strain Pestoides F)
Q1CEB6 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYR6 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIZ9 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis
B2K1W6 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0W2 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FN79 9.12e-07 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JNC4 1.45e-06 52 34 3 84 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q6NI56 0.000114 46 33 5 107 3 ripA HTH-type transcriptional regulator RipA Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q32A71 0.000179 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Shigella dysenteriae serotype 1 (strain Sd197)
Q1R413 0.000198 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain UTI89 / UPEC)
A1AI83 0.000198 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O1:K1 / APEC
Q83PD9 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri
Q0SZ96 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Shigella flexneri serotype 5b (strain 8401)
Q31U83 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Shigella boydii serotype 4 (strain Sb227)
P09378 0.000206 45 28 3 125 1 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12)
Q8FBD7 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAF7 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A710 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O9:H4 (strain HS)
C5A074 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli (strain K12 / MC4100 / BW2952)
A7ZUB8 0.000206 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O139:H28 (strain E24377A / ETEC)
P45008 0.000212 45 30 2 107 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8X7B3 0.000213 45 28 3 125 3 rhaR HTH-type transcriptional activator RhaR Escherichia coli O157:H7
Q1CEB5 0.000404 44 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJ00 0.000404 44 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis
Q1C0W1 0.000404 44 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Antiqua)
A9MI64 0.000531 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5FPP5 0.000536 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
Q57HG8 0.000551 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
Q66FF2 0.000557 43 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype I (strain IP32953)
B4TPQ9 0.000571 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
B4TBY3 0.000571 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
B5F0M9 0.000571 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
P0A2S9 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 0.000577 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
B1JNC5 0.000583 43 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TRS8 0.000583 43 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis (strain Pestoides F)
A9QYR8 0.000583 43 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Angola)
B2K1W5 0.000583 43 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FN80 0.000583 43 32 1 67 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5BJG8 0.000593 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 0.000593 43 29 1 75 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7ML57 0.000625 43 32 2 78 3 rhaR HTH-type transcriptional activator RhaR Cronobacter sakazakii (strain ATCC BAA-894)
P0A9E2 0.000667 41 32 1 76 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 0.000667 41 32 1 76 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 0.000667 41 32 1 76 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
A6TGB0 0.00081 43 29 2 81 3 rhaR HTH-type transcriptional activator RhaR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0A9E0 0.000875 43 28 5 139 1 araC Arabinose operon regulatory protein Escherichia coli (strain K12)
P0A9E1 0.000875 43 28 5 139 3 araC Arabinose operon regulatory protein Escherichia coli O157:H7
P07642 0.001 43 32 1 70 3 araC Arabinose operon regulatory protein Dickeya chrysanthemi
Q56143 0.001 41 31 1 76 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14650
Feature type CDS
Gene -
Product helix-turn-helix transcriptional regulator
Location 3246053 - 3246823 (strand: -1)
Length 771 (nucleotides) / 256 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_274
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF02311 AraC-like ligand binding domain
PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Protein Sequence

MRNVPLESVDLLERDVIALGTDYLPNTLLETHRHRRAQFLYPATGLIEVSTNDGEWVIPPSCGVWIPPQTGHETRMLDVSTRSLYIEPAAAPRQSQQCEVLRVSPLLRQLLLEAVDVPAQYDKKGRDGILMQLILYELAKAEPLPFFVPIPQDSKLAKLCRDFIRQPKIDALPQQWAEKLHKSERSFSRFFRQQTGMAFSQWRQQVCLLNSLTQILSGHSITAVAFDLGYNSASSFSTMFKKQMGQSPSDFVRNAP

Flanking regions ( +/- flanking 50bp)

TAGTGACCAGATTTGCTCATCAGCAAGAAAGATAAAAAAGTAGGTTTAATGTGAGAAATGTGCCGTTAGAAAGTGTTGATCTCCTTGAGAGAGATGTGATTGCGCTGGGTACAGATTATCTGCCTAATACGCTATTAGAAACGCATCGACATCGACGAGCGCAATTTTTATATCCCGCTACCGGATTGATTGAAGTGAGCACAAATGATGGGGAATGGGTTATCCCTCCCTCTTGTGGTGTGTGGATCCCTCCTCAGACGGGGCATGAAACACGCATGTTAGATGTGAGTACCAGAAGTTTATATATTGAGCCAGCGGCAGCTCCTCGTCAGAGTCAACAGTGTGAAGTGTTAAGAGTGTCACCGCTTTTACGTCAATTACTTCTTGAAGCCGTTGATGTGCCTGCGCAATATGATAAAAAAGGGCGCGATGGTATTTTAATGCAACTTATCTTATATGAGTTAGCGAAAGCAGAACCTTTGCCTTTCTTTGTTCCTATTCCACAGGACAGTAAATTAGCTAAATTATGTCGCGATTTTATTCGTCAGCCCAAAATTGACGCTCTACCTCAGCAGTGGGCCGAGAAATTACATAAAAGTGAACGCTCGTTTAGCCGTTTTTTCCGCCAACAGACGGGAATGGCATTTTCACAATGGCGTCAGCAAGTCTGTCTTTTAAACTCACTCACGCAAATTTTATCAGGGCATAGCATTACCGCTGTGGCTTTTGATTTGGGCTATAACAGCGCTAGCTCTTTTTCTACTATGTTTAAAAAGCAGATGGGACAATCACCTTCTGATTTTGTGAGAAACGCGCCATAACGGCGCGTTTTCTATGAGCTTGAATTAGTGGCTGGGCTTGTTTTCTCTTA