Homologs in group_1748

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12180 FBDBKF_12180 79.2 Morganella morganii S1 metF methylenetetrahydrofolate reductase
EHELCC_14125 EHELCC_14125 79.2 Morganella morganii S2 metF methylenetetrahydrofolate reductase
NLDBIP_15220 NLDBIP_15220 79.2 Morganella morganii S4 metF methylenetetrahydrofolate reductase
LHKJJB_15390 LHKJJB_15390 79.2 Morganella morganii S3 metF methylenetetrahydrofolate reductase
HKOGLL_14510 HKOGLL_14510 79.2 Morganella morganii S5 metF methylenetetrahydrofolate reductase
F4V73_RS16990 F4V73_RS16990 80.6 Morganella psychrotolerans metF methylenetetrahydrofolate reductase

Distribution of the homologs in the orthogroup group_1748

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1748

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P71319 0.0 533 82 0 298 3 metF 5,10-methylenetetrahydrofolate reductase Pectobacterium carotovorum subsp. carotovorum
P11003 0.0 518 81 0 296 3 metF 5,10-methylenetetrahydrofolate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEZ2 0.0 514 81 0 296 3 metF 5,10-methylenetetrahydrofolate reductase Shigella flexneri
P0AEZ1 0.0 514 81 0 296 1 metF 5,10-methylenetetrahydrofolate reductase Escherichia coli (strain K12)
P45208 1.69e-160 451 73 0 290 1 metF 5,10-methylenetetrahydrofolate reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JZQ3 1.4e-159 449 73 0 290 1 metF 5,10-methylenetetrahydrofolate reductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57154 1.34e-128 370 58 0 292 3 metF 5,10-methylenetetrahydrofolate reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA62 4.88e-125 361 57 0 292 3 metF 5,10-methylenetetrahydrofolate reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89B13 1.1e-124 360 55 1 291 3 metF 5,10-methylenetetrahydrofolate reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O67422 5.22e-76 237 45 4 276 3 metF 5,10-methylenetetrahydrofolate reductase Aquifex aeolicus (strain VF5)
O54235 8.52e-61 198 38 2 279 1 metF 5,10-methylenetetrahydrofolate reductase Streptomyces lividans
Q9SE60 3.26e-51 180 35 4 289 1 MTHFR1 Methylenetetrahydrofolate reductase (NADH) 1 Arabidopsis thaliana
Q9SE94 5.79e-50 177 34 4 293 1 None Methylenetetrahydrofolate reductase (NADH) 1 Zea mays
O80585 9.44e-50 176 34 5 296 1 MTHFR2 Methylenetetrahydrofolate reductase (NADH) 2 Arabidopsis thaliana
Q75HE6 1.13e-47 171 33 4 293 2 Os03g0815200 Probable methylenetetrahydrofolate reductase (NADH) Oryza sativa subsp. japonica
P42898 4.35e-43 159 35 12 302 1 MTHFR Methylenetetrahydrofolate reductase (NADPH) Homo sapiens
Q5I598 3.27e-42 157 35 9 284 2 MTHFR Methylenetetrahydrofolate reductase (NADPH) Bos taurus
Q60HE5 6e-41 153 35 9 284 2 MTHFR Methylenetetrahydrofolate reductase (NADPH) Macaca fascicularis
P46151 1.13e-39 150 33 10 299 1 MET12 Methylenetetrahydrofolate reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q17693 1.9e-39 149 31 9 303 3 mthf-1 Probable methylenetetrahydrofolate reductase (NADPH) Caenorhabditis elegans
Q9WU20 3.37e-39 148 33 9 299 1 Mthfr Methylenetetrahydrofolate reductase (NADPH) Mus musculus
P53128 4e-39 147 31 7 287 1 MET13 Methylenetetrahydrofolate reductase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q10258 7.81e-38 144 30 3 279 1 met9 Methylenetetrahydrofolate reductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74927 1.43e-25 109 32 9 281 2 met11 Methylenetetrahydrofolate reductase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
G2IQS8 3.77e-07 53 26 14 270 1 metF 5,10-methylenetetrahydrofolate reductase Sphingobium sp. (strain NBRC 103272 / SYK-6)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14495
Feature type CDS
Gene metF
Product methylenetetrahydrofolate reductase
Location 3213956 - 3214855 (strand: 1)
Length 900 (nucleotides) / 299 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1748
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02219 Methylenetetrahydrofolate reductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0685 Amino acid transport and metabolism (E) E 5,10-methylenetetrahydrofolate reductase

Kegg Ortholog Annotation(s)

Protein Sequence

MSFYHASQHEALNQNLAELDGQIQVSFEFFPPRTQEMENTLWQSLARLNTLKPSFVSVTYGANSGERDRTHAIIKDIKERTGLEAAPHLTCIDACREELQHIAQDYWQSGIRHIVALRGDLPDNSQKPDMYAVDLVRLLKDVGDFDISVAAYPEVHPEAKSAQADLINLKKKVDAGANRAITQFFFDVESYLRFRDRCVSTGIDVEIVPGILPVTNFKQLKRFAGLTNVKIPGWMHKMFDGLDNDPETRALVGASIAIDMVKILSREGVKDFHFYTLNRSELTYAICHTLGVRPQLAKV

Flanking regions ( +/- flanking 50bp)

AACGGAATAACAATAACAACATGTGACACAACGATTGATGAGGTATAGGTATGAGCTTTTATCACGCAAGCCAGCATGAAGCGCTTAATCAAAATCTTGCTGAATTAGATGGCCAGATCCAAGTTTCTTTTGAGTTTTTTCCTCCTCGCACACAAGAGATGGAAAATACACTCTGGCAATCACTGGCTCGTTTAAATACCTTAAAACCTAGCTTTGTTTCGGTCACTTATGGTGCAAATTCAGGTGAACGAGATAGAACACATGCCATTATTAAAGATATAAAAGAGCGTACAGGCCTTGAGGCAGCACCACATTTAACCTGCATTGATGCCTGTCGTGAAGAATTACAGCACATTGCCCAAGACTATTGGCAAAGTGGCATTCGTCATATTGTGGCGCTACGGGGAGATTTACCTGATAACAGCCAGAAGCCAGATATGTATGCCGTTGATCTGGTTCGTTTACTGAAAGATGTAGGAGATTTTGATATTTCGGTTGCTGCTTATCCAGAAGTGCATCCCGAAGCTAAAAGCGCACAGGCTGATCTTATTAATTTAAAAAAGAAAGTGGATGCCGGCGCTAATCGAGCCATTACACAATTTTTCTTTGATGTAGAAAGTTACTTACGCTTTCGTGATCGCTGTGTTTCAACGGGTATTGATGTAGAAATTGTTCCGGGTATTTTACCTGTCACCAATTTTAAACAGTTAAAACGTTTTGCCGGATTAACCAATGTGAAGATCCCCGGTTGGATGCATAAAATGTTTGATGGCTTAGATAACGATCCAGAAACTCGCGCACTGGTTGGGGCTTCTATCGCTATTGATATGGTGAAAATTTTAAGCCGTGAGGGCGTGAAAGATTTCCATTTTTACACTCTTAACCGCTCTGAATTGACCTACGCCATTTGCCATACATTAGGTGTTCGCCCACAACTTGCGAAGGTTTAGTCTTATCACCCCGCCCATAGTCTATTGGCGGGGTTTTTCTAGGCGAGATT