Homologs in group_1748

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12180 FBDBKF_12180 96.0 Morganella morganii S1 metF methylenetetrahydrofolate reductase
EHELCC_14125 EHELCC_14125 96.0 Morganella morganii S2 metF methylenetetrahydrofolate reductase
NLDBIP_15220 NLDBIP_15220 96.0 Morganella morganii S4 metF methylenetetrahydrofolate reductase
LHKJJB_15390 LHKJJB_15390 96.0 Morganella morganii S3 metF methylenetetrahydrofolate reductase
HKOGLL_14510 HKOGLL_14510 96.0 Morganella morganii S5 metF methylenetetrahydrofolate reductase
PMI_RS14495 PMI_RS14495 80.6 Proteus mirabilis HI4320 metF methylenetetrahydrofolate reductase

Distribution of the homologs in the orthogroup group_1748

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1748

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P11003 0.0 517 81 0 296 3 metF 5,10-methylenetetrahydrofolate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P71319 0.0 516 80 0 297 3 metF 5,10-methylenetetrahydrofolate reductase Pectobacterium carotovorum subsp. carotovorum
P0AEZ2 0.0 510 79 0 296 3 metF 5,10-methylenetetrahydrofolate reductase Shigella flexneri
P0AEZ1 0.0 510 79 0 296 1 metF 5,10-methylenetetrahydrofolate reductase Escherichia coli (strain K12)
P45208 1.49e-156 441 72 0 285 1 metF 5,10-methylenetetrahydrofolate reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JZQ3 1.41e-154 436 72 0 284 1 metF 5,10-methylenetetrahydrofolate reductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57154 5.99e-127 366 56 0 285 3 metF 5,10-methylenetetrahydrofolate reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89B13 1.02e-126 366 55 1 291 3 metF 5,10-methylenetetrahydrofolate reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8KA62 2.24e-122 355 56 0 292 3 metF 5,10-methylenetetrahydrofolate reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O67422 1.1e-74 233 44 4 276 3 metF 5,10-methylenetetrahydrofolate reductase Aquifex aeolicus (strain VF5)
O54235 2.74e-63 204 40 2 279 1 metF 5,10-methylenetetrahydrofolate reductase Streptomyces lividans
Q9SE60 9.08e-50 176 35 3 289 1 MTHFR1 Methylenetetrahydrofolate reductase (NADH) 1 Arabidopsis thaliana
O80585 3.68e-49 175 34 4 296 1 MTHFR2 Methylenetetrahydrofolate reductase (NADH) 2 Arabidopsis thaliana
Q75HE6 3.26e-47 169 34 5 293 2 Os03g0815200 Probable methylenetetrahydrofolate reductase (NADH) Oryza sativa subsp. japonica
Q9SE94 5.72e-46 166 32 3 289 1 None Methylenetetrahydrofolate reductase (NADH) 1 Zea mays
P42898 1.45e-39 149 33 8 302 1 MTHFR Methylenetetrahydrofolate reductase (NADPH) Homo sapiens
Q5I598 6.59e-39 147 32 6 284 2 MTHFR Methylenetetrahydrofolate reductase (NADPH) Bos taurus
P53128 7.5e-39 147 31 7 299 1 MET13 Methylenetetrahydrofolate reductase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q10258 8.87e-39 147 31 3 279 1 met9 Methylenetetrahydrofolate reductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9WU20 9.55e-39 147 32 7 302 1 Mthfr Methylenetetrahydrofolate reductase (NADPH) Mus musculus
Q60HE5 1.77e-38 146 33 8 302 2 MTHFR Methylenetetrahydrofolate reductase (NADPH) Macaca fascicularis
P46151 8.08e-37 142 31 10 299 1 MET12 Methylenetetrahydrofolate reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q17693 2.52e-35 137 30 7 299 3 mthf-1 Probable methylenetetrahydrofolate reductase (NADPH) Caenorhabditis elegans
O74927 5.02e-22 99 32 10 283 2 met11 Methylenetetrahydrofolate reductase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
G2IQS8 0.000565 44 28 11 190 1 metF 5,10-methylenetetrahydrofolate reductase Sphingobium sp. (strain NBRC 103272 / SYK-6)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16990
Feature type CDS
Gene metF
Product methylenetetrahydrofolate reductase
Location 20595 - 21497 (strand: 1)
Length 903 (nucleotides) / 300 (amino acids)

Contig

Accession term accessions NZ_VXKB01000007 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1748
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02219 Methylenetetrahydrofolate reductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0685 Amino acid transport and metabolism (E) E 5,10-methylenetetrahydrofolate reductase

Kegg Ortholog Annotation(s)

Protein Sequence

MSFLHVDQHEALNQNLAELAGRVEVSFEFFPPGTPEMENTLWQSIERLSVLKPKFVSVTYGANSGERDRTHSVIKGIKEKTGLIAVPHLTCIDATRDELKTIAKDYWDNGIRHIVALRGDLPDNSRKPDMYAADLVNLLKSVADFDISVAAYPEVHPEARSAQADLINLKKKIDAGADRAITQFFFDVSTYLRFRDRCAAAGIDVEIVPGILPVSNFKQLQRFAGMTNVRIPGWLGNMFEGLDDDPESRKLVGASVAMEMVKILSREGVKDFHFYTLNRAELTYAICHTLGVRPAVACVA

Flanking regions ( +/- flanking 50bp)

CGAATGAATAAGGGTATATTTACCACGGACGGATGACATCGGGGGCAAAGATGAGTTTTTTACACGTTGACCAGCACGAGGCACTGAACCAAAATCTGGCAGAATTAGCCGGCCGCGTGGAAGTATCTTTTGAGTTTTTCCCCCCGGGCACACCGGAAATGGAAAACACACTGTGGCAGTCTATTGAGCGCCTCAGTGTTCTGAAACCTAAATTTGTCTCTGTGACTTACGGAGCAAATTCCGGCGAGCGCGACCGCACACACTCCGTGATCAAAGGGATCAAAGAAAAAACCGGGCTGATTGCCGTGCCGCATCTGACCTGTATTGATGCCACCCGCGATGAACTGAAAACCATCGCAAAAGATTACTGGGATAACGGCATCCGCCATATTGTGGCACTGCGCGGCGATTTGCCGGATAACAGCCGCAAACCGGATATGTATGCCGCCGACCTGGTCAATTTGTTAAAATCGGTCGCCGATTTTGATATTTCAGTCGCCGCTTACCCGGAAGTGCATCCGGAAGCACGCAGCGCGCAGGCAGACTTGATTAATCTCAAAAAGAAAATCGATGCCGGGGCAGACCGCGCTATCACGCAATTTTTCTTTGATGTCAGCACTTATCTGCGCTTTCGCGACCGCTGTGCCGCCGCAGGAATTGATGTGGAAATTGTTCCGGGGATACTGCCGGTATCCAATTTCAAACAGTTACAACGTTTTGCCGGTATGACCAACGTGCGCATTCCGGGCTGGCTCGGTAACATGTTTGAAGGGCTGGATGATGACCCGGAGTCACGCAAACTGGTTGGTGCATCGGTTGCGATGGAGATGGTGAAGATTCTCAGCCGCGAAGGCGTGAAAGATTTCCATTTTTACACCCTGAACCGCGCTGAGCTGACTTATGCAATCTGCCACACTTTAGGTGTCCGCCCTGCGGTAGCCTGTGTGGCATAAGAAAATCATTCACATCCTGAATAACTATACCCAACGTCATTCAGGATGCA