Homologs in group_304

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_13895 EHELCC_13895 100.0 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_14340 NLDBIP_14340 100.0 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_08510 LHKJJB_08510 100.0 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_08060 HKOGLL_08060 100.0 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS12515 F4V73_RS12515 33.9 Morganella psychrotolerans - helix-turn-helix transcriptional regulator
F4V73_RS12930 F4V73_RS12930 90.0 Morganella psychrotolerans - helix-turn-helix transcriptional regulator
PMI_RS14650 PMI_RS14650 76.1 Proteus mirabilis HI4320 - helix-turn-helix transcriptional regulator

Distribution of the homologs in the orthogroup group_304

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_304

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76241 4.31e-33 124 31 3 236 2 nimR HTH-type transcriptional regulator NimR Escherichia coli (strain K12)
Q8FQS2 4.71e-07 53 29 4 131 3 ripA HTH-type transcriptional regulator RipA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8NRR3 3.56e-06 50 30 2 107 2 ripA HTH-type transcriptional regulator RipA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6NI56 0.000167 45 26 2 106 3 ripA HTH-type transcriptional regulator RipA Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A4TRS7 0.000174 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis (strain Pestoides F)
Q1CEB6 0.000174 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYR6 0.000174 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIZ9 0.000174 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis
B2K1W6 0.000174 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0W2 0.000174 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FF1 0.000177 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FN79 0.000177 45 30 3 88 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4WG90 0.000179 45 29 2 82 3 rhaR HTH-type transcriptional activator RhaR Enterobacter sp. (strain 638)
P43461 0.00019 44 44 0 38 4 None Uncharacterized HTH-type transcriptional regulator in cgkA 5'region (Fragment) Pseudoalteromonas carrageenovora
B1JNC4 0.000209 45 31 2 76 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P0A9E2 0.000314 42 30 1 72 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 0.000314 42 30 1 72 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 0.000314 42 30 1 72 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
Q56143 0.000433 42 30 1 68 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MI63 0.000593 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P40865 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BJG9 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain AKU_12601)
A9MZC9 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKG1 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZZ4 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella newport (strain SL254)
B5QWY5 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella enteritidis PT4 (strain P125109)
B5F0N0 0.00062 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella agona (strain SL483)
B4TPR0 0.000667 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella schwarzengrund (strain CVM19633)
A6TGB0 0.000684 43 29 2 79 3 rhaR HTH-type transcriptional activator RhaR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5FPP6 0.000801 43 28 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella dublin (strain CT_02021853)
P07642 0.000805 43 29 1 87 3 araC Arabinose operon regulatory protein Dickeya chrysanthemi
Q57HG7 0.001 43 27 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella choleraesuis (strain SC-B67)
Q8Z2V5 0.001 43 27 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella typhi
B4TBY4 0.001 43 27 2 81 3 rhaR HTH-type transcriptional activator RhaR Salmonella heidelberg (strain SL476)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_08065
Feature type CDS
Gene araC
Product AraC-type DNA-binding domain and AraC-containing proteins
Location 151153 - 151938 (strand: -1)
Length 786 (nucleotides) / 261 (amino acids)

Contig

Accession contig_8
Length 164760 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_304
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2207 Transcription (K) K AraC-type DNA-binding domain and AraC-containing proteins

Protein Sequence

MRNIPLKSVDNIARDVIALGTDYLPDTLLEYHAHRRAQFLYPATGLIEVSTADGEWVIPPSCGVWIPEQVAHETRMLNVSTRSLYIEPAAKPRHAVSCEVVSVSPLLRQLLLEAVDSPAEYDIQGRDGVLMQLILCELARMPPLPFFAPIPRDEKLGRLCREFMRKPVITSQPGEWAEQLHKSERSFSRFFRTQTGMSFSEWRQQACLLNSLSHILSGKSITEVAYELGYNSAGAFSIMFKKQMGQSPSHFKNDDSDIRHF

Flanking regions ( +/- flanking 50bp)

TATAACACCCGCCGGTTTTTACTTTCAGTCAGATACGGAGTGCGACACTCATGAGAAATATTCCGTTAAAAAGCGTGGATAATATCGCGCGGGATGTCATTGCGCTCGGCACCGATTATCTGCCCGATACCCTGCTGGAATACCACGCTCACCGCCGGGCACAGTTTTTATATCCGGCCACCGGGCTGATTGAAGTCAGTACCGCAGACGGCGAGTGGGTGATCCCGCCGTCCTGTGGTGTGTGGATCCCGGAACAGGTCGCTCATGAAACCCGGATGCTGAATGTCAGCACGCGCAGTCTGTATATCGAACCGGCAGCAAAGCCGCGTCACGCCGTCAGTTGTGAAGTGGTGAGTGTCTCCCCGCTGCTGCGCCAGCTGCTGCTGGAGGCGGTGGATAGCCCGGCGGAATATGATATTCAGGGGCGTGACGGTGTGCTGATGCAGCTGATCCTCTGCGAGCTGGCGCGTATGCCCCCGCTGCCGTTTTTCGCGCCGATCCCGCGTGATGAGAAGCTCGGTCGTCTGTGCCGTGAGTTTATGCGCAAACCGGTTATCACCTCACAACCGGGGGAATGGGCGGAACAGCTGCACAAAAGCGAGCGCTCTTTCAGCCGTTTTTTCCGCACCCAGACCGGGATGTCATTTTCAGAATGGCGGCAGCAGGCGTGTCTTCTGAACTCGCTGTCTCATATTCTGTCCGGAAAATCGATTACCGAAGTGGCGTATGAGCTGGGTTACAACAGTGCGGGGGCATTCTCAATTATGTTTAAAAAACAGATGGGGCAATCCCCTTCCCATTTTAAAAATGATGATTCGGATATCCGCCATTTTTAAATTGTTTTTTAACAAATATAATCTTATTATGTGCCGCCGATGAAATTTGA