Homologs in group_142

Help

9 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07125 FBDBKF_07125 32.6 Morganella morganii S1 pflA pyruvate formate lyase 1-activating protein
EHELCC_03845 EHELCC_03845 32.6 Morganella morganii S2 pflA pyruvate formate lyase 1-activating protein
EHELCC_19995 EHELCC_19995 16.7 Morganella morganii S2 - hypothetical protein
NLDBIP_03845 NLDBIP_03845 32.6 Morganella morganii S4 pflA pyruvate formate lyase 1-activating protein
LHKJJB_09675 LHKJJB_09675 32.6 Morganella morganii S3 pflA pyruvate formate lyase 1-activating protein
HKOGLL_09300 HKOGLL_09300 32.6 Morganella morganii S5 pflA pyruvate formate lyase 1-activating protein
F4V73_RS01310 F4V73_RS01310 32.6 Morganella psychrotolerans pflA pyruvate formate lyase 1-activating protein
PMI_RS03465 PMI_RS03465 33.9 Proteus mirabilis HI4320 pflA pyruvate formate lyase 1-activating protein
PMI_RS12405 PMI_RS12405 26.1 Proteus mirabilis HI4320 - YjjW family glycine radical enzyme activase

Distribution of the homologs in the orthogroup group_142

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_142

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q30W71 4.24e-94 284 46 1 311 1 cutD Choline trimethylamine-lyase activating enzyme Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0A069AMK2 2.55e-60 197 35 4 304 3 pflE Trans-4-hydroxy-L-proline dehydratase activating enzyme Clostridioides difficile
O87941 4.53e-58 192 37 4 272 2 bssD Benzylsuccinate synthase activating enzyme Thauera aromatica
E5Y377 2.53e-55 185 36 7 283 1 islB Isethionate sulfite-lyase activating enzyme Bilophila wadsworthia (strain 3_1_6)
P32675 4.53e-55 184 33 3 296 3 pflC Pyruvate formate-lyase 2-activating enzyme Escherichia coli (strain K12)
Q312S3 1.95e-54 182 37 7 286 2 islB Isethionate sulfite-lyase activating enzyme Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0A124EH39 7.63e-53 179 34 7 290 3 AUL39_03430 Indoleacetate decarboxylase activating enzyme Tractidigestivibacter scatoligenes
E5Y7I3 1.82e-52 177 36 8 311 3 hpsH (2S)-3-sulfopropanediol sulfolyase activating enzyme Bilophila wadsworthia (strain 3_1_6)
C9YHW3 3.2e-50 172 32 6 309 3 hpdA 4-hydroxyphenylacetate decarboxylase activating enzyme Clostridioides difficile (strain R20291)
C9XIS7 3.2e-50 172 32 6 309 3 hpdA 4-hydroxyphenylacetate decarboxylase activating enzyme Clostridioides difficile (strain CD196)
Q727N0 3.87e-50 171 36 7 304 1 iseH Isethionate sulfite-lyase activating enzyme Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q18CP3 3.53e-49 169 31 6 309 3 hpdA 4-hydroxyphenylacetate decarboxylase activating enzyme Clostridioides difficile (strain 630)
Q84F14 6.35e-49 168 31 6 309 1 hpdA 4-hydroxyphenylacetate decarboxylase activating enzyme Clostridioides difficile
B8J0R0 7.01e-49 168 37 7 285 1 islB Isethionate sulfite-lyase activating enzyme Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A0A318FEA4 2.47e-46 162 33 3 283 3 hpfH (2S)-3-sulfopropanediol dehydratase activating enzyme Klebsiella oxytoca
P75794 3.61e-42 150 33 4 289 3 ybiY Putative pyruvate formate-lyase 3-activating enzyme Escherichia coli (strain K12)
Q38HX2 3.81e-42 150 29 7 307 1 csdA 4-hydroxyphenylacetate decarboxylase activating enzyme Clostridium scatologenes
Q46267 4.11e-29 114 32 2 194 3 act Pyruvate formate-lyase-activating enzyme Clostridium pasteurianum
Q46267 2.49e-07 54 25 5 190 3 act Pyruvate formate-lyase-activating enzyme Clostridium pasteurianum
O68575 3.38e-24 102 36 4 176 3 act Pyruvate formate-lyase-activating enzyme Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P0A9N7 2.28e-22 97 28 2 200 3 pflA Pyruvate formate-lyase 1-activating enzyme Shigella flexneri
P0A9N4 2.28e-22 97 28 2 200 1 pflA Pyruvate formate-lyase 1-activating enzyme Escherichia coli (strain K12)
P0A9N5 2.28e-22 97 28 2 200 3 pflA Pyruvate formate-lyase 1-activating enzyme Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9N6 2.28e-22 97 28 2 200 3 pflA Pyruvate formate-lyase 1-activating enzyme Escherichia coli O157:H7
P39409 1.41e-21 95 29 6 234 1 yjjW Putative glycyl-radical enzyme activating enzyme YjjW Escherichia coli (strain K12)
P43751 4.75e-18 85 27 4 219 3 pflA Pyruvate formate-lyase 1-activating enzyme Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7A1W8 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain MW2)
Q6GCP9 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain MSSA476)
Q6GK89 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain MRSA252)
Q7A7X5 4.5e-16 79 31 3 200 1 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain N315)
Q99WZ6 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJF3 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain COL)
Q2YV52 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G1D7 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK43 4.5e-16 79 31 3 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus aureus (strain USA300)
Q8CTX5 3.51e-15 77 30 4 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKI0 3.51e-15 77 30 4 200 3 pflA Pyruvate formate-lyase-activating enzyme Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0A442 1.35e-10 63 27 2 180 3 pflA Pyruvate formate-lyase-activating enzyme Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A442 6.76e-05 47 41 0 41 3 pflA Pyruvate formate-lyase-activating enzyme Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZR3 1.35e-10 63 27 2 180 3 pflA Pyruvate formate-lyase-activating enzyme Listeria monocytogenes serotype 4b (strain F2365)
Q71ZR3 6.76e-05 47 41 0 41 3 pflA Pyruvate formate-lyase-activating enzyme Listeria monocytogenes serotype 4b (strain F2365)
P0A443 1.35e-10 63 27 2 180 3 pflA Pyruvate formate-lyase-activating enzyme Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P0A443 6.76e-05 47 41 0 41 3 pflA Pyruvate formate-lyase-activating enzyme Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q85WU9 1.67e-07 51 36 1 57 3 psaC Photosystem I iron-sulfur center Pinus koraiensis
A6H5P3 1.67e-07 51 36 1 57 3 psaC Photosystem I iron-sulfur center Cycas taitungensis
O07112 2.57e-07 50 38 1 57 3 psaC Photosystem I iron-sulfur center Mastigocladus laminosus
Q4G3C1 5.32e-07 50 38 1 57 3 psaC Photosystem I iron-sulfur center Emiliania huxleyi
Q68RV5 5.76e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Panax ginseng
Q0ZIW7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Vitis vinifera
P62094 5.87e-07 50 35 1 57 1 psaC Photosystem I iron-sulfur center Nicotiana tabacum
Q2PMN3 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Glycine max
Q2VEC9 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Solanum tuberosum
Q2MI49 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Solanum lycopersicum
Q2MID6 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Solanum bulbocastanum
A4GYW7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Populus trichocarpa
Q14FA7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Populus alba
Q09FZ5 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Platanus occidentalis
Q06GK6 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Piper cenocladum
Q3BAH7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Phalaenopsis aphrodite subsp. formosana
Q06FQ3 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Pelargonium hortorum
A4QJY3 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Olimarabidopsis pumila
P62093 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Oenothera elata subsp. hookeri
Q6EVZ9 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Nymphaea alba
Q33BX1 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Nicotiana tomentosiformis
Q3C1Q3 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Nicotiana sylvestris
A4QLY6 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Nasturtium officinale
Q09FQ9 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Nandina domestica
Q09WW7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Morus indica
P62092 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Lotus japonicus
A4QLP8 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Lobularia maritima
A4QLG0 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Lepidium virginicum
Q06R79 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Jasminum nudiflorum
A7Y3L3 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Ipomoea purpurea
Q2L956 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Gossypium hirsutum
A0ZZ86 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Gossypium barbadense
Q49KU7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Eucalyptus globulus subsp. globulus
A4QL72 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Draba nemorosa
Q0G9R1 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Daucus carota
A4QKY5 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Crucihimalaya wallichii
A0A386 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Coffea arabica
Q09MC5 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Citrus sinensis
A4QKP6 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Capsella bursa-pastoris
Q7HKX2 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Calycanthus floridus var. glaucus
A6MM88 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Buxus microphylla
A4QKF8 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Barbarea verna
P62091 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Atropa belladonna
P62090 5.87e-07 50 35 1 57 1 psaC Photosystem I iron-sulfur center Arabidopsis thaliana
Q70XW3 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Amborella trichopoda
A4QJQ1 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Aethionema grandiflorum
A4QJG7 5.87e-07 50 35 1 57 3 psaC Photosystem I iron-sulfur center Aethionema cordifolium
P10098 6.04e-07 50 35 1 57 1 psaC Photosystem I iron-sulfur center Spinacia oleracea
P41649 6.04e-07 50 36 1 57 3 psaC Photosystem I iron-sulfur center Pinus thunbergii
Q332S6 6.6e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Lactuca sativa
Q1KXQ4 6.6e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Helianthus annuus
A8W3G7 7e-07 49 32 3 77 3 psaC Photosystem I iron-sulfur center Cuscuta exaltata
Q85AC1 7.07e-07 49 35 1 57 2 psaC Photosystem I iron-sulfur center Anthoceros angustus
P69415 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Triticum aestivum
A1YV30 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Secale cereale
Q6ENP6 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Saccharum officinarum
Q6L3D9 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Saccharum hybrid
A1YV27 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Pseudoroegneria spicata
P51374 7.36e-07 49 36 1 57 3 psaC Photosystem I iron-sulfur center Porphyra purpurea
P0C361 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Oryza sativa subsp. japonica
P0C360 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Oryza sativa subsp. indica
P0C359 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Oryza sativa
Q6ENA6 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Oryza nivara
Q1XDB3 7.36e-07 49 36 1 57 3 psaC Photosystem I iron-sulfur center Neopyropia yezoensis
A8Y9D8 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Lolium perenne
P69416 7.36e-07 49 35 1 57 1 psaC Photosystem I iron-sulfur center Hordeum vulgare
A1EA60 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Agrostis stolonifera
A1YV25 7.36e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Aegilops tauschii
Q1ACE8 7.58e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Chara vulgaris
A4QK71 7.8e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Arabis hirsuta
Q0G9G8 8.2e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Liriodendron tulipifera
A8W3M8 8.44e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Cuscuta obtusiflora
Q3V4Y3 8.44e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Acorus calamus
P31173 8.53e-07 49 36 1 57 1 psaC Photosystem I iron-sulfur center Cyanophora paradoxa
A7M942 8.53e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Cuscuta gronovii
Q5SCZ7 8.61e-07 49 36 1 57 3 psaC Photosystem I iron-sulfur center Huperzia lucidula
A7M9B0 8.95e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Cuscuta reflexa
A1E9X5 9.04e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Sorghum bicolor
A6MMZ6 9.04e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Illicium oligandrum
Q2JNW5 9.26e-07 49 36 1 58 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JWZ0 9.26e-07 49 36 1 58 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain JA-3-3Ab)
A4GGE7 9.59e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Phaseolus vulgaris
P10793 9.59e-07 49 35 1 57 1 psaC Photosystem I iron-sulfur center Pisum sativum
P42046 9.59e-07 49 35 1 57 1 psaC Photosystem I iron-sulfur center Cucumis sativus
Q6YXQ2 9.69e-07 49 35 1 57 1 psaC Photosystem I iron-sulfur center Physcomitrium patens
A6YGC0 9.88e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Pleurastrum terricola
Q20EY7 9.88e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Oltmannsiellopsis viridis
P56301 9.88e-07 49 35 1 57 3 psaC Photosystem I iron-sulfur center Chlorella vulgaris
A6MVS8 1.04e-06 49 36 1 57 1 psaC Photosystem I iron-sulfur center Rhodomonas salina
A6BM25 1.06e-06 49 35 1 57 3 psaC Photosystem I iron-sulfur center Gnetum parvifolium
Q32RM0 1.07e-06 49 35 1 57 3 psaC Photosystem I iron-sulfur center Zygnema circumcarinatum
B2Y205 1.07e-06 49 35 1 57 3 psaC Photosystem I iron-sulfur center Welwitschia mirabilis
P0A411 1.07e-06 49 38 1 57 1 psaC Photosystem I iron-sulfur center Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P0A410 1.07e-06 49 38 1 57 1 psaC Photosystem I iron-sulfur center Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9MRI1 1.07e-06 49 35 1 57 3 psaC Photosystem I iron-sulfur center Gnetum gnemon
Q3ZJ03 1.16e-06 49 36 1 57 3 psaC Photosystem I iron-sulfur center Tupiella akineta
A6MMH6 1.2e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Chloranthus spicatus
Q32S09 1.23e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Staurastrum punctulatum
Q19V62 1.23e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Chlorokybus atmophyticus
O19905 1.24e-06 48 36 2 68 3 psaC Photosystem I iron-sulfur center Cyanidium caldarium
P11601 1.28e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Zea mays
A2T384 1.3e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Angiopteris evecta
Q85FH4 1.3e-06 48 35 1 57 2 psaC Photosystem I iron-sulfur center Adiantum capillus-veneris
Q06GU5 1.41e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Drimys granadensis
B0JJ37 1.54e-06 48 38 1 57 3 psaC Photosystem I iron-sulfur center Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P58870 1.57e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Psilotum nudum
P0A414 1.6e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Nostoc sp. (strain PCC 9229)
P0A413 1.6e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Nostoc sp. (strain PCC 8009)
B2J393 1.6e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P0A412 1.6e-06 48 36 1 57 1 psaC Photosystem I iron-sulfur center Microchaete diplosiphon
O78443 1.68e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Guillardia theta
Q06SI8 1.83e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Stigeoclonium helveticum
Q9TKV9 1.98e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Nephroselmis olivacea
Q6B8M0 2.02e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Gracilaria tenuistipitata var. liui
B1WYT0 2.17e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q0P3P1 2.19e-06 48 35 1 57 1 psaC Photosystem I iron-sulfur center Ostreococcus tauri
Q8M9U0 2.21e-06 48 35 1 57 3 psaC Photosystem I iron-sulfur center Chaetosphaeridium globosum
P0A417 2.39e-06 48 36 1 57 1 psaC Photosystem I iron-sulfur center Thermostichus vulcanus
P0A415 2.39e-06 48 36 1 57 1 psaC Photosystem I iron-sulfur center Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0A416 2.39e-06 48 36 1 57 1 psaC Photosystem I iron-sulfur center Synechococcus elongatus
B8HRC2 2.39e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B0CB42 2.39e-06 48 36 1 57 1 psaC Photosystem I iron-sulfur center Acaryochloris marina (strain MBIC 11017)
P32422 2.49e-06 48 36 1 57 1 psaC Photosystem I iron-sulfur center Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7KFK8 2.49e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Gloeothece citriformis (strain PCC 7424)
Q46IK4 2.59e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain NATL2A)
A2C555 2.59e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain NATL1A)
B7K3K1 2.74e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Rippkaea orientalis (strain PCC 8801 / RF-1)
Q318D4 2.77e-06 48 35 2 68 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9312)
A2CCX5 2.8e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9303)
A6MMR2 2.94e-06 48 33 1 57 3 psaC Photosystem I iron-sulfur center Dioscorea elephantipes
A9BD50 3.03e-06 48 36 1 57 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9211)
Q1KVW1 3.21e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Tetradesmus obliquus
A0T0L2 3.61e-06 47 35 1 57 3 psaC Photosystem I iron-sulfur center Phaeodactylum tricornutum (strain CCAP 1055/1)
Q06J47 3.75e-06 48 41 1 55 3 psaC Photosystem I iron-sulfur center Bigelowiella natans
Q119B1 3.79e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Trichodesmium erythraeum (strain IMS101)
P31087 3.79e-06 47 36 1 57 1 psaC Photosystem I iron-sulfur center Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q00914 4.02e-06 47 35 1 57 1 psaC Photosystem I iron-sulfur center Chlamydomonas reinhardtii
A0T0W4 4.22e-06 47 35 1 57 3 psaC Photosystem I iron-sulfur center Thalassiosira pseudonana
O96804 4.22e-06 47 35 1 57 3 psaC Photosystem I iron-sulfur center Skeletonema costatum
A2BTI9 4.22e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain AS9601)
Q7UZQ1 4.22e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A2BYZ1 4.22e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9515)
A8G7B3 4.22e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9215)
A3PF98 4.22e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9301)
Q0IDV2 4.31e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain CC9311)
A5GI59 4.31e-06 47 35 2 68 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain WH7803)
P31085 4.35e-06 47 36 1 57 1 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31QV2 4.35e-06 47 36 1 57 1 psaC Photosystem I iron-sulfur center Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A8SEF5 4.48e-06 47 34 1 55 3 psaC Photosystem I iron-sulfur center Ceratophyllum demersum
Q3ANC9 4.61e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain CC9605)
Q3B0I2 4.61e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain CC9902)
A5GQ77 4.61e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain RCC307)
P0A419 4.61e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain WH8103)
P0A418 4.61e-06 47 36 1 57 3 psaC Photosystem I iron-sulfur center Parasynechococcus marenigrum (strain WH8102)
P49477 4.77e-06 47 35 1 57 3 psaC Photosystem I iron-sulfur center Trieres chinensis
Q9MUM9 4.99e-06 47 34 1 55 3 psaC Photosystem I iron-sulfur center Mesostigma viride
Q7V9R1 7.46e-06 47 35 1 57 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P31556 9.17e-06 46 32 2 68 3 psaC Photosystem I iron-sulfur center Euglena gracilis
Q08368 1.08e-05 50 40 1 62 1 cdhA1 Acetyl-CoA decarbonylase/synthase complex subunit alpha 1 Methanosarcina thermophila
Q7NG86 1.34e-05 46 35 1 57 1 psaC Photosystem I iron-sulfur center Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7V4J7 2.44e-05 45 35 1 57 3 psaC Photosystem I iron-sulfur center Prochlorococcus marinus (strain MIT 9313)
P00211 2.99e-05 44 38 2 60 1 None Ferredoxin-2 Desulfomicrobium norvegicum (strain DSM 1741 / NCIMB 8310)
Q06439 5.25e-05 44 36 1 57 3 psaC Photosystem I iron-sulfur center Antithamnion sp.
P81292 7.24e-05 45 33 5 87 4 MJ0514.1 Uncharacterized polyferredoxin-like protein MJ0514.1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P06251 0.000113 43 35 1 57 3 psaC Photosystem I iron-sulfur center Marchantia polymorpha
Q85G47 0.000153 43 36 1 57 1 psaC Photosystem I iron-sulfur center Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q89AT9 0.000228 44 28 6 118 3 nuoI NADH-quinone oxidoreductase subunit I Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q49161 0.000374 45 38 1 62 1 cdhA1 Acetyl-CoA decarbonylase/synthase complex subunit alpha 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P08813 0.000378 41 35 2 62 1 DvMF_2120 Ferredoxin-1 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q01700 0.000398 41 38 3 55 3 None Probable ferredoxin Methanosarcina thermophila
P52636 0.000801 44 31 4 88 1 yccM Putative electron transport protein YccM Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13380
Feature type CDS
Gene cutD
Product choline TMA-lyase-activating enzyme
Location 2964242 - 2965192 (strand: -1)
Length 951 (nucleotides) / 316 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_142
Orthogroup size 10
N. genomes 7

Actions

Genomic region

Domains

PF04055 Radical SAM superfamily
PF12838 4Fe-4S dicluster domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1180 Posttranslational modification, protein turnover, chaperones (O) O Pyruvate-formate lyase-activating enzyme

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K20037 choline trimethylamine-lyase activating enzyme [EC:1.97.1.-] - -

Protein Sequence

METAAEIRGRIFNIQKYSIYDGDGIRTLVFLKGCNIRCPWCSNPEGLSSEFQVMYSRDKCVDCGKCVDVCPAGVHYMTTNEQGQQVHRVDRAVDCIGCRKCEEVCLSDALDIMGKDVSVSELMDIIMQDYDFYISSGGGVTIGGGEMSLQTDFAVALLRECKKMMINTAVETQATTNVANYEKLAQVVDQFLIDIKHIDTTQHKALFGIGNENVRRNLERLMDLGANVVIRMPLVRGYNDSYDAITGAINYAMALSKRGNLQRIDILPYHQFGRNKYQKLEMIYPIKNDPGYTPEELDRLEAFFKQFDFEIRLVRH

Flanking regions ( +/- flanking 50bp)

ATGTAAATTTATCGAACAAGGATGTTTGATGCAGATTTGGAGGCGTAAAGATGGAGACGGCAGCAGAAATAAGAGGGCGGATATTTAATATCCAAAAATACTCTATTTATGATGGTGATGGTATTCGTACTCTGGTTTTCTTAAAAGGCTGTAATATCCGCTGCCCTTGGTGTTCAAACCCAGAAGGTCTTAGCAGTGAATTTCAGGTGATGTACTCTCGCGATAAATGCGTGGATTGCGGTAAATGTGTTGATGTGTGTCCGGCAGGTGTGCATTACATGACAACCAATGAGCAAGGGCAGCAAGTTCATCGCGTTGATCGTGCCGTTGATTGTATTGGATGCCGTAAATGTGAAGAAGTGTGTCTTTCTGATGCACTGGATATTATGGGTAAAGATGTCTCTGTATCTGAATTGATGGACATTATCATGCAAGATTACGACTTCTATATCTCTTCCGGCGGTGGTGTCACAATCGGTGGCGGCGAAATGAGTTTACAAACGGATTTTGCTGTAGCTCTGCTACGTGAATGTAAAAAGATGATGATCAATACCGCGGTGGAAACACAAGCAACCACTAATGTGGCTAATTATGAAAAATTAGCGCAAGTCGTTGATCAGTTTCTAATTGATATCAAACACATTGATACTACTCAGCATAAAGCATTATTTGGCATTGGTAATGAGAATGTCCGCCGTAATTTAGAGCGTTTGATGGATCTCGGTGCAAATGTGGTTATCCGTATGCCTTTAGTGCGAGGTTATAACGACTCTTATGATGCGATTACTGGTGCGATTAACTACGCCATGGCGTTGTCAAAACGCGGTAATCTTCAGCGCATCGATATTCTACCTTATCACCAATTTGGCCGTAATAAATACCAAAAATTGGAGATGATCTACCCCATTAAAAACGATCCGGGATATACGCCAGAAGAGCTCGATCGCTTAGAAGCCTTCTTTAAACAATTTGATTTTGAGATCCGTCTTGTCCGCCACTAATCAGTAGGAGAGAAAGATGAACAGTTTAGGTGTGATTGAAACACGCGGAT