Homologs in group_386

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20035 FBDBKF_20035 38.5 Morganella morganii S1 sfaG S-fimbrial protein subunit SfaG
EHELCC_03495 EHELCC_03495 38.5 Morganella morganii S2 sfaG S-fimbrial protein subunit SfaG
NLDBIP_03495 NLDBIP_03495 38.5 Morganella morganii S4 sfaG S-fimbrial protein subunit SfaG
LHKJJB_09325 LHKJJB_09325 38.5 Morganella morganii S3 sfaG S-fimbrial protein subunit SfaG
HKOGLL_09650 HKOGLL_09650 38.5 Morganella morganii S5 sfaG S-fimbrial protein subunit SfaG
PMI_RS07085 PMI_RS07085 37.0 Proteus mirabilis HI4320 - fimbrial protein
PMI_RS17135 PMI_RS17135 39.5 Proteus mirabilis HI4320 - fimbrial protein

Distribution of the homologs in the orthogroup group_386

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_386

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P08189 3.14e-29 108 41 3 172 1 fimF Protein FimF Escherichia coli (strain K12)
P77789 9.77e-23 92 34 4 174 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
P13429 5.46e-22 90 34 4 167 1 sfaG S-fimbrial protein subunit SfaG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P37921 1.38e-21 89 36 5 186 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55223 2.8e-21 88 36 5 186 3 None Fimbrial subunit type 1 Salmonella typhimurium
P75860 3.93e-20 85 31 3 170 2 ycbV Uncharacterized fimbrial-like protein YcbV Escherichia coli (strain K12)
P37920 4.65e-20 85 36 6 186 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi
P0ABW5 9.91e-19 82 37 5 155 2 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli (strain K12)
P0ABW6 9.91e-19 82 37 5 155 3 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli O157:H7
P39264 2.54e-17 78 30 6 178 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P43660 1.58e-15 73 32 6 182 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P38052 2.12e-14 70 30 3 176 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
P37926 3.13e-14 69 33 6 174 3 fimF Fimbrial-like protein FimF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5K5 8.04e-14 68 30 5 175 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P62605 5.14e-12 64 31 5 177 3 pilC Type-1 fimbrial protein, C chain Escherichia coli
P62606 5.14e-12 64 31 5 177 3 pilC Type-1 fimbrial protein, C chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P04128 1.92e-10 60 34 6 154 1 fimA Type-1 fimbrial protein, A chain Escherichia coli (strain K12)
P12730 1.95e-10 60 32 7 178 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P43664 2.22e-10 59 27 5 183 3 lpfE Protein LpfE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37922 2.23e-09 57 28 5 152 3 fimI Fimbrin-like protein FimI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P12266 2.94e-09 56 33 6 154 1 None Fimbrial subunit type 1 Klebsiella pneumoniae
P12903 7.6e-09 55 30 7 184 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
Q08456 1.63e-08 54 27 5 152 5 fimI Putative fimbrin-like protein FimI Salmonella typhi
Q47223 5.54e-08 53 32 6 154 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
P75859 6.31e-08 53 28 2 153 2 ycbU Uncharacterized fimbrial-like protein YcbU Escherichia coli (strain K12)
P22595 1.13e-06 49 28 4 164 3 fimA Type-1 fimbrial protein subunit Serratia marcescens
P42913 1.19e-06 49 25 6 190 2 yraH Uncharacterized fimbrial-like protein YraH Escherichia coli (strain K12)
P11312 1.58e-05 46 25 6 184 3 F17a-A F17 fimbrial protein Escherichia coli
P76499 3.79e-05 45 25 6 171 2 yfcP Uncharacterized fimbrial-like protein YfcP Escherichia coli (strain K12)
P37909 0.000127 43 24 7 193 1 ybgD Uncharacterized fimbrial-like protein YbgD Escherichia coli (strain K12)
P77294 0.000173 43 27 4 131 3 ydeR Uncharacterized fimbrial-like protein YdeR Escherichia coli (strain K12)
P04740 0.000863 41 28 7 151 3 KS71A KS71A fimbrillin Escherichia coli

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13460
Feature type CDS
Gene -
Product fimbrial protein
Location 2982997 - 2983515 (strand: 1)
Length 519 (nucleotides) / 172 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_386
Orthogroup size 8
N. genomes 6

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07345 major type 1 subunit fimbrin (pilin) Shigellosis
Pertussis		 -

Protein Sequence

MHKLMLIVALSLLFTTKGSAYDTLVHINARVTGNTCTVETNSKRITVKLGQIATKDFISTTITQQRTPVIPFSIKLVDCQPEASAVKVSFNGRADPIDNALLAIDATGAKGVAISIMDNLGASIDINDKSQSYTLLPNQDNTLQFYARYVATQLPVQAGSANATATFLLEYQ

Flanking regions ( +/- flanking 50bp)

GCCTCTCAACTTGATGAACCTTTTGTGAAAATGACACAGGAGTGCCAATAATGCACAAATTAATGCTTATTGTAGCGTTGTCATTACTGTTTACCACTAAGGGATCTGCTTACGATACATTGGTACACATTAATGCCAGAGTAACAGGAAACACATGTACGGTAGAGACAAACTCAAAACGTATTACCGTAAAATTAGGCCAAATCGCCACAAAAGATTTTATTTCTACGACGATAACGCAACAACGTACGCCTGTTATCCCTTTTAGTATTAAATTAGTCGATTGCCAACCTGAAGCCAGTGCTGTGAAGGTCAGTTTTAATGGTCGTGCCGATCCTATTGATAACGCCTTACTCGCCATTGATGCAACGGGTGCCAAGGGAGTTGCCATTTCCATTATGGATAACTTAGGAGCTTCCATCGATATTAACGATAAAAGCCAGTCTTATACCTTATTGCCTAACCAAGATAATACCCTGCAATTTTATGCTCGCTATGTAGCGACTCAACTTCCTGTTCAAGCCGGATCGGCGAATGCAACAGCAACCTTTTTACTGGAGTACCAATAATGACACGCTCTTTTTCTTTCTTCACATTGCTGGTTTCTCTTCTTTGTATC