Homologs in group_1673

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10740 FBDBKF_10740 92.5 Morganella morganii S1 ompR two-component system response regulator OmpR
EHELCC_15075 EHELCC_15075 92.5 Morganella morganii S2 ompR two-component system response regulator OmpR
NLDBIP_14905 NLDBIP_14905 92.5 Morganella morganii S4 ompR two-component system response regulator OmpR
LHKJJB_14440 LHKJJB_14440 92.5 Morganella morganii S3 ompR two-component system response regulator OmpR
HKOGLL_13060 HKOGLL_13060 92.5 Morganella morganii S5 ompR two-component system response regulator OmpR
F4V73_RS14455 F4V73_RS14455 91.7 Morganella psychrotolerans ompR two-component system response regulator OmpR

Distribution of the homologs in the orthogroup group_1673

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1673

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A4P7TS68 1.03e-158 442 87 0 239 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.03e-158 442 87 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.03e-158 442 87 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.03e-158 442 87 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.03e-158 442 87 0 239 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.03e-158 442 87 0 239 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.03e-158 442 87 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.03e-158 442 87 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
G3XCY6 6.06e-62 197 43 4 231 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P31079 1.33e-60 193 46 4 234 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P51358 2.03e-56 183 42 2 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 2.31e-56 182 42 2 229 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P48259 1.4e-55 181 40 2 232 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q9HUI2 7.8e-55 179 40 3 234 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P13359 3.27e-53 174 42 5 232 3 virG Regulatory protein VirG Rhizobium rhizogenes
O78428 9.55e-53 174 38 2 234 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P28835 1.74e-52 172 39 4 234 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q9TLQ4 5.99e-52 171 39 3 233 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P28257 1.48e-51 171 40 2 229 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P39663 2.42e-51 170 39 3 236 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q06239 2.89e-51 169 37 3 228 3 vanR Regulatory protein VanR Enterococcus faecium
P07545 4.22e-51 169 42 4 231 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
P37478 5.77e-51 169 37 1 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P13792 1.42e-50 167 38 1 228 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P94413 6.26e-50 166 37 5 233 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q8CQK0 1.08e-48 162 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.08e-48 162 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A216 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 3.11e-48 161 37 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 3.11e-48 161 37 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 3.11e-48 161 37 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 3.11e-48 161 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P62722 3.54e-48 162 42 4 231 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
Q4LAJ9 6.29e-48 160 36 1 225 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q4A160 2.06e-47 159 36 1 225 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q44444 8.13e-47 159 42 4 231 3 virG Regulatory protein VirG Rhizobium radiobacter
Q7A0U4 1.56e-46 157 36 3 231 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.56e-46 157 36 3 231 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.56e-46 157 36 3 231 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.56e-46 157 36 3 231 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.56e-46 157 36 3 231 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.56e-46 157 36 3 231 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.56e-46 157 36 3 231 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.56e-46 157 36 3 231 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P35163 5.12e-46 156 36 3 229 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P42244 1.6e-45 154 33 2 223 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P44918 3.12e-45 154 35 2 231 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P32040 4.54e-45 154 36 3 234 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A1TEL7 8.33e-45 152 36 2 227 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0PWB4 2.58e-44 151 36 2 229 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P0A9Q4 4.64e-44 151 36 4 233 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 4.64e-44 151 36 4 233 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 4.64e-44 151 36 4 233 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 4.64e-44 151 36 4 233 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P69228 8.96e-44 150 36 3 240 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 8.96e-44 150 36 3 240 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1B3X8 1.25e-43 149 37 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.25e-43 149 37 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.25e-43 149 37 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q742C1 2.17e-43 149 36 2 227 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.17e-43 149 36 2 227 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A0R3I8 2.34e-43 149 35 2 229 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1KHB7 2.64e-43 149 36 2 229 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 2.64e-43 149 36 2 229 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q04942 3e-43 148 40 3 228 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CD68 4.32e-43 148 36 2 227 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P9WGL9 7.21e-43 147 35 2 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 7.21e-43 147 35 2 224 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 7.21e-43 147 35 2 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGM9 9.72e-43 147 35 2 229 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 9.72e-43 147 35 2 229 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 9.72e-43 147 35 2 229 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9F868 1.31e-42 147 37 2 224 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45607 2.44e-42 146 36 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q8DPL7 5.95e-42 145 35 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 5.95e-42 145 35 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 5.95e-42 145 35 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P45605 7.01e-42 145 36 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P0AFJ5 1.54e-41 144 35 3 229 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 1.54e-41 144 35 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P45606 1.59e-41 144 35 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
O32192 1.69e-41 144 33 5 228 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P23620 2.91e-41 144 36 3 228 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44895 4.18e-41 143 36 4 229 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H3GGB5 5.17e-41 143 39 6 235 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE90 8.13e-41 142 39 7 236 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 8.13e-41 142 39 7 236 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 8.13e-41 142 39 7 236 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P94504 6.8e-40 140 33 4 232 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P0ACZ8 1.55e-39 139 38 3 232 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 1.55e-39 139 38 3 232 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 1.55e-39 139 38 3 232 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P54443 3.75e-39 138 32 4 230 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
A0QTK2 1.13e-38 137 37 3 225 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9CCJ2 1.39e-38 136 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
O34903 1.41e-38 136 33 3 227 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q31S42 1.44e-38 137 35 3 229 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q52990 2.28e-38 136 36 3 227 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q93CB8 1.14e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 1.15e-37 134 37 3 225 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 1.15e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 1.15e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q44929 2.29e-37 134 34 4 233 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
Q7D9K0 3.2e-37 134 35 3 231 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 3.2e-37 134 35 3 231 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P54884 5.05e-37 132 37 2 185 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
Q02540 9.25e-37 132 34 4 228 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
P45189 1.7e-36 131 34 5 230 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZEP4 2.03e-36 131 33 3 236 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82EB1 2.96e-36 130 34 4 237 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q7A1J1 3.63e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 3.63e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 3.63e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 3.63e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 3.63e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 3.63e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 3.63e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 3.63e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 3.63e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 3.63e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q8CQ17 1.11e-35 129 32 3 228 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 1.11e-35 129 32 3 228 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0C001 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 1.22e-35 129 35 6 228 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 1.22e-35 129 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P38684 1.28e-35 129 31 3 232 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
Q55890 1.53e-35 129 34 3 229 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q99U73 1.94e-35 128 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q44006 2.19e-35 128 33 3 230 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q50136 2.37e-35 128 35 2 213 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P9WGM1 3.55e-35 128 35 2 213 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 3.55e-35 128 35 2 213 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 3.55e-35 128 35 2 213 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P52108 4.14e-35 128 33 3 236 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
L7N689 5.47e-35 128 34 4 230 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P58357 1.35e-34 126 31 3 232 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q4L6C6 1.97e-34 125 35 7 231 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q9AE24 2.6e-34 125 31 2 233 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q83RR0 3.21e-34 125 33 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 3.21e-34 125 33 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23836 3.28e-34 125 33 4 228 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q9ZHD3 3.43e-34 125 35 5 234 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q8Z7H2 1.35e-33 124 33 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P0DMK7 1.37e-33 124 33 3 227 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 1.37e-33 124 33 3 227 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P42421 2.16e-33 123 32 3 225 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q47456 2.62e-33 123 33 2 227 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
Q49ZT8 2.68e-33 123 32 3 224 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0DM78 3.66e-33 122 33 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 3.66e-33 122 33 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 3.66e-33 122 33 3 227 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 3.66e-33 122 33 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 3.66e-33 122 33 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8X738 4.14e-33 122 33 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
O24973 5.34e-33 122 34 2 225 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
Q4L8L9 7.02e-33 122 34 5 226 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q2YZ24 1.06e-32 121 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q57QC3 1.96e-32 120 32 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q7A039 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 2.06e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WGN1 2.47e-32 120 29 2 226 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 2.47e-32 120 29 2 226 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6GE73 3.41e-32 120 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
P08368 4.03e-32 120 32 1 224 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
P36556 4.86e-32 119 34 4 230 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P30843 5.46e-32 119 34 4 231 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
A6QJK3 5.62e-32 119 31 3 225 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 5.62e-32 119 31 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q8CN92 6.32e-32 119 33 5 225 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLN2 6.39e-32 119 33 5 225 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P21866 7.94e-32 119 33 4 231 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
O06978 1.23e-31 119 30 2 228 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q9I4F9 1.24e-31 119 33 2 227 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0CL17 2.25e-31 118 33 4 234 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 2.25e-31 118 33 4 234 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q49XM7 3.22e-31 117 34 4 226 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P76340 6.79e-31 116 32 4 229 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q01473 5.6e-30 120 31 1 225 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 8.23e-09 58 30 1 119 3 rcaC Protein RcaC Microchaete diplosiphon
Q70FH0 1.08e-29 113 32 2 228 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
Q07783 2.54e-29 113 30 5 237 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q55933 3.74e-29 112 30 4 238 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P50350 1.74e-28 110 32 5 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P50351 2.45e-28 110 30 5 239 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5HPC3 4.13e-28 109 35 7 228 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0A4I0 4.14e-28 109 30 4 228 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 4.14e-28 109 30 4 228 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q04803 6.19e-28 111 33 2 230 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8CP82 6.94e-28 108 35 7 228 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q07597 1.15e-27 108 31 4 233 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
Q2FWH6 1.58e-27 108 31 4 223 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8FZ93 3.18e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 3.18e-27 107 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 3.18e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 3.18e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 3.18e-27 107 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 3.18e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 3.18e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 3.18e-27 107 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
A6WZ81 5.69e-27 106 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9HV32 8.68e-27 105 31 3 226 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9K621 1.47e-26 105 26 3 234 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O69730 2.84e-26 105 30 3 229 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q47744 6.89e-26 103 28 4 227 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
P33112 2.09e-25 102 31 6 230 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
A8Z181 3.34e-25 102 29 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 3.34e-25 102 29 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 3.34e-25 102 29 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 3.34e-25 102 29 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 3.34e-25 102 29 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
P0A4I2 4.12e-25 101 31 2 225 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 4.12e-25 101 31 2 225 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q932F1 5.37e-25 101 29 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P45337 7.18e-25 100 28 2 227 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9I0I1 7.92e-25 100 31 3 228 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8H358 1.47e-24 100 28 1 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 1.47e-24 100 28 1 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q6GJ11 1.64e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
Q7A1L2 1.71e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 1.71e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 1.71e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 1.71e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 1.71e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 1.71e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YSS2 1.86e-24 100 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q49VK3 3.81e-24 99 27 6 228 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQ37 5.74e-24 98 25 3 226 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 5.74e-24 98 25 3 226 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P52076 9.16e-24 98 27 2 227 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P48359 1.89e-23 97 36 3 150 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q8DN02 2.78e-23 96 28 5 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 2.78e-23 96 28 5 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8XBS3 1.56e-22 94 27 2 227 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P66795 2.3e-22 94 27 2 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 2.3e-22 94 27 2 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q4L481 5.43e-22 93 26 5 230 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
O31432 1.5e-21 92 28 9 234 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
P0A4H8 2.09e-21 92 28 5 228 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.09e-21 92 28 5 228 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O34951 9.74e-21 90 25 4 227 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q9KM23 1.15e-20 90 30 6 225 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1XDE4 4.63e-20 88 35 2 135 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
Q8GP20 1.96e-18 84 30 5 230 1 rssB Swarming motility regulation protein RssB Serratia marcescens
B8GZM2 6.87e-17 82 36 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
B8GZM2 2.39e-05 48 28 3 121 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 6.87e-17 82 36 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A5I5 2.39e-05 48 28 3 121 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P72781 1.08e-16 79 33 3 136 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51343 5.81e-15 74 34 1 123 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P06628 7.69e-15 72 35 2 121 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P55701 1.04e-14 73 26 4 228 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P43501 1.35e-14 71 33 3 121 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92HC2 4.55e-14 74 35 1 109 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UL27 6.34e-14 73 33 1 113 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q2KCH7 8e-14 69 33 2 121 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P52931 8.69e-14 71 38 2 117 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
P40138 1.67e-13 72 33 2 127 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q68WH4 1.71e-13 72 31 1 113 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 2.13e-13 72 31 1 113 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q1RJS1 2.2e-13 72 32 1 113 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q4UU85 2.95e-13 71 36 3 126 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
A1W0A5 3.99e-13 67 29 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 3.99e-13 67 29 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 3.99e-13 67 29 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P51586 5.39e-13 67 36 1 109 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P46384 5.61e-13 67 32 3 121 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52942 5.95e-13 67 33 2 120 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
O05251 7.25e-13 68 41 4 104 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q9ZM64 9.53e-13 66 28 2 119 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P52941 9.63e-13 68 34 5 135 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P23221 1.6e-12 67 27 1 133 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HU19 1.92e-12 69 31 0 115 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P71403 2.41e-12 65 28 2 119 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P03029 3.88e-12 68 31 1 121 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
T2KMF4 4.06e-12 68 29 2 124 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q04848 5.41e-12 68 26 2 132 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P41789 5.44e-12 68 30 1 123 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q05943 6.16e-12 67 28 3 169 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9HV27 6.95e-12 67 38 2 100 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28787 9.6e-12 67 31 1 124 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q1IRH0 9.89e-12 67 31 4 153 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
P52929 1e-11 65 36 3 119 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
P0AFB8 1.19e-11 67 30 1 123 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.19e-11 67 30 1 123 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
Q9I4N3 2.82e-11 66 34 3 128 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10577 3.2e-11 65 28 0 110 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45671 3.28e-11 65 28 1 131 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P0A4I4 4.46e-11 64 34 6 158 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 4.46e-11 64 34 6 158 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P52934 4.51e-11 64 36 2 119 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
P10576 5.43e-11 65 27 0 107 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q9WY30 5.87e-11 65 32 1 117 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O25918 6.21e-11 63 23 8 236 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
P24072 8.22e-11 60 28 1 119 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P13632 8.41e-11 64 28 0 117 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q00934 1.16e-10 64 33 0 126 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P31908 1.35e-10 63 32 4 117 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q06065 1.37e-10 63 30 0 119 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q3LWR6 3.65e-10 61 28 1 132 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 3.65e-10 61 28 1 132 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 3.65e-10 61 28 1 132 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P72253 4.69e-10 62 36 4 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P52932 4.96e-10 60 34 3 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
P23747 5.05e-10 62 28 2 138 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52928 6.6e-10 61 35 3 119 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q8L9Y3 8.11e-10 61 28 1 121 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
Q88AQ2 9e-10 61 28 0 111 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q04849 1.05e-09 61 30 3 131 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P96602 1.6e-09 59 30 3 120 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q2WAJ8 2.18e-09 60 33 4 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P96126 2.35e-09 57 26 2 121 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
Q5A599 2.49e-09 60 28 2 128 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q88RJ6 3e-09 60 29 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9KA55 4.32e-09 59 30 7 149 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P0A2D5 4.38e-09 56 28 3 121 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 4.38e-09 56 28 3 121 3 cheY Chemotaxis protein CheY Salmonella typhi
P06534 4.42e-09 58 34 3 119 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
P15940 4.52e-09 58 31 0 116 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P09432 5.15e-09 59 29 2 124 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q54SP4 6.3e-09 59 34 3 113 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 0.000127 46 37 1 78 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P29267 7.73e-09 58 31 2 119 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8FGP6 8.7e-09 55 28 3 121 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P26487 1.03e-08 57 28 4 158 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9FXD6 1.12e-08 58 28 2 124 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P0AE69 1.23e-08 55 28 3 121 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 1.23e-08 55 28 3 121 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 1.23e-08 55 28 3 121 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q54YZ9 1.3e-08 58 33 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q8KR08 1.4e-08 57 26 1 132 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P52940 1.55e-08 57 31 5 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
B0R4K1 1.77e-08 54 31 2 116 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O14002 1.87e-08 58 29 4 126 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q93P00 2.82e-08 54 26 4 123 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q9FAD7 3.22e-08 54 28 3 121 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q9AAK0 3.6e-08 56 35 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q51455 3.89e-08 53 29 3 121 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KIY1 4.37e-08 57 31 2 116 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P52936 5.39e-08 55 31 4 129 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8D0P1 6.05e-08 53 27 3 123 3 cheY Chemotaxis protein CheY Yersinia pestis
Q10WZ6 6.49e-08 55 31 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P62646 6.83e-08 55 33 4 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q86AT9 9.41e-08 55 32 3 116 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P94514 1e-07 54 31 3 119 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
P58662 1.06e-07 55 30 0 105 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 1.12e-07 55 30 0 105 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q9KQD5 1.15e-07 52 26 3 126 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.15e-07 52 26 3 126 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8VL08 1.17e-07 55 37 5 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Azospirillum brasilense
P0DMC5 1.26e-07 55 31 0 105 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q20XK3 1.54e-07 54 32 4 119 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Rhodopseudomonas palustris (strain BisB18)
P14375 1.61e-07 54 25 0 119 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q86CZ2 2.17e-07 54 29 3 134 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q5A4X5 2.32e-07 54 28 2 112 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0AFU5 2.43e-07 54 29 0 118 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 2.43e-07 54 29 0 118 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P39486 2.53e-07 53 30 4 109 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q56312 2.68e-07 51 24 2 122 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7NSI8 2.71e-07 53 32 8 166 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P0DMC6 2.76e-07 54 31 0 105 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P58253 2.78e-07 53 32 4 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2SFK0 3.16e-07 53 36 3 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q8X613 3.51e-07 53 25 0 119 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q8Z333 3.74e-07 53 26 1 129 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P25852 4.5e-07 53 25 1 136 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KSB1 5.12e-07 53 28 3 121 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P42508 5.33e-07 52 27 0 106 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P42012 6.25e-07 52 28 5 143 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q39KQ1 7.49e-07 52 30 7 165 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P0A4H5 7.58e-07 50 25 1 109 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 7.58e-07 50 25 1 109 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
E0X9C7 8.13e-07 53 29 2 116 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P45709 8.45e-07 50 29 3 118 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
P38889 1.02e-06 52 27 0 107 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1QI44 1.11e-06 52 28 3 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
P52938 1.42e-06 51 27 5 134 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q9K998 1.53e-06 51 32 4 118 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9F8D7 1.74e-06 52 27 1 112 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q6BGW4 1.77e-06 51 28 3 125 3 SRR1 Stress response regulator protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q2T8Y6 1.82e-06 51 35 5 110 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q4L8V4 1.92e-06 51 30 4 132 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
O82868 1.92e-06 50 28 0 108 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
P39048 2e-06 51 31 3 116 2 patA Protein PatA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6H805 2.04e-06 51 27 2 133 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 2.1e-06 51 27 2 133 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q5L0L0 2.32e-06 51 29 4 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
Q8H7S7 2.37e-06 51 30 3 126 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 2.37e-06 51 30 3 126 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
Q3J653 2.52e-06 51 33 5 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9APD9 2.53e-06 51 26 0 102 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P30855 2.74e-06 51 31 0 101 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q3JY65 2.82e-06 50 32 4 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain 1710b)
Q62G12 2.82e-06 50 32 4 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia mallei (strain ATCC 23344)
Q2STS8 2.95e-06 50 32 4 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P58402 2.98e-06 51 31 0 101 3 evgS Sensor protein EvgS Escherichia coli O157:H7
A5W4E3 3.02e-06 51 28 2 116 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q53228 3.03e-06 49 28 0 106 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9RC52 3.04e-06 50 31 6 140 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q07084 3.05e-06 51 25 2 138 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5N6V8 3.11e-06 51 27 3 124 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q05522 3.22e-06 50 36 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
Q9KM66 3.35e-06 51 25 1 116 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O25153 3.41e-06 51 26 3 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
A1SMR4 3.43e-06 50 30 2 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P10958 3.56e-06 49 30 0 103 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
A7N6S2 3.56e-06 50 28 3 115 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q8EQQ3 3.84e-06 50 29 3 120 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0C5S3 5.1e-06 49 29 2 109 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
P0A4H2 5.17e-06 49 30 3 117 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 5.17e-06 49 30 3 117 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 5.17e-06 49 30 3 117 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0AEV3 5.24e-06 50 26 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 5.24e-06 50 26 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 5.24e-06 50 26 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q2SPQ1 5.65e-06 50 33 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
Q0D3B6 7.3e-06 50 28 2 125 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
A2YQ93 7.3e-06 50 28 2 125 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
A6UEL7 7.34e-06 48 29 2 109 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q2RRX2 7.35e-06 49 36 4 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q1GZZ0 7.79e-06 49 32 5 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P66797 7.95e-06 48 26 2 119 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 7.95e-06 48 26 2 119 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P0AED6 8.02e-06 48 26 2 119 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 8.02e-06 48 26 2 119 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
O25408 8.51e-06 49 31 4 113 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q2INJ8 1.01e-05 49 33 5 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q89SQ1 1.04e-05 49 30 3 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8E217 1.08e-05 48 27 4 137 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 1.08e-05 48 27 4 137 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
Q63PS2 1.13e-05 49 31 4 111 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain K96243)
Q1QVY7 1.13e-05 49 32 4 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q81JL3 1.15e-05 48 32 4 106 3 lytT Sensory transduction protein LytT Bacillus anthracis
Q9P896 1.31e-05 49 30 2 110 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2YV67 1.33e-05 48 30 4 136 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2ILG8 1.35e-05 48 31 3 105 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
O14283 1.38e-05 49 27 0 102 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7Y0W3 1.63e-05 48 25 2 120 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
P10046 1.64e-05 48 27 0 111 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q7Y0W5 1.64e-05 48 25 2 120 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
P48027 1.86e-05 48 25 1 112 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
O33558 1.95e-05 48 32 5 107 1 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Cereibacter sphaeroides
Q39S45 2e-05 48 32 5 109 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1BRL2 2.06e-05 48 32 4 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia orbicola (strain AU 1054)
A2XYV5 2.12e-05 47 26 5 126 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
O29221 2.16e-05 48 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6K9T0 2.3e-05 46 23 2 109 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 2.3e-05 46 23 2 109 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q7XQA6 2.41e-05 47 26 5 126 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
Q9FPR6 2.51e-05 46 25 2 121 2 ARR17 Two-component response regulator ARR17 Arabidopsis thaliana
Q132U2 2.53e-05 48 31 3 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain BisB5)
Q13SY2 2.63e-05 48 31 3 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Paraburkholderia xenovorans (strain LB400)
Q9KL96 2.76e-05 47 27 5 142 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2RX18 2.83e-05 48 30 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8NYH3 2.86e-05 47 29 4 125 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MW2)
Q6GCL1 2.86e-05 47 29 4 125 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MSSA476)
Q20YL8 2.89e-05 48 27 5 146 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodopseudomonas palustris (strain BisB18)
P60610 2.97e-05 47 29 4 125 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain N315)
P60609 2.97e-05 47 29 4 125 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJB5 2.97e-05 47 29 4 125 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain COL)
P60611 2.97e-05 47 29 4 125 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK09 2.97e-05 47 29 4 125 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain USA300)
Q6GK51 3.03e-05 47 29 4 125 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MRSA252)
B8AEH1 3.07e-05 48 28 2 120 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q8PX96 3.07e-05 47 29 4 135 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6K8X6 3.13e-05 48 28 2 120 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q9LYP5 3.15e-05 48 26 3 124 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q1LH11 3.37e-05 47 33 3 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q814J1 3.45e-05 47 32 4 106 4 lytT Sensory transduction protein LytT Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P96686 3.65e-05 47 32 3 119 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q65JK6 3.67e-05 47 29 5 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q221I1 3.83e-05 47 33 5 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2IQS6 4.52e-05 47 31 9 145 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q54RP6 4.7e-05 47 27 3 115 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P62644 4.85e-05 47 29 5 148 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q46PH7 5.09e-05 47 31 7 148 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P32967 5.33e-05 46 30 2 120 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q3SVA1 5.33e-05 47 28 3 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q39WQ9 5.49e-05 47 33 5 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A8R3S7 5.52e-05 46 29 1 120 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
A7HD44 5.79e-05 46 32 2 110 1 Anae109_2439 Response regulator receiver protein Anae109_2439 Anaeromyxobacter sp. (strain Fw109-5)
Q0AXB7 6.29e-05 47 32 4 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14290
Feature type CDS
Gene ompR
Product two-component system response regulator OmpR
Location 3171999 - 3172721 (strand: 1)
Length 723 (nucleotides) / 240 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1673
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07659 two-component system, OmpR family, phosphate regulon response regulator OmpR Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MQDSYKVLIVDDDLRLRSLLERYLTEQGFQIRTAANSDQMDRLLTRESIHLIVLDLMLPGEDGLSICRRLRSQNNPIPIIMVTAKGEEVDRIVGLEIGADDYISKPFNPRELLARIRAVLRRQANELPGAPSQDNAIVSFGKFKLNLGTREMFHEDQHMPLTSGEFAVLKVLVSHPREPLSRDKLMSLARGREYSAMERSIDVQISRLRRMIEEDPTHPRYIQTVWGLGYVFVPDGTSVS

Flanking regions ( +/- flanking 50bp)

TCAATGATAGAATTCGCTAATAAAAGCATTTGCACTTCGGGAGCTTAAAGATGCAAGACAGTTATAAAGTGCTGATTGTGGATGATGATTTACGTCTACGTTCACTATTAGAGCGCTATTTGACAGAGCAGGGTTTTCAAATCCGCACCGCGGCAAACTCCGATCAAATGGATCGTTTACTTACTCGCGAATCTATCCATCTTATTGTCCTCGACTTAATGCTTCCTGGCGAAGATGGCTTATCTATTTGTCGTCGCTTGAGAAGCCAAAACAATCCTATCCCTATTATTATGGTGACTGCCAAAGGGGAAGAAGTTGACAGAATTGTCGGACTTGAAATTGGTGCTGATGATTATATCTCAAAACCATTTAACCCAAGAGAGCTATTAGCCCGTATTCGTGCGGTGCTTCGTCGCCAAGCCAACGAACTACCGGGAGCACCTTCACAAGACAATGCGATTGTCTCATTTGGTAAATTTAAGCTTAACCTCGGTACGCGGGAAATGTTCCACGAAGATCAACATATGCCTTTGACCAGTGGTGAATTTGCCGTATTAAAAGTCCTTGTTTCACATCCCCGAGAGCCATTATCACGTGATAAATTAATGAGTCTGGCGCGAGGTCGTGAATATAGTGCGATGGAGCGTTCTATTGATGTGCAAATTTCTCGTTTACGTCGCATGATTGAAGAAGATCCCACCCATCCTCGCTATATTCAAACGGTTTGGGGACTGGGTTATGTCTTTGTACCTGATGGAACGAGCGTATCATAATGAGAAGGCTGAGGCTTTCACCCCACAATAAGCTCACTCGCTCTCTATTT