Homologs in group_1631

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10740 FBDBKF_10740 100.0 Morganella morganii S1 ompR two-component system response regulator OmpR
NLDBIP_14905 NLDBIP_14905 100.0 Morganella morganii S4 ompR two-component system response regulator OmpR
LHKJJB_14440 LHKJJB_14440 100.0 Morganella morganii S3 ompR two-component system response regulator OmpR
HKOGLL_13060 HKOGLL_13060 100.0 Morganella morganii S5 ompR two-component system response regulator OmpR
F4V73_RS14455 F4V73_RS14455 98.3 Morganella psychrotolerans ompR two-component system response regulator OmpR
PMI_RS14290 PMI_RS14290 92.5 Proteus mirabilis HI4320 ompR two-component system response regulator OmpR

Distribution of the homologs in the orthogroup group_1631

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1631

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A4P7TS68 1.3e-163 454 92 0 239 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.3e-163 454 92 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.3e-163 454 92 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.3e-163 454 92 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.3e-163 454 92 0 239 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.3e-163 454 92 0 239 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.3e-163 454 92 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.3e-163 454 92 0 239 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
G3XCY6 2.59e-63 200 45 4 232 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P31079 5.54e-61 194 46 4 234 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P48259 2.84e-58 187 43 2 234 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
Q9HUI2 6.46e-57 184 42 3 240 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1XDC9 1.7e-56 183 43 2 229 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P51358 1.78e-56 183 43 2 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
P28835 3.3e-54 177 41 4 234 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
O78428 4.41e-54 177 40 2 234 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q9TLQ4 4.13e-53 174 38 3 236 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P13359 6.06e-53 174 42 5 234 3 virG Regulatory protein VirG Rhizobium rhizogenes
P28257 1.25e-52 173 41 2 229 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q06239 1.39e-52 172 39 3 228 3 vanR Regulatory protein VanR Enterococcus faecium
P13792 6.87e-52 171 40 1 228 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P37478 9.05e-52 171 39 1 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P94413 8.73e-51 168 38 5 233 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P39663 1.91e-50 168 39 2 236 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P07545 9.28e-50 166 42 4 231 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8CQK0 1.43e-49 165 39 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.43e-49 165 39 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4LAJ9 1.02e-48 162 38 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q7A216 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 2e-48 162 38 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 2e-48 162 38 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 2e-48 162 38 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 2e-48 162 38 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A160 1.4e-47 160 38 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1TEL7 1.06e-46 157 38 2 227 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q7A0U4 1.25e-46 157 35 3 236 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.25e-46 157 35 3 236 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.25e-46 157 35 3 236 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.25e-46 157 35 3 236 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.25e-46 157 35 3 236 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.25e-46 157 35 3 236 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.25e-46 157 35 3 236 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.25e-46 157 35 3 236 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P62722 1.5e-46 158 41 4 231 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
A0PWB4 7.32e-46 155 37 2 229 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P32040 9.42e-46 155 38 3 234 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P42244 1.15e-45 155 34 2 223 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
A1KHB7 1.81e-45 154 37 2 229 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.81e-45 154 37 2 229 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1B3X8 2.67e-45 154 39 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 2.67e-45 154 39 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 2.67e-45 154 39 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q44444 2.78e-45 155 41 4 231 3 virG Regulatory protein VirG Rhizobium radiobacter
P35163 3.17e-45 154 36 3 229 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q742C1 4.46e-45 153 38 3 230 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 4.46e-45 153 38 3 230 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A0R3I8 5.49e-45 153 37 2 229 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGM9 7.2e-45 153 37 2 229 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 7.2e-45 153 37 2 229 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 7.2e-45 153 37 2 229 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P44918 1.58e-44 152 35 2 231 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WGL9 2.6e-44 151 36 2 225 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 2.6e-44 151 36 2 225 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 2.6e-44 151 36 2 225 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CD68 3.08e-44 151 37 2 227 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P0A9Q4 1.09e-43 150 36 4 233 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 1.09e-43 150 36 4 233 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 1.09e-43 150 36 4 233 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 1.09e-43 150 36 4 233 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P44895 1.4e-43 149 37 4 229 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DPL7 1.92e-43 149 36 3 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 1.92e-43 149 36 3 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 1.92e-43 149 36 3 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04942 2.58e-43 149 40 3 229 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A0H3GGB5 3.86e-43 148 40 6 235 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q9F868 5.2e-43 148 37 2 225 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0AE90 6.68e-43 148 40 7 236 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 6.68e-43 148 40 7 236 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 6.68e-43 148 40 7 236 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P45607 1.03e-42 147 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P69228 3.97e-42 146 36 3 235 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 3.97e-42 146 36 3 235 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFJ5 4.71e-42 145 37 3 229 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 4.71e-42 145 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P45606 4.92e-42 145 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P45605 6.24e-42 145 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P23620 2e-41 144 36 3 228 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O32192 7.24e-41 142 32 4 228 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P0ACZ8 2.53e-40 141 38 3 232 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 2.53e-40 141 38 3 232 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 2.53e-40 141 38 3 232 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P94504 4.29e-40 140 33 3 234 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P54443 7.09e-39 137 33 4 230 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
A0QTK2 1.98e-38 136 37 3 225 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7D9K0 2.92e-38 136 35 3 233 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 2.92e-38 136 35 3 233 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q52990 3.47e-38 135 36 3 227 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q31S42 5.75e-38 135 35 3 229 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O34903 5.97e-38 135 32 3 231 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P54884 6.2e-38 134 38 2 185 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P9WGM7 1.6e-37 134 37 3 225 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 1.6e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 1.6e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q93CB8 1.87e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9CCJ2 1.87e-37 134 37 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q02540 3.46e-37 133 35 4 228 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q44929 4.6e-37 133 34 4 232 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P38684 5e-37 132 32 3 232 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P45189 7.88e-37 132 35 4 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q44006 2.36e-36 130 35 3 230 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8CQ17 2.92e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 2.92e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
L7N689 3.17e-36 131 34 3 230 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7A1J1 3.67e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 3.67e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 3.67e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 3.67e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 3.67e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 3.67e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 3.67e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 3.67e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 3.67e-36 130 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 3.67e-36 130 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q50136 5.02e-36 130 36 2 215 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P58357 5.06e-36 130 32 3 232 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q82EB1 5.7e-36 130 35 4 237 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P9WGM1 8.05e-36 129 36 2 215 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 8.05e-36 129 36 2 215 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 8.05e-36 129 36 2 215 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9AE24 1.14e-35 129 32 2 233 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P23836 1.83e-35 128 35 4 228 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 2.19e-35 128 35 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 2.19e-35 128 35 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z7H2 2.45e-35 128 35 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q9ZEP4 2.8e-35 128 34 3 236 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0DM78 6.71e-35 127 35 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 6.71e-35 127 35 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 6.71e-35 127 35 3 227 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 6.71e-35 127 35 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 6.71e-35 127 35 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P52108 6.86e-35 127 32 3 236 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q55890 7.07e-35 127 34 3 229 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0C001 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 7.86e-35 127 34 6 228 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 7.86e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q4L6C6 8.85e-35 126 35 7 231 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P42421 1.48e-34 126 32 3 225 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q99U73 1.91e-34 125 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q9ZHD3 1.95e-34 126 35 5 234 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q4L8L9 2.64e-34 125 35 5 226 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q8X738 2.78e-34 125 35 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q57QC3 3.42e-34 125 35 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q8CN92 4.37e-34 125 33 4 225 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O24973 4.58e-34 125 34 2 225 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
Q5HLN2 4.71e-34 125 33 4 225 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0DMK7 7e-34 124 33 3 227 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 7e-34 124 33 3 227 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P30843 2.48e-33 123 33 2 230 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q47456 3.05e-33 122 33 2 227 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P21866 4.28e-33 122 33 4 231 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q49ZT8 4.64e-33 122 32 3 224 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P08368 6.59e-33 122 33 1 224 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q9I4F9 7.07e-33 122 35 2 228 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2YZ24 9.19e-33 121 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0CL17 9.39e-33 121 34 4 234 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 9.39e-33 121 34 4 234 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P9WGN1 2.2e-32 120 30 2 226 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 2.2e-32 120 30 2 226 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P36556 2.62e-32 120 33 2 229 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A039 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 3.61e-32 120 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE73 5.41e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
A6QJK3 8.74e-32 119 32 3 225 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 8.74e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P76340 1.2e-31 118 32 4 229 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q70FH0 3.7e-31 117 32 2 228 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
Q49XM7 4.08e-31 117 34 6 227 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O06978 7.6e-31 117 29 2 228 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q07783 2.75e-30 115 31 4 237 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q04803 4.67e-30 116 34 2 230 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q01473 5.6e-30 120 32 2 226 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 4.99e-09 59 30 1 119 3 rcaC Protein RcaC Microchaete diplosiphon
P50351 1.18e-29 114 32 5 239 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P50350 1.93e-29 113 33 5 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P0A4I0 1.74e-28 110 31 4 228 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 1.74e-28 110 31 4 228 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q5HPC3 8.71e-28 108 34 7 228 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9K621 9.86e-28 108 27 3 233 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q07597 1.08e-27 108 30 2 226 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
Q8CP82 1.21e-27 108 34 7 228 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q55933 1.44e-27 108 29 4 238 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8FZ93 2.16e-27 107 30 1 227 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 2.16e-27 107 30 1 227 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 2.16e-27 107 30 1 227 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 2.16e-27 107 30 1 227 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 2.16e-27 107 30 1 227 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 2.16e-27 107 30 1 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 2.16e-27 107 30 1 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 2.16e-27 107 30 1 227 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
A6WZ81 3.13e-27 107 30 1 227 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P0A4I2 4.16e-27 106 33 2 225 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 4.16e-27 106 33 2 225 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O69730 2.1e-26 105 31 3 229 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q2FWH6 2.35e-26 105 31 4 223 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q932F1 3.33e-26 104 28 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9HV32 5.8e-26 103 30 3 226 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8H358 6.21e-26 103 29 1 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 6.21e-26 103 29 1 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A8Z181 9.68e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 9.68e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 9.68e-26 103 28 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 9.68e-26 103 28 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 9.68e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q47744 1.05e-25 103 28 4 227 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q2YSS2 1.16e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1L2 1.25e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 1.25e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 1.25e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 1.25e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 1.25e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 1.25e-25 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GJ11 1.56e-25 102 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
P52076 3.03e-25 102 29 2 227 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P33112 3.24e-25 102 32 6 227 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q9I0I1 9.94e-25 100 31 3 228 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45337 1.91e-24 99 28 2 227 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DN02 2.24e-24 99 28 5 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 2.24e-24 99 28 5 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8CQ37 3.52e-24 99 26 4 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 3.52e-24 99 26 4 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8XBS3 4.95e-24 98 29 2 227 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q49VK3 5.42e-24 99 28 7 231 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P66795 2.48e-23 97 29 2 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 2.48e-23 97 29 2 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q4L481 2.09e-22 94 26 4 229 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
Q9KM23 3.79e-22 94 31 8 229 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P48359 6.17e-22 93 34 2 150 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P0A4H8 8.53e-21 90 28 5 228 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 8.53e-21 90 28 5 228 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O31432 3.95e-20 88 26 8 235 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
O34951 4.29e-20 88 25 4 227 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q1XDE4 2.31e-19 86 35 2 136 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
Q8GP20 5.49e-19 85 31 5 230 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P72781 4.75e-17 80 35 3 136 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8GZM2 1.31e-16 81 37 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 1.31e-16 81 37 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P55701 8.24e-16 77 27 6 236 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P06628 6e-15 72 34 2 121 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P51343 1.52e-14 73 34 1 123 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P43501 1.87e-14 70 34 3 121 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04848 5.08e-14 74 28 3 167 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9ZM64 6.43e-14 69 31 2 119 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P52931 7.72e-14 71 36 2 117 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q2KCH7 8.37e-14 69 32 2 121 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P71403 1.43e-13 68 31 2 119 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P0AFB8 1.63e-13 72 31 1 123 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.63e-13 72 31 1 123 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P41789 1.79e-13 72 31 1 123 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23221 1.81e-13 70 30 1 133 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P10577 1.97e-13 72 32 0 110 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
A1W0A5 2.18e-13 68 30 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 2.18e-13 68 30 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 2.18e-13 68 30 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P52941 2.28e-13 70 34 4 135 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q92HC2 2.47e-13 72 33 1 109 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P51586 2.89e-13 67 39 1 109 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q4UL27 3.04e-13 72 31 1 113 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P28787 4.26e-13 71 33 1 124 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P10576 4.42e-13 71 31 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P45671 4.68e-13 71 31 1 131 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q9HU19 6.36e-13 70 33 0 115 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52942 7.58e-13 66 32 2 120 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q68WH4 7.88e-13 70 30 1 113 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P03029 9.63e-13 70 30 1 121 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q9ZCY9 1.09e-12 70 30 1 113 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q1RJS1 1.09e-12 70 30 1 113 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
O05251 1.12e-12 68 40 4 104 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q05943 1.26e-12 68 30 5 171 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4UU85 1.3e-12 69 35 3 126 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P46384 2.43e-12 65 32 3 121 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P40138 3.05e-12 68 33 2 127 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
T2KMF4 3.69e-12 68 28 2 124 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q9HV27 1.01e-11 67 40 3 122 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I4N3 1.31e-11 67 31 6 179 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I4 1.68e-11 65 31 5 154 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 1.68e-11 65 31 5 154 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9WY30 2.63e-11 65 33 1 117 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P13632 3.18e-11 65 29 0 117 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P52929 3.59e-11 63 29 3 154 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
P72253 4.57e-11 65 37 4 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P52934 5.96e-11 63 34 2 119 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
Q06065 6.92e-11 64 29 0 119 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P31908 9.06e-11 64 35 4 117 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O25918 9.47e-11 62 23 7 236 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
P26487 9.98e-11 62 29 1 151 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P24072 1.23e-10 60 28 1 118 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q00934 1.35e-10 63 32 0 126 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52932 1.52e-10 62 34 3 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
P23747 1.54e-10 63 30 2 138 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52928 1.93e-10 62 31 4 154 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q88AQ2 1.96e-10 63 31 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3LWR6 2.63e-10 62 28 0 125 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 2.63e-10 62 28 0 125 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 2.63e-10 62 28 0 125 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q54SP4 3.73e-10 63 38 3 113 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 0.001 43 30 3 129 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q8L9Y3 4.29e-10 62 29 1 121 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
P09432 4.83e-10 62 31 2 124 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q88RJ6 6.26e-10 62 31 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1IRH0 9.09e-10 61 30 4 143 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q2WAJ8 1.17e-09 61 34 4 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9FXD6 1.27e-09 61 30 2 124 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P06534 1.63e-09 60 32 3 134 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q04849 1.99e-09 60 29 3 131 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9KA55 2.16e-09 60 33 8 150 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P96602 2.23e-09 59 30 3 122 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P15940 2.3e-09 59 32 0 116 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P96126 4.19e-09 57 27 2 121 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
P0A2D5 4.6e-09 56 28 2 120 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 4.6e-09 56 28 2 120 3 cheY Chemotaxis protein CheY Salmonella typhi
Q8KR08 6.87e-09 57 27 1 130 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P29267 7.75e-09 58 32 2 119 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5A599 1.44e-08 58 28 2 128 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0AE69 1.5e-08 55 27 2 120 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 1.5e-08 55 27 2 120 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 1.5e-08 55 27 2 120 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q8FGP6 1.85e-08 54 27 2 120 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O14002 2.48e-08 57 29 4 126 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54YZ9 2.5e-08 57 33 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q8KIY1 2.73e-08 57 30 2 117 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q1QI44 2.99e-08 57 32 3 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q93P00 3e-08 54 26 2 123 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q8VL08 3.45e-08 56 35 4 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Azospirillum brasilense
Q9FAD7 3.55e-08 53 27 2 120 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q8D0P1 4.47e-08 53 26 2 123 3 cheY Chemotaxis protein CheY Yersinia pestis
Q2SFK0 5.18e-08 56 36 3 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q8Z333 6.65e-08 55 26 2 152 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
A2X1N2 6.75e-08 56 29 2 133 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q6H805 6.88e-08 56 29 2 133 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
P25852 7.44e-08 55 26 2 152 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5N6V8 7.58e-08 55 29 5 153 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
P52940 8.55e-08 55 31 5 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
A1SMR4 8.72e-08 55 34 2 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
B0R4K1 9.86e-08 52 29 0 115 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P39486 1.4e-07 53 31 4 109 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P52938 1.53e-07 54 29 5 134 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q9KQD5 1.53e-07 52 24 3 130 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.53e-07 52 24 3 130 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9APD9 1.58e-07 54 26 1 139 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P45709 1.82e-07 52 30 3 118 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
P62646 1.85e-07 54 32 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q51455 2.24e-07 51 26 2 120 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25153 2.27e-07 54 27 3 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q86AT9 2.31e-07 54 31 3 116 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P94514 2.41e-07 53 30 4 121 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
Q10WZ6 2.42e-07 54 30 2 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q9AAK0 2.65e-07 53 33 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P14375 2.74e-07 54 26 0 119 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q56128 2.84e-07 54 31 0 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 2.87e-07 54 31 0 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0DMC5 2.89e-07 54 32 0 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P38889 2.96e-07 54 28 0 107 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9KSB1 3.04e-07 53 28 3 121 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5A4X5 3.17e-07 53 27 0 110 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
P52936 3.63e-07 53 30 3 122 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8H7S7 3.7e-07 53 31 2 123 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 3.77e-07 53 31 2 123 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
E0X9C7 4.13e-07 53 30 2 113 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P0A4H5 4.84e-07 50 26 1 109 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 4.84e-07 50 26 1 109 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P0DMC6 6.16e-07 53 32 0 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q89SQ1 6.2e-07 52 31 5 125 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q20YL8 6.24e-07 53 30 5 146 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodopseudomonas palustris (strain BisB18)
Q8X613 7.11e-07 52 26 0 119 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q2T8Y6 8.05e-07 52 38 6 113 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P0AFU5 8.35e-07 52 29 0 118 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 8.35e-07 52 29 0 118 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q9F8D7 9.01e-07 52 28 1 112 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9LYP5 9.95e-07 52 25 2 122 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
Q4L8V4 1.01e-06 52 30 4 131 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
Q56312 1.03e-06 49 23 1 117 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A2XYV5 1.04e-06 50 29 5 126 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
A7N6S2 1.06e-06 52 30 3 115 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q7XQA6 1.08e-06 50 29 5 126 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
Q20XK3 1.14e-06 52 31 4 119 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Rhodopseudomonas palustris (strain BisB18)
Q9RC52 1.15e-06 51 31 6 138 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q132U2 1.15e-06 52 32 3 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain BisB5)
Q9KM66 1.26e-06 52 27 1 116 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q07084 1.43e-06 52 25 2 138 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P30855 1.46e-06 52 30 0 107 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
A5W4E3 1.5e-06 52 29 2 113 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3SVA1 1.5e-06 52 30 4 120 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P0C5S3 1.6e-06 50 31 2 109 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
P58402 1.82e-06 52 30 0 107 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P58253 1.88e-06 51 31 4 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5L0L0 1.96e-06 51 30 4 115 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
P10958 2.04e-06 50 29 1 132 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
A6UEL7 2.08e-06 50 31 2 109 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q97GZ3 2.09e-06 51 30 4 138 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P42012 2.31e-06 50 26 3 126 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
P62644 2.41e-06 51 30 5 148 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P42508 2.5e-06 50 26 0 106 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P0AED6 2.53e-06 50 28 2 119 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 2.53e-06 50 28 2 119 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
Q0D3B6 2.6e-06 51 29 2 125 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
A2YQ93 2.72e-06 51 29 2 125 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
Q9FPR6 2.89e-06 49 26 2 121 2 ARR17 Two-component response regulator ARR17 Arabidopsis thaliana
P66797 2.92e-06 50 28 2 119 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 2.92e-06 50 28 2 119 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P0AEV3 2.97e-06 50 25 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 2.97e-06 50 25 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 2.97e-06 50 25 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q3J653 3.47e-06 50 35 5 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q21IQ9 3.57e-06 50 33 4 127 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9K998 3.64e-06 50 32 5 119 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2SPQ1 4.08e-06 50 34 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
P39048 4.6e-06 50 31 3 116 2 patA Protein PatA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P10046 5.59e-06 50 28 0 111 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q2ILG8 5.94e-06 50 33 3 107 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3JY65 6.5e-06 50 34 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain 1710b)
Q62G12 6.5e-06 50 34 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia mallei (strain ATCC 23344)
Q2STS8 6.8e-06 49 34 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6K8X6 6.82e-06 50 30 2 120 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q7Y0W3 7.02e-06 49 29 3 120 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
B8AEH1 7.27e-06 50 30 2 120 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q7Y0W5 7.42e-06 49 29 3 120 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
O82868 7.51e-06 48 26 0 112 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q9KL96 7.52e-06 49 28 4 142 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6K9T0 8.94e-06 47 24 2 109 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 8.94e-06 47 24 2 109 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q05522 8.95e-06 49 36 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
Q2INJ8 9.06e-06 49 36 5 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8EF61 9.35e-06 49 34 4 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q39S45 9.99e-06 49 31 5 109 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q81JL3 1.08e-05 48 34 4 106 3 lytT Sensory transduction protein LytT Bacillus anthracis
Q8E217 1.11e-05 48 30 3 107 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 1.11e-05 48 30 3 107 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
P62645 1.13e-05 49 30 3 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P48027 1.15e-05 49 26 1 112 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q9ZWJ9 1.16e-05 49 29 2 123 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
Q89T55 1.23e-05 49 31 7 141 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8B3I4 1.25e-05 49 30 2 120 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q0HVI0 1.29e-05 48 35 5 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q5SML5 1.33e-05 49 30 2 120 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
Q2IT50 1.41e-05 48 30 3 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain HaA2)
Q2RRX2 1.56e-05 48 36 5 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7NSI8 1.79e-05 48 30 9 167 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
O14283 1.81e-05 48 27 0 102 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P18769 1.85e-05 48 32 1 112 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q53228 1.93e-05 47 27 0 106 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q0HIF6 1.99e-05 48 35 5 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
Q6BGW4 2.01e-05 47 27 3 125 3 SRR1 Stress response regulator protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5JF95 2.08e-05 48 33 7 136 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P62598 2.08e-05 48 27 2 132 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P0A4H2 2.12e-05 47 30 3 117 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 2.12e-05 47 30 3 117 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 2.12e-05 47 30 3 117 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8EQQ3 2.18e-05 47 28 1 91 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7MBQ5 2.3e-05 48 33 6 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
Q8D4X6 2.32e-05 48 33 6 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
Q1QVY7 2.36e-05 48 34 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
O33558 2.4e-05 48 34 5 107 1 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Cereibacter sphaeroides
Q940D0 2.79e-05 48 29 3 124 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q63PS2 2.93e-05 47 33 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain K96243)
Q52883 2.97e-05 47 33 7 136 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q814J1 3.05e-05 47 34 4 106 4 lytT Sensory transduction protein LytT Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2KCH8 3.25e-05 47 31 7 137 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9KQD8 3.26e-05 47 28 6 154 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P52939 3.35e-05 47 25 5 163 3 spo0A Stage 0 sporulation protein A homolog Clostridium innocuum
Q75HW2 3.39e-05 48 29 4 130 2 RR27 Two-component response regulator ORR27 Oryza sativa subsp. japonica
Q2IQS6 3.43e-05 47 32 9 146 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q12PJ3 3.53e-05 47 30 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8PX96 3.89e-05 47 28 4 135 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O87940 3.89e-05 47 28 0 114 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
Q9P896 4.09e-05 47 29 2 110 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O29221 4.14e-05 47 31 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P31802 4.15e-05 46 30 8 212 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
Q1GZZ0 4.22e-05 47 31 5 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P59338 4.43e-05 47 30 3 106 3 dcuR Transcriptional regulatory protein DcuR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_15075
Feature type CDS
Gene ompR
Product two-component system response regulator OmpR
Location 116082 - 116801 (strand: 1)
Length 720 (nucleotides) / 239 (amino acids)

Contig

Accession ZDB_225
Length 129223 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1631
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07659 two-component system, OmpR family, phosphate regulon response regulator OmpR Two-component system
Biofilm formation - Escherichia coli		 -

Protein Sequence

MQESYKVLVVDDDMRLRALLERYLSEQGFQVRTAANAEQMDRLLTRESIHLIVLDLMLPGEDGLSICRRLRSQNNPIPIIMVTAKGEEVDRIVGLEIGADDYIPKPFNPRELLARIRAVLRRQANELPGAPSQDDAVIQFGKFKLNLGTREMFHEDENMPLTSGEFAVLKVLVSHPREPLSRDKLMSLARGREYSAMERSIDVQISRLRRMIEEDPTHPRYIQTVWGLGYVFVPDGNKA

Flanking regions ( +/- flanking 50bp)

GCACAATTAATCTGAAGAGTTGCATGAAAAAATGAACCCGGGAGTCAAACATGCAGGAAAGTTATAAGGTCCTTGTCGTTGATGATGACATGCGTCTGCGTGCGCTGCTTGAGCGCTATCTGAGTGAGCAGGGTTTCCAGGTCCGTACCGCCGCGAATGCGGAACAGATGGATCGCCTGCTGACGCGTGAATCTATCCATCTTATTGTCCTGGATCTGATGTTACCGGGCGAAGACGGGCTGTCTATCTGCCGCCGTCTGAGAAGCCAGAATAACCCGATTCCGATCATTATGGTGACGGCGAAAGGGGAAGAAGTGGATCGCATCGTCGGGCTGGAAATCGGTGCGGATGATTATATTCCGAAGCCGTTTAACCCGCGTGAACTGCTGGCGCGTATCCGTGCTGTGCTGCGCCGTCAGGCGAATGAACTGCCGGGTGCACCATCCCAGGATGATGCGGTGATTCAGTTCGGTAAGTTCAAACTGAACCTCGGCACCCGTGAGATGTTCCATGAAGATGAAAACATGCCGCTGACCAGCGGTGAGTTCGCCGTGCTGAAAGTGCTGGTGTCACACCCGCGTGAACCGCTGTCCCGCGATAAGCTGATGAGCCTGGCGCGCGGCCGTGAGTACAGTGCGATGGAACGTTCAATCGACGTGCAGATTTCCCGTCTGCGCCGCATGATTGAGGAAGATCCGACACATCCGCGTTATATCCAGACCGTCTGGGGACTGGGTTACGTGTTCGTTCCGGACGGCAACAAGGCATGAAACGGCTGCGGTTCTCGCCGAGGAGCACTTTTTCGCGCTCGTTATTTCTG