Homologs in group_1674

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10745 FBDBKF_10745 100.0 Morganella morganii S1 envZ two-component system sensor histidine kinase EnvZ
EHELCC_15080 EHELCC_15080 100.0 Morganella morganii S2 envZ two-component system sensor histidine kinase EnvZ
LHKJJB_14435 LHKJJB_14435 100.0 Morganella morganii S3 envZ two-component system sensor histidine kinase EnvZ
HKOGLL_13055 HKOGLL_13055 100.0 Morganella morganii S5 envZ two-component system sensor histidine kinase EnvZ
F4V73_RS14460 F4V73_RS14460 88.1 Morganella psychrotolerans envZ two-component system sensor histidine kinase EnvZ
PMI_RS14295 PMI_RS14295 56.3 Proteus mirabilis HI4320 envZ two-component system sensor histidine kinase EnvZ

Distribution of the homologs in the orthogroup group_1674

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1674

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P08982 0.0 545 57 0 442 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 0.0 545 57 0 442 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 0.0 542 57 0 442 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
A0A4P7TSF2 0.0 539 57 0 442 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 0.0 539 57 0 442 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 0.0 539 57 0 442 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q9HZ47 2.75e-33 134 32 6 260 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P18392 2.61e-27 116 30 6 287 1 rstB Sensor protein RstB Escherichia coli (strain K12)
A0A0H3GPN8 6.12e-27 115 30 6 266 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE82 4.86e-26 113 30 6 266 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 4.86e-26 113 30 6 266 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 4.86e-26 113 30 6 266 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q70FG9 9.08e-22 99 31 11 300 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
P23545 3.99e-19 93 28 7 229 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q8CRA8 1.96e-18 90 25 9 266 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLN1 3.77e-18 89 25 9 266 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WGK7 1.1e-17 88 28 13 291 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.1e-17 88 28 13 291 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.1e-17 88 28 13 291 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P36557 2.43e-17 86 28 11 284 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52101 3.35e-17 87 26 7 279 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q8XA47 5.28e-17 86 26 7 279 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q4L8M0 5.53e-17 86 23 8 296 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
A1TEL6 1.14e-16 85 28 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
O32193 2.04e-16 84 23 10 295 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P42707 3.96e-16 83 23 10 346 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
P94414 4.22e-16 84 23 10 304 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P0DMC6 1.03e-15 83 28 6 236 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 1.06e-15 83 28 6 236 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
O33071 1.14e-15 82 25 7 282 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P45608 1.32e-15 82 28 6 237 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
A0QBR0 2.93e-15 81 27 6 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
P08400 3e-15 80 30 8 245 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q56128 3.23e-15 82 27 6 236 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q4LAJ8 3.76e-15 81 27 7 236 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9F8D7 4.01e-15 81 23 12 369 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q8XBY4 5.53e-15 80 25 9 289 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P08401 6.34e-15 80 24 10 280 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q9RDT3 8.23e-15 79 27 6 229 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q8FK37 9.02e-15 79 25 9 289 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q742C0 9.23e-15 79 26 6 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P58662 1.17e-14 80 27 6 236 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34638 1.17e-14 79 27 6 218 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
O69729 1.33e-14 79 32 10 217 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P77485 1.52e-14 79 25 9 289 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
A6QD58 1.77e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q1B3X9 2.01e-14 79 28 8 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 2.01e-14 79 28 8 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A3Q5L8 2.05e-14 78 28 8 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q7A215 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 2.2e-14 79 27 6 229 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 2.2e-14 79 27 6 229 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 2.2e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
P30844 2.23e-14 77 26 10 287 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q6GKS6 2.28e-14 79 27 6 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
O34206 2.34e-14 79 28 9 258 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
A5A2P0 3.13e-14 77 28 6 229 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q83RR1 3.17e-14 78 27 13 295 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q5HPC4 3.21e-14 77 24 8 287 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P45609 3.21e-14 77 29 8 245 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P23837 3.25e-14 78 27 13 295 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8FIB8 3.47e-14 77 27 13 295 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8CU87 3.66e-14 78 26 6 230 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 3.66e-14 78 26 6 230 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0PWB3 3.73e-14 77 27 10 284 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q8CSL7 4.24e-14 77 25 7 287 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P30847 4.99e-14 77 24 5 275 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P39453 5.29e-14 78 27 7 250 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8X739 6.32e-14 77 27 13 295 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
P58356 8.76e-14 77 28 7 253 3 torS Sensor protein TorS Escherichia coli O157:H7
Q4A159 9.74e-14 77 27 6 230 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49XM6 1.06e-13 76 25 8 280 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1RJB3 1.28e-13 76 24 11 297 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
P0A4I8 1.55e-13 75 25 7 242 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 1.55e-13 75 25 7 242 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P35164 1.76e-13 75 28 10 284 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q8NV46 1.82e-13 75 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.82e-13 75 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q9ZHD4 1.95e-13 75 26 9 279 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q9HV31 1.95e-13 75 26 8 261 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8Z553 2.07e-13 75 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 2.07e-13 75 23 8 286 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 2.07e-13 75 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 2.07e-13 75 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 2.07e-13 75 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
A0R3I7 2.64e-13 75 27 7 266 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7A3X0 3.29e-13 74 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 3.29e-13 74 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 3.29e-13 74 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 3.29e-13 74 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 3.29e-13 74 23 8 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WGL1 3.3e-13 75 27 9 278 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 3.3e-13 75 27 9 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 3.3e-13 75 27 9 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KHB8 3.48e-13 74 27 9 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 3.48e-13 74 27 9 278 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9Z5G7 3.57e-13 75 26 6 275 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q06067 5.44e-13 74 28 7 215 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P42422 6.72e-13 72 24 10 302 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
P21865 7.3e-13 74 28 8 241 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
P48027 7.41e-13 74 22 12 352 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P33113 8.87e-13 73 24 7 229 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P33639 9.04e-13 73 24 5 219 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P16497 1.04e-12 73 22 6 259 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q4UMD4 1.09e-12 73 25 13 328 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q2YZ23 1.14e-12 73 23 7 267 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q92H24 1.41e-12 73 25 13 330 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
O31671 1.46e-12 72 27 9 217 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q6GE72 1.58e-12 72 23 8 280 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
P42245 2.4e-12 71 27 8 237 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q45614 4.22e-12 71 27 7 243 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P0DM80 4.94e-12 71 23 8 288 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 4.94e-12 71 23 8 288 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 4.94e-12 71 23 8 288 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 4.94e-12 71 23 8 288 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 4.94e-12 71 23 8 288 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 4.94e-12 71 23 8 288 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 5.02e-12 71 23 8 288 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P94608 1e-11 70 25 8 293 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O34989 1.05e-11 70 23 9 308 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q7A0W5 1.77e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 1.77e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 1.77e-11 69 24 8 297 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 1.77e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 1.77e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 1.77e-11 69 24 8 297 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 1.77e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
A7HD43 1.78e-11 68 27 6 210 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q6GGZ4 1.84e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q9ZCU7 1.99e-11 69 23 10 323 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
P71380 2.01e-11 69 22 6 231 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2YY04 2.01e-11 69 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P39764 2.75e-11 68 24 8 256 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q44930 2.9e-11 68 24 12 313 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q2JWK9 3.09e-11 68 28 9 231 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q44007 3.25e-11 68 26 6 242 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q68WC5 3.26e-11 68 24 10 318 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q55932 3.34e-11 68 24 5 218 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45336 3.37e-11 68 24 6 283 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEC5 3.87e-11 68 29 10 214 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 3.87e-11 68 29 10 214 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 3.87e-11 68 29 10 214 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P59342 4.15e-11 68 29 10 214 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q04943 4.85e-11 68 25 5 281 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9HU20 8.65e-11 67 27 5 217 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L6C5 9.68e-11 67 26 10 284 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q2JKD9 1.23e-10 66 28 9 249 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q87GU5 1.33e-10 67 25 9 257 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q08430 1.37e-10 66 23 7 217 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P96368 1.45e-10 66 27 5 216 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL3 1.78e-10 67 25 6 260 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O81122 1.83e-10 66 25 10 264 2 ETR1 Ethylene receptor Malus domestica
P9WGL2 1.94e-10 66 25 6 260 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8ZPP5 2.25e-10 66 24 6 235 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9SSY6 3.36e-10 65 25 8 233 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q06240 4.98e-10 64 26 10 247 1 vanS Sensor protein VanS Enterococcus faecium
A0QTK3 6.79e-10 64 26 9 260 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9KHI5 7.2e-10 65 30 10 233 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P23621 9.5e-10 63 27 6 218 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P07167 9.78e-10 64 26 10 262 3 virA Limited host range VirA protein Rhizobium radiobacter
Q49ZT9 1.27e-09 63 22 7 260 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9P896 1.28e-09 63 23 8 211 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q47457 1.77e-09 63 23 10 284 3 pcoS Probable sensor protein PcoS Escherichia coli
O82436 2.02e-09 63 23 18 443 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9M7M1 2.17e-09 63 25 7 232 2 ETR1 Ethylene receptor Prunus persica
Q82EB2 2.28e-09 62 27 13 291 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q95PI2 2.39e-09 63 26 10 219 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q06904 2.41e-09 62 23 8 290 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8DKG0 2.55e-09 63 29 8 229 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O31661 2.97e-09 62 25 11 218 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P40719 3.55e-09 62 24 15 355 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q04804 3.88e-09 62 22 8 249 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DPL8 4.23e-09 62 25 7 228 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 4.23e-09 62 25 7 228 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8X524 4.31e-09 62 23 14 351 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q551X9 5.77e-09 62 28 9 231 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P19906 6.5e-09 60 22 6 228 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P37894 6.65e-09 62 25 10 255 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P26762 8.39e-09 61 27 10 241 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q93CB7 8.45e-09 61 24 11 300 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P40330 8.62e-09 61 27 10 241 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8X614 9.16e-09 60 24 7 226 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
P54302 9.41e-09 61 24 9 254 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q9ZWL6 1.01e-08 61 24 9 254 2 ETR1 Ethylene receptor Passiflora edulis
Q8YR50 1.2e-08 60 26 8 249 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q840P7 1.27e-08 60 26 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q54U87 1.31e-08 61 24 10 239 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q7A1J2 1.43e-08 60 26 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.43e-08 60 26 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.43e-08 60 26 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.43e-08 60 26 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.43e-08 60 26 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIT7 1.48e-08 59 26 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q3M8A7 1.6e-08 60 26 8 249 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5HHW5 1.68e-08 59 26 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.68e-08 59 26 9 255 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.68e-08 59 26 9 255 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
P0C0F6 1.71e-08 60 24 9 249 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 1.77e-08 60 24 9 249 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P16575 1.95e-08 60 27 10 241 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q869S5 2.13e-08 60 25 10 237 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q9APE0 2.35e-08 59 25 9 240 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q6GGK7 2.92e-08 59 24 11 266 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q8DXQ8 2.93e-08 59 24 7 214 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3C7 3.29e-08 58 24 7 214 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
P0A4I6 3.32e-08 59 25 8 231 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 3.32e-08 59 25 8 231 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0DMK6 3.77e-08 58 24 9 259 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
O14002 3.91e-08 59 24 8 216 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
I1WSZ3 4.58e-08 58 24 9 257 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q9KLK7 5.01e-08 59 25 9 226 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10047 5.44e-08 58 29 9 226 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q47745 5.62e-08 58 25 12 288 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q8KIY1 5.84e-08 58 28 8 240 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q9HWR3 6.02e-08 58 25 8 206 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P14377 6.88e-08 58 24 7 228 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q9I0I2 6.98e-08 58 25 11 268 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3S4A7 7.52e-08 58 23 14 315 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P9WGK5 7.75e-08 57 27 7 231 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 7.75e-08 57 27 7 231 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 7.75e-08 57 27 7 231 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7A5H7 8.35e-08 58 24 11 266 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 8.35e-08 58 24 11 266 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
B2J946 8.49e-08 57 24 7 233 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q9L523 9.27e-08 58 24 11 266 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 9.44e-08 58 24 11 266 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 9.44e-08 58 24 11 266 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 9.44e-08 58 24 11 266 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 9.44e-08 58 24 11 266 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8ZLZ9 9.59e-08 57 25 9 242 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 1e-07 57 25 9 242 3 qseC Sensor protein QseC Salmonella typhi
E0X9C7 1.06e-07 58 26 10 246 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 1.11e-07 58 26 10 246 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q52977 1.17e-07 57 26 11 230 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
O48929 1.19e-07 57 23 9 261 2 ETR1 Ethylene receptor Nicotiana tabacum
P72292 1.33e-07 57 25 9 274 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q9XH58 1.35e-07 57 23 8 268 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q52969 1.47e-07 57 25 6 226 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q41342 1.63e-07 57 24 10 263 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q9XH57 1.69e-07 57 22 8 269 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9SXL4 1.7e-07 57 21 9 276 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
O24972 2.27e-07 56 22 8 248 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P45675 2.3e-07 57 21 8 260 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
P0AEC4 2.38e-07 57 25 7 233 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.38e-07 57 25 7 233 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
O49187 2.52e-07 57 36 3 84 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P58363 2.55e-07 57 25 7 233 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q03228 3.55e-07 56 25 6 239 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9CCJ1 3.88e-07 56 25 9 302 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P10955 3.89e-07 55 25 8 254 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
P15939 4.02e-07 56 26 4 182 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8CTI3 4.04e-07 55 26 11 242 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 4.04e-07 55 26 11 242 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P76339 4.13e-07 55 23 11 276 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q07737 4.45e-07 55 25 6 207 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q54YH4 4.93e-07 56 26 7 223 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P49333 5.58e-07 55 24 7 228 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P74111 5.91e-07 55 26 11 234 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q38846 6.18e-07 55 23 15 405 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q9HUI3 6.19e-07 55 28 9 228 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P20169 6.52e-07 55 21 7 248 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0IBF4 7.09e-07 54 28 6 202 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P9WGK8 7.13e-07 55 24 8 260 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 7.13e-07 55 24 8 260 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7V6P7 8.91e-07 54 25 9 271 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P51392 9.7e-07 55 24 8 230 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q54RP6 9.75e-07 55 25 11 235 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P28788 9.79e-07 54 25 7 220 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
P06218 9.92e-07 54 26 8 221 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q8DN03 9.97e-07 54 23 7 216 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 9.97e-07 54 23 7 216 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P0AFB7 1.07e-06 53 27 8 204 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 1.07e-06 53 27 8 204 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 1.07e-06 53 27 8 204 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
B8AY75 1.07e-06 54 24 10 255 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q55630 1.08e-06 54 21 5 229 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0DKM0 1.11e-06 54 24 10 255 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q7MD16 1.14e-06 54 29 3 118 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 1.14e-06 54 29 3 118 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
P0A2D9 1.19e-06 53 26 9 221 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 1.19e-06 53 26 9 221 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
P9WGK9 1.33e-06 54 24 8 260 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A2C884 1.34e-06 53 25 10 271 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
B0JK50 1.43e-06 53 24 9 226 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
T2KMF4 1.48e-06 54 24 8 239 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q8ZPP6 1.49e-06 54 24 11 283 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q54SP4 1.76e-06 54 24 8 262 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
A0QR01 1.82e-06 53 26 7 207 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P37461 1.85e-06 53 23 7 222 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 2.04e-06 53 23 7 222 3 zraS Sensor histidine kinase ZraS Salmonella typhi
O49230 2.13e-06 53 23 9 248 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q02482 2.32e-06 53 25 2 112 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q3AYV8 2.5e-06 53 27 8 218 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q9ZEP3 2.64e-06 53 27 6 216 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P07168 2.77e-06 53 27 6 177 3 virA Wide host range VirA protein Rhizobium radiobacter
Q08408 2.87e-06 53 22 7 238 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P39664 3.49e-06 52 29 11 242 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P10799 3.51e-06 53 27 5 155 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P73276 3.77e-06 52 24 6 223 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
E5KK10 4.04e-06 53 27 9 235 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q54YZ9 4.44e-06 53 26 11 230 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P54883 4.81e-06 52 25 6 239 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q04850 5.57e-06 52 24 9 224 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B7KFU0 7.33e-06 51 24 8 226 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q86CZ2 8.02e-06 52 24 9 245 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q2T0V9 8.84e-06 51 24 9 227 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P10578 1.08e-05 51 24 10 244 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q53RH0 1.44e-05 51 21 16 451 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 1.44e-05 51 21 16 451 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q7BWI3 2.06e-05 50 26 8 242 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9R6X3 2.16e-05 50 21 7 236 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5A872 2.94e-05 50 38 1 72 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q55168 3.33e-05 50 21 9 219 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P41503 3.73e-05 49 25 11 238 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
Q1XD95 5.2e-05 49 22 8 230 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
P18540 5.98e-05 49 30 4 123 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KM24 6.53e-05 48 25 8 202 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P39928 6.72e-05 49 37 1 72 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P09431 9.14e-05 48 25 8 222 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P96601 0.000114 48 26 9 179 3 dctS Probable C4-dicarboxylate sensor kinase Bacillus subtilis (strain 168)
P37739 0.00013 48 36 1 73 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
P23222 0.000132 47 36 1 72 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8FZ86 0.000171 47 22 10 244 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 0.000174 47 22 10 244 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
P58402 0.000204 47 24 3 112 3 evgS Sensor protein EvgS Escherichia coli O157:H7
O35044 0.000213 47 20 10 292 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q7D9K1 0.000221 47 26 5 207 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P30855 0.000224 47 24 3 112 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
A3PDI2 0.000254 46 24 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q2FWH7 0.000311 47 24 8 224 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
B7K3M6 0.000337 46 22 5 224 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
A9M715 0.000342 47 22 10 244 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9K620 0.000343 46 23 9 228 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q10MG9 0.000422 46 23 10 235 2 PHYB Phytochrome B Oryza sativa subsp. japonica
P30663 0.000474 46 32 1 80 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
A2BRQ6 0.000496 45 25 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q7U871 0.000525 45 27 9 222 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q8GP19 0.000561 45 23 12 269 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
O25026 0.000602 45 29 2 82 1 flgS Sensor histidine kinase FlgS Helicobacter pylori (strain ATCC 700392 / 26695)
Q5AHA0 0.00061 46 26 11 214 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A2XFW2 0.00069 45 23 10 235 3 PHYB Phytochrome B Oryza sativa subsp. indica
P44578 0.000756 45 23 9 224 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1WYT4 0.000813 45 22 7 241 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q9P4U6 0.001 45 38 1 72 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_14910
Feature type CDS
Gene envZ
Product two-component system sensor histidine kinase EnvZ
Location 116798 - 118132 (strand: 1)
Length 1335 (nucleotides) / 444 (amino acids)
In genomic island -

Contig

Accession ZDB_530
Length 141725 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1674
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07638 two-component system, OmpR family, osmolarity sensor histidine kinase EnvZ [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MKRLRFSPRSTFSRSLFLVIFLLFATITTSYLAVVNFIVMPSLQQFNRVLAYEVRTLMSEEMVLKDGTAVRVSPALRKKIYEELGITFFTEKTADEGGLRWARHFESLSKQMSHYLDGYADVRLEVSRDYPVLWLNSYIAPDVWVRVPLTEIGQDQFSPVFRYIFAFLLIVFAGVWVFIRYQNRPLTELESAARQIGTGGPLVPVREAGAAEVRSVIRSFNQMSRDIKTLEQDRTVLMAGVSHDLRTPLTRIRLATEMMNPDDDYLAESINNDIEECDGIIEQFMAYLRTGREMEMVHLELTSVLNEVIEAHIHSDVTLQNDVIQAPVYLTGNPIAIKRALGNMLVNATRYGNGWIRVSSGSDEHFAWFQVEDDGNGIDEADIPDLFQPFVQGEKARSNKGTGLGLAILRRIVDAHDGKIDVGRSQRGGFRIRVMLPLPDDRDD

Flanking regions ( +/- flanking 50bp)

CAGACCGTCTGGGGACTGGGTTACGTGTTCGTTCCGGACGGCAACAAGGCATGAAACGGCTGCGGTTCTCGCCGAGGAGCACTTTTTCGCGCTCGTTATTTCTGGTCATCTTTCTGTTGTTTGCAACCATAACAACAAGTTATCTGGCCGTTGTGAACTTCATTGTGATGCCCAGCCTGCAGCAGTTTAACCGGGTGCTGGCCTATGAAGTACGCACACTGATGAGCGAAGAGATGGTGCTGAAGGACGGAACCGCGGTACGTGTTTCTCCGGCGCTGCGTAAGAAAATTTATGAAGAGCTGGGCATTACCTTTTTTACCGAAAAGACAGCCGATGAGGGCGGACTGCGCTGGGCGCGTCATTTTGAATCCCTCAGTAAACAGATGAGCCATTATCTGGACGGTTATGCGGATGTCCGGCTGGAAGTCAGCCGCGATTATCCCGTGCTGTGGCTGAACTCCTATATTGCCCCGGATGTCTGGGTGAGAGTGCCGCTGACTGAAATCGGTCAGGATCAGTTCTCGCCGGTCTTCCGTTATATTTTTGCCTTTCTGCTGATTGTCTTTGCAGGTGTCTGGGTGTTTATCCGCTATCAGAACCGTCCGCTGACCGAGCTGGAATCCGCAGCCCGGCAAATCGGTACCGGCGGTCCGCTGGTTCCGGTACGGGAAGCCGGGGCGGCAGAAGTGCGCTCGGTTATCCGCTCGTTTAACCAGATGTCCAGAGATATCAAAACGCTGGAGCAGGATCGCACCGTGCTGATGGCCGGTGTCAGCCATGATCTGCGCACGCCGCTGACCCGCATCCGCCTGGCAACGGAAATGATGAACCCGGATGACGATTATCTGGCGGAATCCATCAACAATGATATTGAAGAGTGTGACGGTATCATTGAGCAGTTTATGGCGTATCTGCGCACCGGCCGTGAGATGGAGATGGTGCATCTGGAACTGACATCTGTCCTCAATGAGGTGATTGAAGCGCACATCCACTCGGATGTCACACTTCAGAATGATGTTATTCAGGCACCGGTTTATCTCACCGGTAACCCGATTGCGATTAAACGCGCACTGGGCAATATGCTGGTCAATGCCACCCGCTACGGCAACGGCTGGATCCGCGTCAGCAGCGGCAGTGATGAGCATTTTGCCTGGTTCCAGGTGGAAGATGACGGCAACGGTATTGATGAGGCGGATATTCCGGACCTGTTCCAGCCGTTTGTGCAGGGTGAAAAAGCGCGCAGTAATAAAGGTACCGGGCTGGGGCTGGCAATTCTGCGCCGGATTGTGGATGCGCATGACGGCAAAATTGATGTCGGCCGCAGTCAGCGCGGCGGATTCCGTATCCGCGTGATGCTGCCGCTGCCGGATGACAGAGATGATTAATTATTATGACAGCAGCATGTCATCGTCATATGACTGTCATAAACCCCTGC