Homologs in group_1674

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10745 FBDBKF_10745 88.1 Morganella morganii S1 envZ two-component system sensor histidine kinase EnvZ
EHELCC_15080 EHELCC_15080 88.1 Morganella morganii S2 envZ two-component system sensor histidine kinase EnvZ
NLDBIP_14910 NLDBIP_14910 88.1 Morganella morganii S4 envZ two-component system sensor histidine kinase EnvZ
LHKJJB_14435 LHKJJB_14435 88.1 Morganella morganii S3 envZ two-component system sensor histidine kinase EnvZ
HKOGLL_13055 HKOGLL_13055 88.1 Morganella morganii S5 envZ two-component system sensor histidine kinase EnvZ
PMI_RS14295 PMI_RS14295 56.5 Proteus mirabilis HI4320 envZ two-component system sensor histidine kinase EnvZ

Distribution of the homologs in the orthogroup group_1674

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1674

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P08982 0.0 556 58 0 442 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 0.0 556 58 0 442 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 0.0 554 58 0 442 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
A0A4P7TSF2 0.0 548 58 0 442 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 0.0 548 58 0 442 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 0.0 548 58 0 442 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q9HZ47 4.43e-30 125 30 4 258 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P18392 2.17e-25 110 28 5 278 1 rstB Sensor protein RstB Escherichia coli (strain K12)
A0A0H3GPN8 2.3e-23 105 29 7 270 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE82 3.47e-23 104 29 6 268 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 3.47e-23 104 29 6 268 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 3.47e-23 104 29 6 268 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q70FG9 7.73e-21 97 29 9 299 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q8CRA8 7.39e-19 92 24 7 266 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLN1 1.62e-18 90 24 7 266 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P36557 4.75e-18 88 29 9 272 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23545 3.13e-17 87 29 9 231 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P30844 1.8e-16 84 27 7 259 1 basS Sensor protein BasS Escherichia coli (strain K12)
P52101 1.91e-16 84 25 7 274 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P45608 2.3e-16 84 30 7 232 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q8XA47 2.56e-16 84 25 7 274 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
O32193 3.43e-16 84 23 10 294 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P08400 5.04e-16 83 30 10 254 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
A0QBR0 7.03e-16 83 27 6 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
P42707 1.68e-15 81 24 8 302 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
Q4L8M0 1.87e-15 81 24 8 298 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q742C0 2.26e-15 81 26 6 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A1TEL6 3.96e-15 80 27 5 262 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P45609 3.97e-15 80 30 10 254 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P30847 5.61e-15 80 25 8 277 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q8XBY4 5.74e-15 80 28 10 259 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
O34638 6.58e-15 80 28 5 216 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
A8Z553 7.83e-15 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 7.83e-15 79 24 8 291 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 7.83e-15 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 7.83e-15 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 7.83e-15 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q7A3X0 1.04e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 1.04e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 1.04e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 1.04e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 1.04e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P08401 1.35e-14 79 25 9 278 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q8NV46 1.68e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.68e-14 79 24 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P77485 1.78e-14 79 27 12 295 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q83RR1 1.83e-14 79 27 14 295 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
P23837 1.87e-14 79 27 14 295 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q6GE72 1.88e-14 78 25 8 284 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q8FIB8 1.93e-14 78 27 14 295 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FK37 2.25e-14 78 27 12 295 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O69729 2.63e-14 78 30 8 204 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q2YZ23 3.16e-14 77 25 7 272 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q06067 3.4e-14 78 29 8 202 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q8X739 4.04e-14 77 27 14 295 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q9HV31 5.15e-14 77 24 4 258 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I8 8.33e-14 76 27 7 242 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 8.33e-14 76 27 7 242 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0R3I7 8.55e-14 76 26 5 267 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGL3 2.4e-13 75 28 6 237 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 2.55e-13 75 28 6 237 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1B3X9 2.66e-13 75 26 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 2.66e-13 75 26 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A3Q5L8 2.66e-13 75 26 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
P94414 3.02e-13 75 21 8 304 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q5HPC4 4.37e-13 74 26 10 272 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CSL7 5.37e-13 74 26 10 272 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9Z5G7 6.31e-13 74 27 8 274 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
O33071 7.85e-13 73 25 9 284 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P94608 8.35e-13 74 29 7 215 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q49XM6 9.9e-13 73 25 9 272 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P16497 1.14e-12 73 22 6 240 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P96368 1.22e-12 73 30 7 214 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O31671 1.69e-12 72 27 7 214 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
A0PWB3 1.73e-12 72 25 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P9WGK7 2.05e-12 72 25 10 290 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 2.05e-12 72 25 10 290 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 2.05e-12 72 25 10 290 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P35164 2.23e-12 72 28 9 238 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P58662 2.31e-12 72 27 8 239 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4UMD4 2.4e-12 72 24 11 307 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q44007 2.92e-12 72 26 6 226 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4L6C5 3.02e-12 71 26 11 285 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
P0DMC6 3.26e-12 72 27 8 239 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 3.43e-12 72 27 8 239 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q92H24 4.09e-12 71 24 11 307 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P42245 4.54e-12 70 27 7 237 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q9ZHD4 5.09e-12 71 22 8 293 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q6GGZ4 5.32e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 5.41e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 5.41e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 5.41e-12 70 24 8 297 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 5.41e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 5.41e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 5.41e-12 70 24 8 297 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 5.41e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q9F8D7 5.69e-12 71 22 11 373 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q2YY04 5.71e-12 70 24 8 297 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q45614 6.12e-12 71 25 6 238 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q56128 6.52e-12 71 27 8 239 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P33639 7.09e-12 70 24 5 219 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04943 7.61e-12 70 24 6 286 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O34206 1.43e-11 70 27 8 213 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q8Z7H3 1.47e-11 69 25 11 295 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 1.54e-11 69 25 11 295 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 1.54e-11 69 25 11 295 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 1.54e-11 69 25 11 295 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 1.54e-11 69 25 11 295 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 1.54e-11 69 25 11 295 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 1.54e-11 69 25 11 295 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
P21865 1.78e-11 70 27 7 241 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q9RDT3 2.63e-11 68 26 6 211 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q68WC5 2.73e-11 69 24 10 307 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O34989 3.87e-11 68 26 6 231 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q44930 4.27e-11 67 24 12 314 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P42422 4.35e-11 67 24 11 296 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q9HU20 4.67e-11 68 25 8 256 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1KHB8 4.88e-11 68 24 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 4.88e-11 68 24 5 263 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6GKS6 5.08e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P45336 5.21e-11 67 25 11 286 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q47457 5.46e-11 67 24 11 289 3 pcoS Probable sensor protein PcoS Escherichia coli
A6QD58 5.49e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q49ZT9 6.04e-11 67 22 6 261 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A215 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 6.33e-11 68 26 6 211 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 6.33e-11 68 26 6 211 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 6.33e-11 68 26 6 211 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9ZCU7 6.78e-11 67 24 10 307 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
A5A2P0 7.65e-11 67 27 7 228 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q2JKD9 1.72e-10 65 29 10 237 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q54SP4 2.06e-10 67 25 11 277 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q2JWK9 2.28e-10 65 25 6 228 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
P48027 2.28e-10 66 21 11 356 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q4LAJ8 2.37e-10 66 25 7 236 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q8CU87 2.88e-10 65 25 6 211 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 2.88e-10 65 25 6 211 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1RJB3 3.41e-10 65 22 10 286 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q8DPL8 3.44e-10 65 26 11 234 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 3.44e-10 65 26 11 234 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04804 3.94e-10 65 23 7 229 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39453 4.45e-10 65 26 8 251 1 torS Sensor protein TorS Escherichia coli (strain K12)
P71380 4.48e-10 65 22 8 226 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P58356 4.89e-10 65 26 7 233 3 torS Sensor protein TorS Escherichia coli O157:H7
P72292 5.62e-10 65 26 9 287 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q07737 6.27e-10 65 28 6 205 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P40719 8.82e-10 63 23 8 266 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q08430 9.62e-10 63 24 8 221 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
I1WSZ3 1.16e-09 63 27 11 261 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P9WGL1 1.29e-09 63 24 5 263 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.29e-09 63 24 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.29e-09 63 24 5 263 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8X524 1.49e-09 63 23 8 266 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q4A159 1.52e-09 63 25 7 231 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0C0F7 1.64e-09 63 25 9 240 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 1.73e-09 63 25 9 240 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0DMK6 1.89e-09 63 27 10 258 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
A2C884 2.06e-09 62 26 11 282 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q7V6P7 2.28e-09 62 25 11 282 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P37894 2.48e-09 63 26 9 216 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8ZPP5 3.41e-09 62 21 8 312 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P51392 4.01e-09 62 23 9 257 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
O81122 4.04e-09 62 26 9 235 2 ETR1 Ethylene receptor Malus domestica
Q9HWR3 4.78e-09 62 27 7 212 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P74111 4.97e-09 62 28 11 237 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
E0X9C7 6.29e-09 62 27 10 254 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 6.58e-09 62 27 10 254 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q87GU5 7.18e-09 61 24 9 244 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P19906 7.3e-09 60 24 7 228 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q9M7M1 8.79e-09 61 26 9 223 2 ETR1 Ethylene receptor Prunus persica
Q9P896 1.01e-08 61 25 10 211 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P23621 1.03e-08 60 25 7 231 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q869S5 1.08e-08 61 25 12 238 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q9SSY6 1.15e-08 61 24 8 231 2 ETR1 Ethylene receptor 1 Cucumis sativus
P10047 1.19e-08 60 28 7 221 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q8E3C7 1.25e-08 60 23 7 217 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q8DXQ8 1.26e-08 60 23 7 217 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P40330 1.29e-08 61 27 9 241 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4I6 1.3e-08 60 25 10 237 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.3e-08 60 25 10 237 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q02482 1.31e-08 60 24 2 133 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
P0AEC5 1.53e-08 60 30 11 213 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.53e-08 60 30 11 213 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.53e-08 60 30 11 213 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P59342 1.61e-08 60 30 11 213 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q06904 1.64e-08 60 23 6 265 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45675 1.89e-08 60 23 6 219 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
Q7MD16 1.89e-08 60 25 10 232 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P26762 2.13e-08 60 26 9 241 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9XH58 2.14e-08 60 22 17 480 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q82EB2 2.26e-08 59 25 12 293 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9SXL4 2.35e-08 60 23 6 205 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q8D5Z6 2.47e-08 60 25 10 232 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
P54302 2.59e-08 60 22 7 232 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
A7HD43 2.88e-08 59 27 9 250 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q55932 2.94e-08 59 26 6 203 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P33113 2.94e-08 59 24 9 228 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
O14002 3.46e-08 60 24 9 219 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54YH4 3.67e-08 59 26 8 222 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q9KLK7 3.69e-08 59 26 10 228 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
T2KMF4 3.89e-08 59 24 7 237 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q41342 3.95e-08 59 23 18 443 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
O82436 4.02e-08 59 24 9 225 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9ZWL6 4.31e-08 59 25 8 223 2 ETR1 Ethylene receptor Passiflora edulis
P0AEC4 5.14e-08 58 25 7 234 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 5.14e-08 58 25 7 234 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 5.33e-08 58 25 7 234 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q52969 6.01e-08 58 27 8 230 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q551X9 6.25e-08 58 26 6 219 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P39764 6.91e-08 58 24 6 216 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
O31661 7.27e-08 58 24 9 209 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P16575 7.63e-08 58 26 9 241 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P20169 8.85e-08 58 21 7 249 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q04850 1.13e-07 57 26 9 221 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9KHI5 1.31e-07 57 30 9 214 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7BWI3 1.32e-07 57 27 10 222 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3S4A7 1.63e-07 57 23 10 312 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q47745 1.66e-07 57 24 10 282 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q8X614 1.87e-07 57 23 6 220 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
O24972 1.89e-07 56 20 5 237 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
Q8YR50 1.92e-07 56 25 11 267 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8G5E7 2.07e-07 56 27 7 199 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q8KIY1 2.32e-07 57 27 11 247 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P9WGK5 2.8e-07 56 26 7 214 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.8e-07 56 26 7 214 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.8e-07 56 26 7 214 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q55168 3.08e-07 56 22 6 218 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06240 3.09e-07 55 24 12 250 1 vanS Sensor protein VanS Enterococcus faecium
Q54U87 3.37e-07 56 25 11 243 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
P14377 3.97e-07 55 22 6 220 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q0IBF4 4.02e-07 55 28 9 232 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P9WGK8 4.04e-07 55 25 7 244 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 4.04e-07 55 25 7 244 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9XH57 4.16e-07 56 24 8 223 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q3AYV8 4.28e-07 55 28 9 220 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P9WGK9 4.29e-07 55 25 7 227 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B2J946 4.74e-07 55 23 7 224 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1XD95 4.99e-07 55 22 8 231 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
O48929 5.2e-07 55 24 7 233 2 ETR1 Ethylene receptor Nicotiana tabacum
A3PDI2 5.75e-07 55 27 7 199 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P49333 5.98e-07 55 25 9 219 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q6GGK7 6.08e-07 55 25 9 230 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q8DKG0 6.16e-07 55 29 9 215 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A2BRQ6 6.69e-07 54 27 7 199 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A0QTK3 6.85e-07 55 25 9 244 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q3M8A7 7.12e-07 54 24 9 246 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8ZLZ9 7.34e-07 55 24 9 237 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LCC2 7.6e-07 55 23 6 221 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z3P2 7.67e-07 55 24 9 237 3 qseC Sensor protein QseC Salmonella typhi
Q5HHW5 7.92e-07 54 25 14 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 7.92e-07 54 25 14 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 7.92e-07 54 25 14 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q03228 7.93e-07 55 25 8 247 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7A5H7 8.18e-07 55 23 8 247 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 8.18e-07 55 23 8 247 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P7 9.81e-07 54 25 14 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q7V113 1.02e-06 54 25 8 216 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8NWF3 1.07e-06 54 23 8 247 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.07e-06 54 23 8 247 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.07e-06 54 23 8 247 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.07e-06 54 23 8 247 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
P10955 1.09e-06 54 25 9 261 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q9L523 1.14e-06 54 23 8 247 1 srrB Sensor protein SrrB Staphylococcus aureus
Q08408 1.15e-06 54 21 7 238 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q9HUI3 1.22e-06 54 27 7 225 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6GIT7 1.31e-06 53 25 14 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 1.36e-06 53 25 14 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.36e-06 53 25 14 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.36e-06 53 25 14 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.36e-06 53 25 14 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.36e-06 53 25 14 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q93CB7 1.4e-06 54 24 8 281 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
O49187 1.4e-06 54 44 2 61 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
O49230 1.5e-06 54 25 9 220 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9CCJ1 1.53e-06 54 25 7 227 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P76339 1.57e-06 53 23 11 276 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P07167 1.65e-06 54 25 11 262 3 virA Limited host range VirA protein Rhizobium radiobacter
Q8ZPP6 2.01e-06 53 29 2 112 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0DKM0 2.04e-06 53 24 10 266 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
B8AY75 2.09e-06 53 24 10 266 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
B7KFU0 2.24e-06 53 23 5 230 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P54883 2.51e-06 53 26 7 216 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q31AE8 2.62e-06 53 26 7 200 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q53RH0 2.63e-06 53 21 15 449 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 2.63e-06 53 21 15 449 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q9I0I2 2.8e-06 53 34 3 100 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10578 2.81e-06 52 43 2 65 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q8DN03 2.86e-06 53 22 8 241 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 2.86e-06 53 22 8 241 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9APE0 3.06e-06 53 26 9 204 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q7U871 3.37e-06 52 27 13 282 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q38846 3.45e-06 53 22 16 408 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q02541 3.68e-06 52 22 7 240 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
P28788 4.08e-06 52 24 6 206 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
Q86CZ2 4.49e-06 53 25 10 225 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9ZEP3 5.5e-06 52 26 10 225 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9R6X3 6.69e-06 52 23 8 239 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P09431 9.2e-06 51 27 10 227 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q55630 1.07e-05 51 22 6 240 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0QR01 1.17e-05 50 26 8 211 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B7K3M6 1.37e-05 50 21 4 231 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
B0JK50 1.43e-05 50 22 9 235 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B0CI82 1.56e-05 51 24 10 234 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8FZ86 1.65e-05 51 24 10 234 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q52977 2.33e-05 50 23 9 228 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
Q8CTI3 2.81e-05 49 23 10 248 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.81e-05 49 23 10 248 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O35044 3.2e-05 49 21 9 267 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
A9M715 3.95e-05 50 24 10 233 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P39664 4e-05 49 29 10 234 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P06218 5.87e-05 48 24 5 203 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q9P7Q7 6.48e-05 49 24 12 219 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8GP19 6.59e-05 48 22 10 288 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P23222 7.05e-05 48 24 8 228 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P37461 8.23e-05 48 22 6 199 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 8.82e-05 48 22 7 222 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q54YZ9 9.54e-05 48 25 10 222 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P0AFB7 9.56e-05 48 47 1 55 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 9.56e-05 48 47 1 55 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 9.56e-05 48 47 1 55 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
P07168 0.000108 48 29 4 124 3 virA Wide host range VirA protein Rhizobium radiobacter
P10799 0.000123 48 29 4 124 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
Q57BR6 0.000129 48 23 10 234 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 0.000129 48 23 10 234 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 0.000129 48 23 10 234 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q54RP6 0.000131 48 25 12 235 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P0A2D9 0.00014 47 24 5 203 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 0.00014 47 24 5 203 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
A5VRX4 0.00014 48 23 10 234 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YIM6 0.000142 48 23 10 234 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
O25026 0.000174 47 30 2 84 1 flgS Sensor histidine kinase FlgS Helicobacter pylori (strain ATCC 700392 / 26695)
Q5A872 0.000184 47 37 1 72 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P15939 0.00022 47 25 6 183 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9K620 0.000232 46 21 12 284 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2FWH7 0.000251 47 23 7 240 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P39928 0.000258 47 41 1 56 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P41503 0.000296 46 36 2 65 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
E5KK10 0.000328 47 27 10 218 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P18540 0.000422 46 28 3 128 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KM24 0.000478 46 24 7 201 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2T0V9 0.000479 46 21 7 208 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P58402 0.000535 46 23 10 230 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q3J6C1 0.000561 45 24 8 228 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P30855 0.000563 46 23 10 230 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q8DMC5 0.000596 45 27 8 218 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P44578 0.000617 45 22 9 231 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37739 0.001 45 25 4 158 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14460
Feature type CDS
Gene envZ
Product two-component system sensor histidine kinase EnvZ
Location 120601 - 121935 (strand: 1)
Length 1335 (nucleotides) / 444 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000004
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1674
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07638 two-component system, OmpR family, osmolarity sensor histidine kinase EnvZ [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MKRLRFSPRSTFSRSLFLVIFLLFATLTTSYLAVVNFIVMPSLQQFNRVLAYEVRTLMSEKMVLKDGTVVRVSPALRKKIYEELGITFFTEQEADDAGLRWARHFESLSGQMSHYLGGYADVRLEINRDYPVLWLNSYISPDVWVRVPLTEIGQDQFSPVFRYIFAFLLFVFAGVWVFIRYQNRPLTELESAARQMGTGGPQTTVREAGAAEVRSVIRSFNQMSRDIKMLDQDRTVLMAGVSHDLRTPLTRIRLATEMMGPADEYLAESINHDIEECDAIIEQFMAYLRTGQEMEMAQLELTGILNEVIGAQSSAEYEIHNDVTQKPVYVTGNAIAVKRALGNMLVNASRYGNGWIRVTSGKDDHFAWFQVEDDGSGIDEADIPNLFQPFVQGEKARSNKGTGLGLAILRRIVDAHDGKIEVGRSQRGGFRIRVLLALPDDRDD

Flanking regions ( +/- flanking 50bp)

ACGGTATGGGGATTGGGTTACGTCTTTGTACCGGACGGCAACAGTAAGCCATGAAGCGGCTCCGGTTCTCCCCCAGGAGCACCTTTTCGCGCTCACTGTTTTTAGTCATTTTTCTGTTGTTTGCAACATTGACAACAAGTTATCTGGCGGTTGTGAACTTCATTGTAATGCCGAGCCTGCAACAGTTTAACCGGGTTCTGGCGTATGAAGTCCGCACACTGATGAGCGAAAAAATGGTGCTGAAGGACGGAACCGTTGTCCGTGTTTCCCCGGCATTGCGTAAGAAAATTTATGAAGAGCTGGGGATCACCTTTTTTACTGAACAAGAAGCCGATGATGCCGGGTTGCGCTGGGCGCGTCATTTTGAGTCGCTCAGCGGGCAGATGAGCCATTATCTGGGAGGGTATGCGGATGTCAGGCTGGAAATTAACCGGGATTACCCGGTACTGTGGCTGAATTCGTATATTTCACCGGATGTGTGGGTGCGGGTTCCGCTGACTGAAATTGGTCAGGATCAGTTCTCGCCGGTTTTCCGTTATATTTTTGCTTTTCTGCTGTTTGTGTTTGCCGGCGTCTGGGTATTTATCCGTTATCAGAACCGCCCGCTCACTGAACTGGAATCGGCAGCCCGGCAAATGGGCACCGGCGGGCCACAGACAACGGTACGCGAAGCAGGTGCCGCAGAGGTGCGCTCAGTGATCCGCTCGTTTAATCAGATGTCGCGGGACATTAAAATGCTGGATCAGGATCGCACCGTTCTGATGGCCGGTGTGAGTCATGATTTGCGTACTCCGCTGACCCGTATCCGCCTGGCAACAGAAATGATGGGTCCGGCGGATGAGTATCTGGCGGAGTCCATTAATCATGACATTGAAGAGTGTGATGCTATCATCGAACAGTTTATGGCCTATCTGCGGACCGGTCAGGAAATGGAGATGGCACAGCTTGAGCTGACCGGCATTCTCAATGAAGTCATCGGTGCGCAAAGCAGTGCTGAGTATGAAATTCACAATGATGTTACGCAAAAGCCGGTGTATGTCACCGGAAATGCTATCGCGGTCAAGCGTGCGCTGGGCAACATGCTGGTGAATGCCTCGCGCTATGGTAACGGGTGGATCCGTGTTACCAGCGGCAAAGATGACCATTTCGCCTGGTTCCAGGTGGAAGATGACGGCAGTGGCATTGATGAAGCGGATATTCCGAATCTGTTCCAGCCGTTTGTTCAGGGTGAAAAAGCGCGCAGTAACAAGGGAACCGGTCTGGGGCTGGCAATTTTGCGGCGTATCGTTGATGCGCATGACGGTAAAATTGAGGTCGGGCGCAGTCAGCGTGGCGGGTTCCGTATCCGGGTTCTGCTGGCACTGCCGGATGACAGAGACGACTGAGATAACTGAGAAATATGACAATGGAATGTCATTTTCATTTTACTGTCACA