Homologs in group_2183

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16440 FBDBKF_16440 77.7 Morganella morganii S1 rluF 23S rRNA pseudouridine(2604) synthase RluF
EHELCC_08305 EHELCC_08305 77.7 Morganella morganii S2 rluF 23S rRNA pseudouridine(2604) synthase RluF
NLDBIP_08630 NLDBIP_08630 77.7 Morganella morganii S4 rluF 23S rRNA pseudouridine(2604) synthase RluF
LHKJJB_05635 LHKJJB_05635 77.7 Morganella morganii S3 rluF 23S rRNA pseudouridine(2604) synthase RluF
HKOGLL_05280 HKOGLL_05280 77.7 Morganella morganii S5 rluF 23S rRNA pseudouridine(2604) synthase RluF
F4V73_RS02960 F4V73_RS02960 76.3 Morganella psychrotolerans rluF 23S rRNA pseudouridine(2604) synthase RluF

Distribution of the homologs in the orthogroup group_2183

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2183

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8Z1V3 1.94e-149 423 76 1 292 3 rluF Dual-specificity RNA pseudouridine synthase RluF Salmonella typhi
Q8ZKL1 5.62e-149 422 76 1 292 3 rluF Dual-specificity RNA pseudouridine synthase RluF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FB47 9.04e-143 406 74 3 298 3 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X4L9 3.55e-142 404 74 3 298 3 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli O157:H7
Q83IR6 5.94e-142 404 74 3 298 3 rluF Dual-specificity RNA pseudouridine synthase RluF Shigella flexneri
P32684 9.48e-141 401 73 3 298 1 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli (strain K12)
P35159 4.46e-37 135 36 4 234 1 rluB Ribosomal large subunit pseudouridine synthase B Bacillus subtilis (strain 168)
Q8X4Q8 6.27e-30 117 30 6 266 3 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli O157:H7
P59815 6.89e-30 117 30 6 266 3 rluB Ribosomal large subunit pseudouridine synthase B Shigella flexneri
P37765 7.26e-30 117 30 6 266 1 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli (strain K12)
Q8FHV4 7.57e-30 117 30 6 266 3 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z7D5 5.31e-29 115 29 6 266 3 rluB Ribosomal large subunit pseudouridine synthase B Salmonella typhi
Q8ZP51 6.89e-29 114 29 6 266 3 rluB Ribosomal large subunit pseudouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O67444 2.96e-28 112 31 5 241 3 aq_1464 Uncharacterized RNA pseudouridine synthase aq_1464 Aquifex aeolicus (strain VF5)
Q8ZEG0 5.82e-27 110 27 7 298 3 rluB Ribosomal large subunit pseudouridine synthase B Yersinia pestis
O32068 2.05e-26 107 33 7 226 3 ytzG Uncharacterized RNA pseudouridine synthase YtzG Bacillus subtilis (strain 168)
Q9HZ55 2.39e-25 107 29 5 243 3 rluB Ribosomal large subunit pseudouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q55578 1.26e-24 102 31 4 211 3 slr0361 Uncharacterized RNA pseudouridine synthase slr0361 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45124 1.34e-24 102 30 5 231 1 rsuA Ribosomal small subunit pseudouridine synthase A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1RJR2 8.4e-24 99 31 5 234 3 RBE_0321 Uncharacterized RNA pseudouridine synthase RBE_0321 Rickettsia bellii (strain RML369-C)
P65843 1.31e-23 99 33 7 241 3 BQ2027_MB1738 Uncharacterized RNA pseudouridine synthase Mb1738 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ1 1.31e-23 99 33 7 241 1 Rv1711 Uncharacterized RNA pseudouridine synthase Rv1711 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ0 1.31e-23 99 33 7 241 3 MT1751.1 Uncharacterized RNA pseudouridine synthase MT1751.1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9KSS7 2.08e-23 100 28 6 244 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9ZJG0 2.38e-23 99 29 5 247 3 jhp_1352 Uncharacterized RNA pseudouridine synthase jhp_1352 Helicobacter pylori (strain J99 / ATCC 700824)
O66829 8.41e-23 97 32 6 231 3 aq_554 Uncharacterized RNA pseudouridine synthase aq_554 Aquifex aeolicus (strain VF5)
Q87NB7 9.11e-23 99 27 10 304 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4UL59 9.69e-23 97 31 5 225 3 RF_0863 Uncharacterized RNA pseudouridine synthase RF_0863 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P55986 9.95e-23 97 28 5 247 3 HP_1459 Uncharacterized RNA pseudouridine synthase HP_1459 Helicobacter pylori (strain ATCC 700392 / 26695)
P45104 1.17e-22 99 30 6 229 1 rluB Ribosomal large subunit pseudouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CMY9 2.23e-22 98 31 9 249 3 rluB Ribosomal large subunit pseudouridine synthase B Pasteurella multocida (strain Pm70)
Q9ZD06 2.67e-22 95 30 6 239 3 RP544 Uncharacterized RNA pseudouridine synthase RP544 Rickettsia prowazekii (strain Madrid E)
P0AA46 1.69e-21 93 28 5 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Shigella flexneri
P0AA43 1.69e-21 93 28 5 228 1 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli (strain K12)
P0AA44 1.69e-21 93 28 5 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA45 1.69e-21 93 28 5 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli O157:H7
Q68WJ1 5.26e-21 92 29 6 241 3 RT0532 Uncharacterized RNA pseudouridine synthase RT0532 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9CPN4 6.37e-21 92 27 5 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Pasteurella multocida (strain Pm70)
P65840 7.59e-21 92 29 6 230 3 rsuA Ribosomal small subunit pseudouridine synthase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65841 7.59e-21 92 29 6 230 3 rsuA Ribosomal small subunit pseudouridine synthase A Salmonella typhi
O05668 1.25e-20 92 32 7 242 3 ML1370 Uncharacterized RNA pseudouridine synthase ML1370 Mycobacterium leprae (strain TN)
Q8ZGM2 3.02e-20 90 27 5 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Yersinia pestis
O51155 3.74e-20 90 29 5 227 3 BB_0129 Uncharacterized RNA pseudouridine synthase BB_0129 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9I5J6 6.34e-20 89 27 6 232 3 rsuA Ribosomal small subunit pseudouridine synthase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87BI2 9.7e-20 92 32 5 223 3 rluB Ribosomal large subunit pseudouridine synthase B Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PAP2 1.01e-19 92 32 5 223 3 rluB Ribosomal large subunit pseudouridine synthase B Xylella fastidiosa (strain 9a5c)
Q92HG4 1.26e-19 88 29 5 228 3 RC0807 Uncharacterized RNA pseudouridine synthase RC0807 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8D8C0 1.45e-19 90 27 8 246 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio vulnificus (strain CMCP6)
Q8P8M6 1.53e-19 91 31 6 223 3 rluB Ribosomal large subunit pseudouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P57369 5.94e-19 87 28 6 253 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8PK58 7.11e-19 89 32 5 223 3 rluB Ribosomal large subunit pseudouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
Q9HX48 1.79e-18 84 31 4 179 3 rluE Ribosomal large subunit pseudouridine synthase E Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42395 1.28e-17 83 31 9 257 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8FIB6 4.4e-17 81 30 4 184 3 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P75966 1.53e-16 79 29 4 184 1 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli (strain K12)
Q83LF6 2.66e-16 79 29 4 185 3 rluE Ribosomal large subunit pseudouridine synthase E Shigella flexneri
Q9F855 3.14e-16 79 30 4 180 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DAS3 3.67e-16 79 27 4 180 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio vulnificus (strain CMCP6)
P72581 3.76e-16 79 27 6 197 3 slr0612 Uncharacterized RNA pseudouridine synthase slr0612 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q87QY8 5.62e-16 79 29 4 175 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8L960 7.74e-16 80 29 7 247 1 SVR1 Putative ribosomal large subunit pseudouridine synthase SVR1, chloroplastic Arabidopsis thaliana
Q8X724 1.12e-15 77 28 4 184 3 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli O157:H7
P44827 1.59e-15 77 29 4 194 3 rluE Ribosomal large subunit pseudouridine synthase E Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZFQ3 2.2e-15 76 29 6 178 3 rluE Ribosomal large subunit pseudouridine synthase E Yersinia pestis
Q9CKK7 2.49e-15 77 26 1 192 3 rluE Ribosomal large subunit pseudouridine synthase E Pasteurella multocida (strain Pm70)
Q8ZPZ1 4.4e-15 75 26 4 187 3 rluE Ribosomal large subunit pseudouridine synthase E Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8PDR2 2.23e-14 73 27 4 177 3 rluE Ribosomal large subunit pseudouridine synthase E Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q87QD4 1.07e-13 72 25 5 235 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8PQN3 1.26e-13 71 28 5 179 3 rluE Ribosomal large subunit pseudouridine synthase E Xanthomonas axonopodis pv. citri (strain 306)
Q8D8X2 2.28e-13 71 26 7 241 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio vulnificus (strain CMCP6)
Q9KRK5 3.39e-13 70 25 7 234 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8Z7G6 6.88e-13 69 25 4 187 3 rluE Ribosomal large subunit pseudouridine synthase E Salmonella typhi
Q89AL1 1.4e-12 69 26 5 237 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14195
Feature type CDS
Gene rluF
Product 23S rRNA pseudouridine(2604) synthase RluF
Location 3151719 - 3152597 (strand: -1)
Length 879 (nucleotides) / 292 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2183
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase
PF01479 S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1187 Translation, ribosomal structure and biogenesis (J) J Pseudouridylate synthase RsuA, specific for 16S rRNA U516 and 23S rRNA U2605

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06182 23S rRNA pseudouridine2604 synthase [EC:5.4.99.21] - -

Protein Sequence

MDTNLSTRLNKYISESGICSRREADRYIEQGLVLINGKRAGIGDRVTAGDEVKVNGRLIEAQDNSELVLIALNKPVGIVSTTDEGEKDNIVDYVNHSTRVFPIGRLDKDSQGLIFLTNHGDLVNKILRAGNSHEKEYLVTVDKPITDEFIRGMGAGVPILGQKTKKCKVKKEAAMVFRITLVQGLNRQIRRMCEYFGYEVTKLERIRIMNVSLAGLPVGEWRDLTDDELIKLFDAIEASSSEAPKQKQNKPKKQISSNAKALGIHIPKTKAKETENNTRKRFAQPGRKKKKR

Flanking regions ( +/- flanking 50bp)

TTTCTATCGTCACTTAATTGAGGTATATTCCGCAGTTTACGGAGGGAAGCATGGACACCAATTTATCTACTCGTCTTAATAAATATATCAGTGAAAGCGGTATCTGTTCACGTCGTGAAGCCGACCGTTATATCGAGCAAGGTCTGGTTCTTATCAATGGTAAGCGCGCAGGCATTGGCGATCGCGTAACGGCTGGCGATGAAGTGAAAGTGAATGGACGATTAATTGAAGCGCAAGATAATTCTGAGCTGGTGTTGATCGCACTGAATAAACCTGTAGGTATCGTCAGTACCACAGATGAAGGTGAGAAAGATAATATTGTTGATTATGTTAACCATAGCACCCGTGTTTTCCCAATTGGTCGTTTAGATAAAGATTCTCAGGGACTGATTTTTTTGACTAACCATGGTGATCTGGTCAATAAAATCTTACGGGCGGGTAACTCCCATGAAAAAGAGTATTTGGTCACGGTTGATAAACCCATTACTGATGAATTTATTCGCGGTATGGGGGCGGGTGTTCCTATTCTGGGACAAAAAACCAAGAAATGTAAGGTGAAAAAAGAAGCCGCAATGGTATTTCGTATCACCTTAGTACAAGGTCTAAACCGTCAAATTCGTCGTATGTGTGAATATTTTGGTTATGAAGTCACCAAGCTTGAACGTATCCGTATTATGAATGTTAGTTTGGCGGGATTACCTGTCGGGGAATGGCGTGATTTAACGGATGATGAGCTGATAAAGCTATTTGATGCTATTGAAGCATCAAGCTCTGAAGCCCCTAAACAGAAGCAAAATAAACCTAAGAAACAGATAAGTAGTAATGCGAAAGCGTTAGGGATCCATATTCCGAAAACAAAAGCCAAAGAGACGGAAAATAATACGCGTAAACGCTTTGCACAACCGGGGCGTAAAAAGAAAAAACGTTAGTTTGTTTCTTTTGTCATTCTGAGTTAAATAAGCGCCTATAGCGGGAGAAA