Homologs in group_1674

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10745 FBDBKF_10745 56.3 Morganella morganii S1 envZ two-component system sensor histidine kinase EnvZ
EHELCC_15080 EHELCC_15080 56.3 Morganella morganii S2 envZ two-component system sensor histidine kinase EnvZ
NLDBIP_14910 NLDBIP_14910 56.3 Morganella morganii S4 envZ two-component system sensor histidine kinase EnvZ
LHKJJB_14435 LHKJJB_14435 56.3 Morganella morganii S3 envZ two-component system sensor histidine kinase EnvZ
HKOGLL_13055 HKOGLL_13055 56.3 Morganella morganii S5 envZ two-component system sensor histidine kinase EnvZ
F4V73_RS14460 F4V73_RS14460 56.5 Morganella psychrotolerans envZ two-component system sensor histidine kinase EnvZ

Distribution of the homologs in the orthogroup group_1674

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1674

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A4P7TSF2 1.2e-177 507 53 0 440 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 1.2e-177 507 53 0 440 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 1.2e-177 507 53 0 440 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P08982 2.24e-174 499 52 0 440 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 2.24e-174 499 52 0 440 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 5.14e-173 495 52 0 440 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q9HZ47 2.98e-32 131 31 6 260 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H3GPN8 2.41e-30 125 31 5 266 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE82 1.83e-29 123 30 5 266 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.83e-29 123 30 5 266 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.83e-29 123 30 5 266 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P18392 2.78e-29 122 31 6 287 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P52101 4.61e-21 99 25 6 292 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q8XA47 5.11e-21 98 25 6 292 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q9Z5G7 7.23e-20 95 28 9 273 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
A0QBR0 6.46e-19 92 26 9 274 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q742C0 2.5e-18 90 25 9 274 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0R3I7 5.25e-18 89 27 8 266 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A3Q5L8 8.79e-18 89 22 13 451 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q1B3X9 9.2e-18 89 26 7 265 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 9.2e-18 89 26 7 265 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A0PWB3 2e-17 88 26 9 274 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P08401 2.21e-17 87 26 7 243 1 creC Sensor protein CreC Escherichia coli (strain K12)
A1KHB8 4.1e-17 87 27 10 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 4.1e-17 87 27 10 276 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A1TEL6 8.35e-17 85 26 8 265 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P9WGL1 1.58e-16 85 26 10 277 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.58e-16 85 26 10 277 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.58e-16 85 26 10 277 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P36557 2.14e-16 83 28 7 258 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P30844 7.26e-16 82 27 8 274 1 basS Sensor protein BasS Escherichia coli (strain K12)
P45675 1.15e-15 83 25 7 252 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
Q8CRA8 1.91e-15 81 24 8 274 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O33071 3.69e-15 80 26 8 292 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q5HLN1 4.72e-15 80 24 8 274 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A5A2P0 1.37e-14 79 28 7 235 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P9WGK7 1.62e-14 79 25 9 293 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.62e-14 79 25 9 293 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.62e-14 79 25 9 293 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZHD4 2.6e-14 78 25 9 286 3 silS Probable sensor kinase SilS Salmonella typhimurium
P23545 2.71e-14 78 27 8 237 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q8ZPP5 2.92e-14 79 24 11 356 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGL3 3.02e-14 79 27 6 244 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 3.15e-14 78 27 6 244 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32193 3.31e-14 77 23 8 302 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q45614 3.56e-14 78 29 10 243 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
A8Z553 5.2e-14 77 25 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 5.2e-14 77 25 7 261 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 5.2e-14 77 25 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 5.2e-14 77 25 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 5.2e-14 77 25 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q04850 7.04e-14 77 26 6 209 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2YZ23 8.3e-14 76 26 8 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P39453 1.01e-13 77 24 10 331 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q49ZT9 1.41e-13 75 23 7 270 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0A4I8 1.52e-13 75 24 7 286 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 1.52e-13 75 24 7 286 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P94414 1.62e-13 75 23 10 321 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P30847 1.65e-13 75 24 7 273 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q04804 1.7e-13 75 25 7 235 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8NV46 1.84e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.84e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P21865 1.9e-13 76 28 8 225 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q7A3X0 2.48e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 2.48e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 2.48e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 2.48e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 2.48e-13 75 24 7 261 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P42245 3.2e-13 73 25 6 257 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q9F8D7 3.21e-13 75 23 16 375 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P45608 3.64e-13 74 26 10 318 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P48027 4.09e-13 75 23 17 355 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q83RR1 4.57e-13 74 24 10 278 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
P23837 4.61e-13 74 24 10 278 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8FIB8 4.91e-13 74 24 10 278 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5HPC4 5.2e-13 74 25 5 243 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P58356 5.83e-13 74 24 10 331 3 torS Sensor protein TorS Escherichia coli O157:H7
O34206 6.35e-13 74 26 8 213 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q70FG9 8.23e-13 73 26 10 292 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q8CSL7 8.28e-13 73 25 5 243 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GE72 1.06e-12 73 24 7 259 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q07737 1.18e-12 73 26 9 287 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P0DMK6 1.35e-12 72 27 8 256 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q8X614 1.35e-12 72 25 6 199 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
I1WSZ3 1.41e-12 72 27 8 256 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P14377 1.55e-12 72 24 6 203 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q9HV31 3.04e-12 72 24 6 249 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q06067 3.04e-12 72 26 8 223 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P72292 3.64e-12 72 29 5 203 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q8X739 4.09e-12 71 24 9 277 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
P35164 4.3e-12 71 26 10 256 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q8Z7H3 4.37e-12 71 23 6 282 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 5.08e-12 71 23 6 282 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 5.08e-12 71 23 6 282 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 5.08e-12 71 23 6 282 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 5.08e-12 71 23 6 282 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 5.08e-12 71 23 6 282 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 5.08e-12 71 23 6 282 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q1RJB3 5.37e-12 71 23 10 286 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q8KIY1 7.28e-12 71 27 9 246 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P19906 8.38e-12 69 26 5 206 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P42707 9.49e-12 70 22 8 287 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
O34638 1.07e-11 70 24 13 366 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q95PI2 1.14e-11 70 30 12 220 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q44930 1.25e-11 69 25 10 277 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q8FK37 1.38e-11 69 24 5 239 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P08400 1.38e-11 69 26 12 312 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q8XBY4 1.4e-11 69 25 6 240 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q93CB7 1.51e-11 70 24 10 302 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q54SP4 1.54e-11 70 27 9 261 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P0AEC5 1.99e-11 70 30 10 204 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.99e-11 70 30 10 204 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.99e-11 70 30 10 204 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P77485 2e-11 69 24 5 239 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
P59342 2.06e-11 70 30 10 204 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
E0X9C7 2.07e-11 70 28 11 239 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A7HD43 2.11e-11 68 22 14 374 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
A5W4E3 2.13e-11 69 28 11 239 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8DPL8 2.29e-11 68 25 6 205 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 2.29e-11 68 25 6 205 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q08430 2.32e-11 68 23 5 212 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q92H24 2.49e-11 69 23 14 313 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
O69729 2.56e-11 68 26 9 228 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9CCJ1 2.56e-11 69 23 10 304 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q8ZLZ9 2.71e-11 68 27 8 244 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEC4 2.73e-11 69 25 7 235 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.73e-11 69 25 7 235 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 2.78e-11 69 25 7 235 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q8Z3P2 2.83e-11 68 27 8 244 3 qseC Sensor protein QseC Salmonella typhi
Q4UMD4 3.13e-11 68 22 12 310 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q55932 4.17e-11 68 26 7 223 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45609 5.01e-11 67 26 13 312 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P40719 5.19e-11 67 25 8 245 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P76339 5.57e-11 67 25 10 313 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q2JKD9 5.7e-11 67 24 9 279 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q3M8A7 8.5e-11 67 25 6 228 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YR50 8.89e-11 67 25 6 228 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q44007 1.87e-10 66 27 10 262 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P37894 2.22e-10 66 25 7 256 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2JWK9 2.58e-10 65 24 8 245 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q03228 2.65e-10 66 26 7 243 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P9WGK8 2.72e-10 65 23 7 281 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 2.72e-10 65 23 7 281 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O31671 3.04e-10 65 26 7 216 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q8X524 3.27e-10 65 25 8 245 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q9ZCU7 3.29e-10 65 23 12 312 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
P30855 3.29e-10 66 23 7 252 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q7A5H7 3.95e-10 65 29 9 226 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 3.95e-10 65 29 9 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GGK7 4.59e-10 65 29 9 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
P9WGK9 4.87e-10 65 22 7 281 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8NWF3 5.01e-10 65 29 9 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 5.01e-10 65 29 9 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 5.01e-10 65 29 9 226 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 5.01e-10 65 29 9 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 5.1e-10 65 29 9 226 1 srrB Sensor protein SrrB Staphylococcus aureus
P58402 5.18e-10 65 23 7 250 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q4A159 5.25e-10 65 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7BWI3 5.38e-10 64 28 11 219 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P0A4I6 5.59e-10 64 26 8 218 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 5.59e-10 64 26 8 218 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4L6C5 5.98e-10 64 24 5 230 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q0IBF4 6.15e-10 64 26 9 236 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q8GP19 6.9e-10 64 24 9 285 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q8CU87 8.08e-10 64 25 7 236 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 8.08e-10 64 25 7 236 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P45336 9.11e-10 63 24 9 279 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54883 9.59e-10 63 25 7 247 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q4LAJ8 1e-09 64 25 7 236 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q3AYV8 1.03e-09 63 28 10 221 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P33639 1.13e-09 63 24 8 218 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47457 1.3e-09 63 24 12 299 3 pcoS Probable sensor protein PcoS Escherichia coli
O34971 1.33e-09 64 24 5 229 3 kdpD Sensor protein KdpD Rathayibacter rathayi
B2J946 1.35e-09 63 24 7 231 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
O34989 1.35e-09 63 21 11 337 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q6GGZ4 1.36e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 1.41e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 1.41e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 1.41e-09 63 24 6 247 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 1.41e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 1.41e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 1.41e-09 63 24 6 247 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 1.41e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 1.46e-09 63 24 6 247 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A215 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 1.53e-09 63 26 8 238 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 1.53e-09 63 26 8 238 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 1.53e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QD58 1.56e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q9RDT3 1.57e-09 63 25 7 236 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q869S5 1.69e-09 63 25 9 224 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
A0QR01 1.78e-09 62 25 7 201 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
T2KMF4 1.78e-09 63 24 9 228 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
A0QTK3 2.21e-09 63 24 10 284 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6GKS6 2.4e-09 63 26 8 238 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P16497 2.46e-09 63 23 5 210 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P51392 2.5e-09 63 25 8 240 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q7U871 2.94e-09 62 28 9 218 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
P0C0F7 3.25e-09 62 22 7 250 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P26762 3.31e-09 63 24 10 260 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0C0F6 3.4e-09 62 22 7 250 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9I0I2 3.42e-09 62 35 1 99 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49XM6 4.41e-09 62 21 7 284 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P54302 4.41e-09 62 25 8 232 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P40330 5.12e-09 62 24 10 260 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9APE0 7.15e-09 61 22 8 220 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
P16575 8.55e-09 61 23 9 258 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q55630 1e-08 60 24 9 229 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P42422 1e-08 60 23 7 238 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
O14002 1.02e-08 61 27 13 220 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4L8M0 1.07e-08 60 22 6 266 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
B7KFU0 1.18e-08 60 23 7 225 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q68WC5 1.34e-08 60 23 12 312 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8DKG0 1.38e-08 60 26 8 217 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q06904 1.52e-08 60 22 8 282 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37461 1.79e-08 60 23 7 198 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGK5 2e-08 59 23 5 256 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2e-08 59 23 5 256 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2e-08 59 23 5 256 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9HWR3 2e-08 60 24 6 206 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C0Z0 2.06e-08 59 25 6 236 3 regB Sensor histidine kinase RegB Cereibacter sphaeroides
Q7V6P7 2.23e-08 59 27 9 203 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P0DMC6 2.23e-08 60 25 8 238 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 2.37e-08 60 25 8 238 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q3J6C1 2.38e-08 59 25 5 233 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P58662 2.52e-08 60 26 10 240 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q551X9 2.65e-08 60 28 10 224 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q56128 2.67e-08 60 26 10 240 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q54YH4 3.61e-08 59 24 9 219 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q9P896 4.02e-08 59 25 9 211 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8Z332 4.35e-08 58 22 7 198 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q1XD95 6.94e-08 58 26 9 224 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
P33113 7.43e-08 58 29 2 104 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q9KHI5 8.43e-08 58 24 7 213 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9M7M1 8.5e-08 58 25 7 219 2 ETR1 Ethylene receptor Prunus persica
A2C884 1.39e-07 57 26 9 203 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
A8G5E7 1.53e-07 57 26 8 202 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
P44578 1.92e-07 56 24 8 230 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P10047 2.02e-07 57 25 7 218 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
P94608 2.22e-07 57 23 5 221 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9ZWL6 2.22e-07 57 22 8 249 2 ETR1 Ethylene receptor Passiflora edulis
Q52969 2.28e-07 56 27 6 229 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q8FZ86 2.36e-07 57 25 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q9KLK7 2.4e-07 57 24 9 234 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0CI82 2.43e-07 57 25 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q87GU5 2.74e-07 56 23 8 232 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A2BRQ6 3.05e-07 55 25 7 193 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
B1WYT4 3.38e-07 55 24 7 206 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A3PDI2 3.49e-07 55 25 7 193 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q82EB2 3.86e-07 55 26 7 210 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9XH57 4.01e-07 56 25 8 240 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
B0JK50 4.25e-07 55 22 8 204 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9M715 5.07e-07 55 25 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
E5KK10 5.26e-07 55 25 13 312 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q7A1J2 5.39e-07 55 22 8 247 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 5.39e-07 55 22 8 247 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 5.39e-07 55 22 8 247 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 5.39e-07 55 22 8 247 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 5.39e-07 55 22 8 247 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIT7 5.69e-07 55 22 8 247 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q9HUI3 5.82e-07 55 26 10 230 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O81122 6.15e-07 55 22 8 248 2 ETR1 Ethylene receptor Malus domestica
P10955 6.42e-07 55 25 7 221 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
A6X5X4 7.27e-07 55 26 10 235 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A5VRX4 7.3e-07 55 24 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P0A2D9 7.92e-07 54 24 6 201 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 7.92e-07 54 24 6 201 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q7V113 8.57e-07 54 24 8 227 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q54U87 8.88e-07 55 24 9 232 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
P71380 9.12e-07 54 23 6 220 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7K3M6 9.28e-07 54 23 9 225 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q5HHW5 1.04e-06 54 22 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.04e-06 54 22 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.04e-06 54 22 8 253 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q9R6X3 1.06e-06 54 24 9 206 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q840P7 1.07e-06 54 22 8 253 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q57BR6 1.09e-06 55 24 8 236 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.09e-06 55 24 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.09e-06 55 24 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q31AE8 1.1e-06 54 24 7 193 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q8YIM6 1.16e-06 54 24 8 236 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P06218 1.77e-06 53 24 7 201 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
O49187 1.8e-06 53 21 8 246 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P09431 2.16e-06 53 30 4 115 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P39764 2.16e-06 53 23 7 211 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
O24972 2.35e-06 53 21 5 241 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
Q7MD16 2.44e-06 53 23 7 236 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8CTI3 2.48e-06 53 22 13 323 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.48e-06 53 22 13 323 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P96368 2.53e-06 53 24 6 224 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZEP3 2.59e-06 53 24 5 207 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1A697 3.14e-06 53 38 2 78 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q8D5Z6 3.16e-06 53 23 7 236 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q2T0V9 3.21e-06 53 23 10 236 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q02482 3.25e-06 53 26 3 150 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q06240 3.41e-06 52 24 9 226 1 vanS Sensor protein VanS Enterococcus faecium
Q5A872 3.76e-06 53 39 1 71 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q02541 4.83e-06 52 24 11 264 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
P28788 5.56e-06 52 24 6 205 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
Q41342 5.82e-06 52 22 8 249 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q9P4U6 6.4e-06 52 40 1 72 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P13633 7.39e-06 52 26 8 213 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
P0AFB7 7.41e-06 51 25 6 200 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 7.41e-06 51 25 6 200 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 7.41e-06 51 25 6 200 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q08408 7.44e-06 52 22 8 206 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P39928 1.14e-05 51 37 2 78 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P74111 1.35e-05 51 25 12 236 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O48929 1.52e-05 51 23 8 247 2 ETR1 Ethylene receptor Nicotiana tabacum
P26489 1.71e-05 50 30 3 120 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9I4F8 1.73e-05 50 24 5 233 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31661 1.8e-05 50 20 7 218 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P49333 1.88e-05 50 24 8 213 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q9XH58 1.97e-05 50 22 7 218 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
P20169 1.99e-05 50 22 8 240 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54RP6 2.36e-05 50 29 10 202 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q8NXR5 2.76e-05 49 26 2 98 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 2.76e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
Q7A6Z3 2.78e-05 49 26 2 98 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 2.78e-05 49 26 2 98 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 2.78e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 2.78e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 2.78e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z182 2.96e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 2.96e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 2.96e-05 49 26 2 98 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2YSS1 2.96e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G0D9 2.96e-05 49 26 2 98 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 2.96e-05 49 26 2 98 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q9SXL4 3.66e-05 50 33 1 75 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q8DN03 3.75e-05 49 21 8 219 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 3.75e-05 49 21 8 219 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q52977 4.17e-05 49 25 7 206 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
Q55168 4.27e-05 49 21 8 276 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q04943 4.37e-05 49 30 2 104 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O49230 4.55e-05 49 24 8 214 2 ETR1 Ethylene receptor 1 Brassica oleracea
P73276 5.35e-05 48 29 3 100 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P39664 7.4e-05 48 26 6 230 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9HU20 0.00011 48 21 6 212 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P15939 0.000142 48 33 1 80 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5A599 0.000156 48 23 11 255 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q03069 0.000156 47 21 8 224 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
O22267 0.000166 48 36 1 73 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q53RH0 0.000183 47 21 6 227 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 0.000183 47 21 6 227 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
O07778 0.000191 45 30 0 108 1 Rv0600c Sensor histidine kinase component HK1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49VK4 0.00021 47 21 7 204 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GJ10 0.000218 47 19 8 288 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q86CZ2 0.000238 47 25 13 226 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q2FWH7 0.00028 47 33 3 87 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P23621 0.000307 46 24 10 275 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10578 0.000331 46 41 1 53 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
P0DOA0 0.00035 47 30 1 82 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
O35044 0.000409 45 22 13 308 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
P41503 0.000484 45 37 1 53 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
Q8DMT2 0.000621 45 25 2 105 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5AHA0 0.000669 46 30 3 93 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q38846 0.000705 45 24 8 226 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14295
Feature type CDS
Gene envZ
Product two-component system sensor histidine kinase EnvZ
Location 3172721 - 3174061 (strand: 1)
Length 1341 (nucleotides) / 446 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1674
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07638 two-component system, OmpR family, osmolarity sensor histidine kinase EnvZ [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MRRLRLSPHNKLTRSLFLVISLLFFSLIASYVVVQHLIVGPSLQQFNKVLAYEIRTLVPEELILVDGTPLKISPALRNKIYNELGISFFDKDAALKAGLEWAREDLELSQQMTDYLNSDTTIWLENTLEYPILWINTQLSPTLWIRVPLTELGQNFLLPVYRQAIIFIIIVVAFFWLYNRFQNRPLHEVEYAARRIGKGVIPPPIPESGTAEMRSIIRAFNQMSSDIRSLDNDRTLVMAGVSHDLRTPLTRIRLATEMMSPEDSYLADSINKDIEDCDAIIGQFLDYMRTGKEMSLELCDMNGLLREVICAESNSGKVSEEHLYPYPINITANPIAVKRALTNMIVNATRYGHGWISITSNQNEEYAWFQVEDDGPGIAKEDRQRLFQPFVQGEQARSSTGAGLGLSIIRRIMDAHGGFVELGDSTKGGLLIRANFPLKVQEDEDD

Flanking regions ( +/- flanking 50bp)

GTTTGGGGACTGGGTTATGTCTTTGTACCTGATGGAACGAGCGTATCATAATGAGAAGGCTGAGGCTTTCACCCCACAATAAGCTCACTCGCTCTCTATTTCTGGTTATCTCATTACTTTTTTTTAGCTTGATAGCCAGTTATGTTGTTGTACAGCATCTTATTGTCGGGCCAAGCCTCCAGCAATTTAATAAAGTATTAGCGTATGAAATTCGTACGCTAGTACCGGAAGAACTGATCTTAGTCGATGGCACCCCACTTAAAATTTCTCCCGCTCTACGTAATAAAATTTACAACGAGTTAGGTATCTCATTTTTTGATAAAGACGCCGCTTTAAAAGCTGGTTTAGAGTGGGCAAGAGAAGATTTAGAACTTAGCCAGCAGATGACGGATTATCTCAATAGTGATACGACGATTTGGCTAGAAAACACCCTAGAGTATCCTATTTTATGGATTAATACCCAACTCTCACCCACGCTATGGATACGCGTACCACTTACCGAATTAGGGCAAAATTTCTTATTACCCGTTTATCGGCAAGCCATTATTTTTATCATCATCGTAGTGGCATTTTTCTGGTTATATAACCGTTTTCAAAATCGTCCATTGCATGAAGTTGAATATGCAGCACGACGCATTGGTAAAGGGGTGATCCCTCCGCCAATACCTGAATCTGGCACTGCTGAAATGCGTTCAATTATTCGAGCATTTAATCAAATGTCATCAGATATTCGCTCATTAGATAATGATAGAACACTGGTGATGGCAGGAGTAAGCCATGATTTACGCACTCCGTTAACGCGTATTCGTCTTGCTACAGAAATGATGAGTCCTGAAGATAGTTATCTTGCAGATTCTATCAATAAAGATATTGAAGATTGCGATGCCATTATCGGTCAATTTTTAGACTATATGCGCACAGGCAAAGAGATGTCTTTAGAATTATGTGATATGAATGGTCTATTGCGAGAAGTGATCTGCGCTGAATCTAACTCAGGTAAAGTCAGCGAAGAGCATTTATACCCTTATCCTATCAATATCACAGCAAACCCAATTGCCGTCAAACGGGCGCTTACCAATATGATTGTTAATGCCACACGCTACGGACATGGTTGGATAAGCATCACAAGTAATCAAAATGAAGAATATGCTTGGTTTCAAGTTGAAGACGATGGTCCAGGCATTGCCAAAGAAGATAGACAACGTTTATTCCAACCCTTTGTTCAAGGGGAACAAGCTCGAAGTTCAACCGGTGCGGGTTTAGGTCTATCCATTATTCGTCGGATCATGGATGCCCATGGTGGCTTTGTCGAACTCGGCGATAGCACGAAAGGCGGGTTACTTATCCGTGCCAACTTTCCGTTAAAAGTGCAAGAAGACGAAGATGATTAATATCCTCACTTTTCAACGTTAACGCCCTTCTTATTCTTTCTCACCTATTT