Homologs in group_1631

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10740 FBDBKF_10740 98.3 Morganella morganii S1 ompR two-component system response regulator OmpR
EHELCC_15075 EHELCC_15075 98.3 Morganella morganii S2 ompR two-component system response regulator OmpR
NLDBIP_14905 NLDBIP_14905 98.3 Morganella morganii S4 ompR two-component system response regulator OmpR
LHKJJB_14440 LHKJJB_14440 98.3 Morganella morganii S3 ompR two-component system response regulator OmpR
HKOGLL_13060 HKOGLL_13060 98.3 Morganella morganii S5 ompR two-component system response regulator OmpR
PMI_RS14290 PMI_RS14290 91.7 Proteus mirabilis HI4320 ompR two-component system response regulator OmpR

Distribution of the homologs in the orthogroup group_1631

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1631

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A4P7TS68 1.02e-161 449 91 0 237 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.02e-161 449 91 0 237 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.02e-161 449 91 0 237 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.02e-161 449 91 0 237 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.02e-161 449 91 0 237 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.02e-161 449 91 0 237 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.02e-161 449 91 0 237 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.02e-161 449 91 0 237 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
G3XCY6 7.95e-63 199 45 4 232 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P31079 4.06e-61 194 46 4 234 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P48259 8.73e-59 189 43 2 234 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P51358 6.22e-57 184 43 2 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 7.64e-57 184 43 2 229 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q9HUI2 4.14e-56 182 42 3 234 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28835 1.39e-54 178 42 4 234 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
O78428 1.56e-54 178 40 2 234 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q9TLQ4 2.28e-53 175 38 3 236 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P28257 5.14e-53 174 41 2 229 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q06239 5.31e-53 174 39 3 228 3 vanR Regulatory protein VanR Enterococcus faecium
P13359 3.5e-52 172 41 5 234 3 virG Regulatory protein VirG Rhizobium rhizogenes
P13792 7.58e-52 171 41 1 228 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P37478 9.46e-52 171 39 1 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P39663 2.45e-51 170 40 2 236 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P94413 3.16e-51 169 38 5 233 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q8CQK0 4.9e-49 164 38 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 4.9e-49 164 38 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P07545 5.64e-49 164 41 4 231 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7A0U4 9.01e-49 163 36 3 239 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 9.01e-49 163 36 3 239 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 9.01e-49 163 36 3 239 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 9.01e-49 163 36 3 239 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 9.01e-49 163 36 3 239 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 9.01e-49 163 36 3 239 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 9.01e-49 163 36 3 239 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 9.01e-49 163 36 3 239 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q4LAJ9 3.18e-48 161 38 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q7A216 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 6.93e-48 160 37 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 6.93e-48 160 37 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 6.93e-48 160 37 3 229 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 6.93e-48 160 37 3 229 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A160 4.3e-47 159 37 4 232 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1TEL7 5.5e-47 158 38 2 227 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0PWB4 3.36e-46 156 38 2 229 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P35163 3.91e-46 156 37 3 229 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P42244 7.1e-46 155 34 2 223 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
A1KHB7 7.79e-46 155 38 2 229 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 7.79e-46 155 38 2 229 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P32040 8.01e-46 156 38 3 234 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P62722 1.03e-45 156 41 4 231 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
Q1B3X8 1.25e-45 155 39 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.25e-45 155 39 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.25e-45 155 39 3 228 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
A0R3I8 2.22e-45 154 37 2 229 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q742C1 2.36e-45 154 39 3 230 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.36e-45 154 39 3 230 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P9WGM9 2.94e-45 154 37 2 229 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 2.94e-45 154 37 2 229 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 2.94e-45 154 37 2 229 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q44444 1.66e-44 153 41 4 231 3 virG Regulatory protein VirG Rhizobium radiobacter
Q9CD68 1.68e-44 152 37 2 227 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P44918 2.91e-44 151 35 2 231 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WGL9 3.64e-44 151 35 2 225 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 3.64e-44 151 35 2 225 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 3.64e-44 151 35 2 225 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A9Q4 5.34e-44 151 36 4 233 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 5.34e-44 151 36 4 233 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 5.34e-44 151 36 4 233 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 5.34e-44 151 36 4 233 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
A0A0H3GGB5 5.42e-44 150 40 6 235 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE90 7.74e-44 150 41 7 236 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 7.74e-44 150 41 7 236 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 7.74e-44 150 41 7 236 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P44895 8.25e-44 150 37 4 229 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04942 1.64e-43 149 40 3 229 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8DPL7 1.94e-43 149 36 3 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 1.94e-43 149 36 3 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 1.94e-43 149 36 3 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P45607 4.31e-43 148 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q9F868 5.03e-43 148 37 2 225 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45606 2.34e-42 146 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0AFJ5 2.36e-42 146 37 3 229 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 2.36e-42 146 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P23620 2.47e-42 146 37 3 228 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45605 2.84e-42 146 37 3 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P69228 4.01e-42 146 37 3 233 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 4.01e-42 146 37 3 233 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P94504 1.15e-40 142 33 3 238 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
O32192 1.93e-40 141 32 4 228 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P0ACZ8 2.34e-40 141 38 3 232 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 2.34e-40 141 38 3 232 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 2.34e-40 141 38 3 232 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P54443 1.45e-38 137 33 4 230 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q52990 2.68e-38 136 37 3 227 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
O34903 2.87e-38 135 33 3 231 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
A0QTK2 3.2e-38 135 38 3 225 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q31S42 3.99e-38 136 35 3 229 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7D9K0 5.3e-38 136 36 3 232 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 5.3e-38 136 36 3 232 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P38684 5.47e-38 135 33 3 232 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P54884 5.62e-38 134 38 2 185 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P9WGM7 7.8e-38 134 38 3 225 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 7.8e-38 134 38 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 7.8e-38 134 38 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CCJ2 8.01e-38 134 38 3 225 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q93CB8 9.02e-38 134 38 3 225 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q02540 2.04e-37 134 35 4 228 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q44929 2.19e-37 134 34 4 233 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P58357 5.86e-37 132 33 3 232 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
P45189 1.05e-36 132 35 4 229 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CQ17 1.26e-36 131 32 2 226 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 1.26e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
L7N689 1.29e-36 132 34 3 230 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7A1J1 1.66e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.66e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.66e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.66e-36 131 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.66e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.66e-36 131 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.66e-36 131 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.66e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.66e-36 131 32 2 226 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.66e-36 131 32 2 226 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q50136 3.06e-36 130 36 2 215 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q44006 3.81e-36 130 34 3 230 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P9WGM1 5.18e-36 130 36 2 215 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 5.18e-36 130 36 2 215 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 5.18e-36 130 36 2 215 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9AE24 5.59e-36 130 33 2 233 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q82EB1 1.26e-35 129 35 4 237 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P23836 1.9e-35 128 35 4 228 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 2.12e-35 128 35 4 228 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 2.12e-35 128 35 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z7H2 2.61e-35 128 35 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q4L6C6 3.67e-35 127 35 7 231 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P0C001 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 3.99e-35 127 34 6 228 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 3.99e-35 127 34 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P52108 5.96e-35 127 33 3 236 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q55890 6.33e-35 127 35 3 229 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0DM78 7.22e-35 127 35 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 7.22e-35 127 35 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 7.22e-35 127 35 3 227 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 7.22e-35 127 35 3 227 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 7.22e-35 127 35 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9ZEP4 7.31e-35 127 33 3 236 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4L8L9 8.57e-35 127 35 5 226 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q99U73 1.39e-34 126 35 6 228 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q9ZHD3 1.97e-34 126 35 5 234 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P42421 2.13e-34 125 33 3 225 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q8X738 2.98e-34 125 35 4 228 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P0DMK7 3.3e-34 125 33 3 235 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 3.3e-34 125 33 3 235 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q57QC3 4e-34 125 34 3 227 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q8CN92 5.34e-34 124 33 4 224 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLN2 6.13e-34 124 33 4 224 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P30843 1.03e-33 124 33 2 230 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
O24973 1.27e-33 124 34 2 225 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
P0CL17 1.51e-33 123 35 4 234 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.51e-33 123 35 4 234 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q47456 1.78e-33 123 33 2 227 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P36556 2.75e-33 122 34 2 229 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P21866 4.74e-33 122 33 4 231 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q49ZT8 5.91e-33 122 32 3 223 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGN1 8.57e-33 121 30 2 226 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 8.57e-33 121 30 2 226 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P08368 1.29e-32 121 33 1 224 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q9I4F9 1.4e-32 121 34 2 228 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2YZ24 1.42e-32 121 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P76340 2.19e-32 120 33 4 229 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q7A039 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 4.84e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q49XM7 6.43e-32 119 35 6 227 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GE73 7.19e-32 119 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q70FH0 8.28e-32 119 33 2 228 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
A6QJK3 1.36e-31 118 32 3 225 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.36e-31 118 32 3 225 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
O06978 3.23e-31 118 29 2 228 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q01473 2.4e-30 121 32 2 226 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 9.29e-09 58 29 1 119 3 rcaC Protein RcaC Microchaete diplosiphon
Q07783 3.53e-30 115 32 4 237 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q04803 5.45e-30 116 34 2 230 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P50351 1.54e-29 114 32 5 239 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P50350 2.14e-29 113 33 5 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P0A4I0 2.36e-28 110 31 4 228 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2.36e-28 110 31 4 228 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q07597 4.46e-28 109 31 2 226 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
Q5HPC3 5.16e-28 109 35 7 228 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9K621 5.43e-28 109 28 3 234 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8CP82 7.97e-28 108 35 7 228 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0A4I2 1.36e-27 108 33 2 225 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 1.36e-27 108 33 2 225 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q55933 2.7e-27 107 29 4 238 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8FZ93 5.34e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 5.34e-27 107 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 5.34e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 5.34e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 5.34e-27 107 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 5.34e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 5.34e-27 107 29 1 227 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 5.34e-27 107 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
A6WZ81 5.81e-27 106 29 1 227 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q2FWH6 8.86e-27 106 31 4 223 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q47744 1.24e-26 105 29 4 227 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q932F1 1.99e-26 105 29 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9HV32 4.02e-26 104 31 3 226 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8Z181 4.6e-26 104 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 4.6e-26 104 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 4.6e-26 104 28 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 4.6e-26 104 28 7 232 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 4.6e-26 104 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
O69730 5.13e-26 104 30 3 229 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B8H358 6.65e-26 103 29 1 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 6.65e-26 103 29 1 227 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2YSS2 7.09e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1L2 8.13e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 8.13e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 8.13e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 8.13e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 8.13e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 8.13e-26 103 28 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GJ11 1.13e-25 103 29 7 232 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
P52076 2.49e-25 102 30 2 227 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P33112 2.5e-25 102 33 6 227 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q9I0I1 4.34e-25 101 31 3 228 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8CQ37 4.73e-25 101 27 4 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 4.73e-25 101 27 4 229 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P45337 7.49e-25 100 29 2 227 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DN02 2.69e-24 99 29 5 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 2.69e-24 99 29 5 225 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8XBS3 4.16e-24 99 29 2 227 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q49VK3 1.75e-23 97 28 7 231 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P66795 2.15e-23 97 29 2 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 2.15e-23 97 29 2 227 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q9KM23 2.78e-22 94 31 8 229 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4L481 4.05e-22 94 25 4 229 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
P48359 4.56e-22 93 34 2 150 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
O34951 1.08e-20 90 25 4 227 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
P0A4H8 2.14e-20 89 28 5 228 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.14e-20 89 28 5 228 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8GP20 7.48e-20 87 32 5 230 1 rssB Swarming motility regulation protein RssB Serratia marcescens
O31432 8.36e-20 87 26 8 235 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q1XDE4 1.86e-19 86 35 2 136 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P72781 3.83e-17 80 35 3 136 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8GZM2 8.73e-17 82 38 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 8.73e-17 82 38 1 120 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P55701 3.25e-16 78 28 5 228 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P06628 4.16e-15 72 35 2 121 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P43501 1.11e-14 71 35 3 121 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P51343 1.47e-14 73 34 1 123 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q04848 3.83e-14 74 32 0 109 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9ZM64 4.79e-14 69 31 2 119 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P71403 1.06e-13 68 31 2 119 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P23221 1.18e-13 70 30 1 133 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P52931 1.22e-13 70 35 2 117 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q2KCH7 1.3e-13 68 31 2 121 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P10577 1.52e-13 72 33 0 110 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P51586 1.64e-13 68 40 1 109 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
A1W0A5 1.76e-13 68 30 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 1.76e-13 68 30 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 1.76e-13 68 30 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P0AFB8 3.11e-13 72 30 1 123 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 3.11e-13 72 30 1 123 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P10576 3.15e-13 72 32 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P45671 3.21e-13 71 32 1 131 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P41789 3.23e-13 71 30 1 123 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52941 3.86e-13 70 34 4 135 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q92HC2 4.23e-13 71 33 1 109 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P52942 4.41e-13 67 33 2 120 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q4UL27 5.41e-13 71 30 1 113 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P28787 8.81e-13 70 32 1 124 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q4UU85 1.03e-12 70 36 3 126 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
Q9HU19 1.11e-12 70 32 0 115 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P03029 1.17e-12 70 30 1 121 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q68WH4 1.41e-12 70 29 1 113 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 1.81e-12 69 29 1 113 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q05943 1.87e-12 68 30 5 171 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1RJS1 1.92e-12 69 30 1 113 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
O05251 1.97e-12 67 39 4 104 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
T2KMF4 2.33e-12 69 29 2 124 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P46384 3.84e-12 65 31 3 121 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P40138 5.16e-12 67 32 2 127 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q9HV27 1.47e-11 66 39 2 100 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I4N3 2.5e-11 66 34 4 138 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I4 3.08e-11 65 31 5 154 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 3.08e-11 65 31 5 154 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9WY30 3.99e-11 65 32 1 117 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q06065 4.71e-11 65 30 0 119 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P13632 5.57e-11 65 29 0 117 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P31908 6.05e-11 65 35 4 117 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O25918 6.21e-11 63 24 7 236 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
P72253 7.1e-11 64 37 4 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
P52929 7.85e-11 63 34 3 119 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
P24072 8.93e-11 60 29 1 118 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P52934 9.58e-11 63 33 2 119 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
P23747 1e-10 64 29 2 153 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P26487 1.27e-10 62 29 1 151 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q88AQ2 1.4e-10 63 32 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3LWR6 1.81e-10 62 28 0 125 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.81e-10 62 28 0 125 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.81e-10 62 28 0 125 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P52932 2.32e-10 61 33 3 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q00934 2.33e-10 63 32 0 126 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8L9Y3 2.89e-10 62 30 1 121 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
P52928 2.89e-10 62 30 4 154 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q88RJ6 4.22e-10 62 32 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P09432 7.77e-10 61 30 2 124 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q54SP4 8.31e-10 62 37 3 113 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 0.000229 45 31 3 129 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q04849 1.37e-09 61 30 3 131 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q1IRH0 1.37e-09 60 30 4 143 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q9FXD6 1.63e-09 60 29 2 124 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
Q2WAJ8 1.68e-09 60 33 4 119 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P06534 2.41e-09 59 31 3 134 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
P96602 3.54e-09 58 29 3 122 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q9KA55 3.55e-09 59 32 8 150 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P0A2D5 3.66e-09 56 28 2 120 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 3.66e-09 56 28 2 120 3 cheY Chemotaxis protein CheY Salmonella typhi
P15940 4.35e-09 58 31 0 116 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8KR08 4.9e-09 58 28 1 130 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P96126 5.14e-09 56 26 2 121 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
Q5A599 8.87e-09 58 28 2 128 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P29267 1.18e-08 58 31 2 119 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0AE69 1.19e-08 55 27 2 120 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 1.19e-08 55 27 2 120 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 1.19e-08 55 27 2 120 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q54YZ9 1.34e-08 58 34 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q8FGP6 1.43e-08 55 27 2 120 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q93P00 2.36e-08 54 26 2 123 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
O14002 2.57e-08 57 29 4 126 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9FAD7 2.71e-08 54 27 2 120 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q8D0P1 3.31e-08 54 26 2 123 3 cheY Chemotaxis protein CheY Yersinia pestis
Q1QI44 3.76e-08 56 31 3 118 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8Z333 5.02e-08 56 28 2 138 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P25852 5.21e-08 56 28 2 138 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8VL08 5.22e-08 56 34 4 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Azospirillum brasilense
Q8KIY1 5.45e-08 56 29 2 117 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q2SFK0 7.34e-08 55 35 3 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q5N6V8 8.85e-08 55 28 5 153 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
A2X1N2 9.05e-08 55 29 2 133 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q6H805 9.75e-08 55 29 2 133 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
Q9APD9 9.99e-08 55 27 1 139 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q9KQD5 1.02e-07 52 25 3 130 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.02e-07 52 25 3 130 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1SMR4 1.09e-07 55 33 2 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P52938 1.15e-07 54 29 5 134 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q51455 1.39e-07 52 27 2 120 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0R4K1 1.53e-07 52 28 0 115 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P52940 1.54e-07 54 30 5 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q10WZ6 1.89e-07 54 31 2 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q56128 1.91e-07 55 32 0 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P14375 1.91e-07 54 26 0 119 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P58662 2.05e-07 54 32 0 100 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0DMC5 2.15e-07 54 33 0 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q9KSB1 2.21e-07 54 28 3 121 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P39486 2.39e-07 53 30 4 109 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P62646 2.72e-07 53 31 3 108 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P45709 3.15e-07 51 29 3 118 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q9AAK0 3.27e-07 53 32 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P94514 3.53e-07 53 29 4 121 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
O25153 3.58e-07 53 26 3 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q5A4X5 3.72e-07 53 26 0 110 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
P38889 3.82e-07 53 27 0 107 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0A4H5 4e-07 50 26 1 109 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 4e-07 50 26 1 109 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q86AT9 4.04e-07 53 31 3 116 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P0DMC6 4.25e-07 53 33 0 100 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q8H7S7 4.27e-07 53 30 2 123 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 4.43e-07 53 30 2 123 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
Q8X613 4.63e-07 53 26 0 119 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P52936 7.04e-07 52 29 3 122 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A7N6S2 7.4e-07 53 31 3 115 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P0AFU5 7.51e-07 52 29 0 118 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 7.51e-07 52 29 0 118 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
E0X9C7 7.7e-07 53 29 2 113 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q20XK3 8.19e-07 52 31 4 119 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Rhodopseudomonas palustris (strain BisB18)
Q9KM66 8.35e-07 52 28 1 116 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q20YL8 8.82e-07 52 29 5 146 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodopseudomonas palustris (strain BisB18)
P30855 9.8e-07 52 31 0 107 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P58402 9.8e-07 52 32 0 105 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q89SQ1 1.01e-06 52 30 5 125 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0C5S3 1.19e-06 50 31 2 109 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
Q2T8Y6 1.21e-06 52 37 6 113 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q4L8V4 1.35e-06 51 30 4 131 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
Q9LYP5 1.45e-06 52 24 2 122 2 ARR21 Putative two-component response regulator ARR21 Arabidopsis thaliana
A2XYV5 1.47e-06 50 28 5 126 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
Q9F8D7 1.5e-06 52 27 1 112 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
A6UEL7 1.6e-06 50 31 2 109 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q7XQA6 1.6e-06 50 28 5 126 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
Q07084 1.65e-06 52 24 2 138 1 SSK1 Osmolarity two-component system protein SSK1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q132U2 1.66e-06 51 31 3 117 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain BisB5)
Q56312 1.68e-06 49 23 1 117 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P42508 1.73e-06 50 26 0 106 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q9RC52 1.84e-06 50 31 6 138 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3SVA1 1.9e-06 51 30 4 120 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P0AEV3 2.16e-06 51 26 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 2.16e-06 51 26 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 2.16e-06 51 26 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P10958 2.7e-06 50 28 1 132 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q5L0L0 2.71e-06 50 29 4 115 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
A5W4E3 2.81e-06 51 28 2 113 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P62644 3.44e-06 50 29 5 148 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P58253 3.49e-06 50 30 4 117 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P39048 3.57e-06 50 31 3 116 2 patA Protein PatA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P42012 3.7e-06 50 26 3 126 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q0D3B6 3.81e-06 50 28 2 125 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
A2YQ93 3.84e-06 50 28 2 125 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
Q97GZ3 3.89e-06 50 29 4 138 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P0AED6 3.97e-06 49 27 2 119 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 3.97e-06 49 27 2 119 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 4.28e-06 49 27 2 119 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 4.28e-06 49 27 2 119 3 uvrY Response regulator UvrY Escherichia coli O157:H7
Q3J653 4.67e-06 50 34 5 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9FPR6 4.72e-06 48 25 2 121 2 ARR17 Two-component response regulator ARR17 Arabidopsis thaliana
Q21IQ9 5e-06 50 32 4 127 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
O82868 5.15e-06 48 26 0 112 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q2INJ8 5.68e-06 50 37 5 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q9K998 5.8e-06 49 31 5 119 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8E217 6.26e-06 49 31 3 107 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 6.26e-06 49 31 3 107 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
Q2SPQ1 6.98e-06 49 33 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Hahella chejuensis (strain KCTC 2396)
B8AEH1 8.93e-06 49 29 2 120 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q2ILG8 8.94e-06 49 32 3 107 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
P10046 9.05e-06 49 27 0 111 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q6K8X6 9.27e-06 49 29 2 120 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q3JY65 9.6e-06 49 33 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain 1710b)
Q62G12 9.6e-06 49 33 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia mallei (strain ATCC 23344)
Q2STS8 9.68e-06 49 33 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7Y0W3 9.99e-06 49 28 3 120 2 EHD1 Two-component response regulator EHD1 Oryza sativa subsp. indica
O14283 1.07e-05 49 28 0 102 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7Y0W5 1.08e-05 49 28 3 120 1 EHD1 Two-component response regulator ORR30 Oryza sativa subsp. japonica
Q9KL96 1.19e-05 48 28 4 142 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q53228 1.22e-05 48 27 0 106 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6K9T0 1.25e-05 47 23 2 109 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 1.25e-05 47 23 2 109 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q05522 1.32e-05 48 35 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus subtilis (strain 168)
Q39S45 1.33e-05 48 30 5 109 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q9ZWJ9 1.36e-05 49 28 2 123 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
Q6BGW4 1.41e-05 48 27 3 125 3 SRR1 Stress response regulator protein 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q8EF61 1.45e-05 48 33 4 107 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P48027 1.54e-05 49 25 1 112 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q5SML5 1.73e-05 48 29 2 120 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
P62645 1.74e-05 48 29 3 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q2IT50 1.74e-05 48 29 3 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhodopseudomonas palustris (strain HaA2)
B8B3I4 1.75e-05 48 29 2 120 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q89T55 1.81e-05 48 31 7 141 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q81JL3 1.93e-05 48 33 4 106 3 lytT Sensory transduction protein LytT Bacillus anthracis
Q0HVI0 1.96e-05 48 34 5 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q2RRX2 2.26e-05 48 35 5 109 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7NSI8 2.41e-05 48 29 9 167 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8EQQ3 2.44e-05 47 28 1 91 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P62598 2.51e-05 48 26 2 132 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P18769 2.53e-05 48 31 1 112 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q0HIF6 3.07e-05 47 34 5 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
A8R3S7 3.1e-05 47 30 1 120 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
P0A4H2 3.15e-05 47 29 3 117 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 3.15e-05 47 29 3 117 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 3.15e-05 47 29 3 117 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O33558 3.38e-05 47 33 5 107 1 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 3 operon Cereibacter sphaeroides
Q940D0 3.52e-05 48 27 4 140 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q5JF95 3.65e-05 47 33 7 136 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q75HW2 3.93e-05 47 28 4 130 2 RR27 Two-component response regulator ORR27 Oryza sativa subsp. japonica
Q7MBQ5 3.97e-05 47 32 6 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain YJ016)
Q8D4X6 4.07e-05 47 32 6 114 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Vibrio vulnificus (strain CMCP6)
Q63PS2 4.08e-05 47 32 6 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Burkholderia pseudomallei (strain K96243)
Q2IQS6 4.09e-05 47 32 9 146 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q1QVY7 4.46e-05 47 33 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q52883 4.67e-05 47 32 7 136 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
Q8PX96 4.69e-05 47 29 4 133 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q2KCH8 4.88e-05 47 30 7 137 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q12PJ3 5.2e-05 47 29 4 112 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8DVB7 5.2e-05 46 31 4 109 3 lytR Sensory transduction protein LytR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9KQD8 5.21e-05 47 27 6 154 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q814J1 5.45e-05 46 33 4 106 4 lytT Sensory transduction protein LytT Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9P896 5.55e-05 47 28 2 110 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O87940 5.56e-05 46 27 0 114 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
Q869S5 5.63e-05 47 29 4 107 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
O29221 5.88e-05 47 30 3 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q1GZZ0 6.51e-05 47 30 5 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14455
Feature type CDS
Gene ompR
Product two-component system response regulator OmpR
Location 119882 - 120604 (strand: 1)
Length 723 (nucleotides) / 240 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1631
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07659 two-component system, OmpR family, phosphate regulon response regulator OmpR Two-component system
Biofilm formation - Escherichia coli		 -

Protein Sequence

MQESYKILVVDDDMRLRALLERYLSEQGFQVRTAANAEQMDRLLTRESIHLIVLDLMLPGEDGLSICRRLRSQNNPIPIIMVTAKGEEVDRIVGLEIGADDYIPKPFNPRELLARIRAVLRRQANELPGAPSQDDAVIQFGKFKLNLGTREMFHDDENMPLTSGEFAVLKVLVSHPREPLSRDKLMSLARGREYSAMERSIDVQISRLRRMIEEDPTHPRYIQTVWGLGYVFVPDGNSKP

Flanking regions ( +/- flanking 50bp)

ACGAAATAACCTGAGTATTTGTATGCAAAAACGAATCTGGAGAGTCAAACATGCAAGAAAGTTATAAGATCCTTGTCGTTGATGATGACATGCGCCTGCGTGCTCTGCTTGAGCGGTATCTGAGTGAGCAGGGCTTCCAGGTACGTACTGCGGCTAACGCGGAACAGATGGATCGCCTGCTGACGCGTGAGTCTATTCACCTTATCGTCCTTGATCTGATGTTACCGGGTGAAGATGGTTTATCCATTTGCCGCCGTCTGAGAAGTCAGAATAATCCGATCCCTATCATCATGGTGACGGCGAAAGGCGAAGAAGTTGACCGTATCGTCGGTCTGGAAATCGGCGCGGATGATTACATTCCCAAGCCGTTTAACCCGCGTGAATTATTAGCCCGTATCCGTGCGGTGCTGCGTCGTCAGGCAAATGAACTGCCGGGTGCGCCGTCGCAGGATGATGCGGTTATTCAGTTTGGTAAGTTTAAACTGAACCTCGGTACGCGTGAAATGTTCCACGATGACGAGAATATGCCGCTGACCAGCGGGGAATTCGCGGTTCTGAAAGTGCTGGTTTCACATCCGCGTGAGCCACTGTCCCGTGACAAACTGATGAGTCTGGCGCGTGGTCGTGAGTACAGTGCGATGGAGCGTTCAATCGATGTGCAGATTTCCCGTCTGCGCCGCATGATTGAAGAAGATCCGACGCATCCGCGCTATATCCAGACGGTATGGGGATTGGGTTACGTCTTTGTACCGGACGGCAACAGTAAGCCATGAAGCGGCTCCGGTTCTCCCCCAGGAGCACCTTTTCGCGCTCACTGTTTTTA