Homologs in group_793

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03720 FBDBKF_03720 76.8 Morganella morganii S1 - hydrogenase 4 subunit F
EHELCC_06815 EHELCC_06815 76.8 Morganella morganii S2 - hydrogenase 4 subunit F
NLDBIP_07140 NLDBIP_07140 76.8 Morganella morganii S4 - hydrogenase 4 subunit F
LHKJJB_06675 LHKJJB_06675 76.8 Morganella morganii S3 - hydrogenase 4 subunit F
HKOGLL_04255 HKOGLL_04255 76.8 Morganella morganii S5 - hydrogenase 4 subunit F
F4V73_RS11150 F4V73_RS11150 77.5 Morganella psychrotolerans - hydrogenase 4 subunit F

Distribution of the homologs in the orthogroup group_793

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_793

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77437 0.0 672 70 2 496 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
A9QPJ1 1.96e-87 280 39 3 421 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
P23482 1.19e-39 156 32 7 351 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
Q8CPU8 8.64e-38 151 28 16 534 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 8.64e-38 151 28 16 534 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9K2S2 6.32e-37 149 29 11 443 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q9RGZ5 1.15e-34 142 30 10 439 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
B1I6I5 1.41e-34 139 30 5 346 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q4L4W7 9.34e-34 139 28 16 510 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q9PMA7 4.17e-33 136 29 13 405 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2YWT4 7.54e-33 136 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P60675 1.77e-32 135 30 13 420 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 1.77e-32 135 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 1.77e-32 135 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 1.77e-32 135 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 1.77e-32 135 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9ZNG6 1.96e-32 135 28 16 511 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q8NXF6 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 3.28e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q52978 4.23e-32 134 28 12 447 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
A1XG02 5.1e-32 134 30 12 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q6GID6 6.08e-32 134 30 13 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q49W91 1.63e-31 132 27 16 488 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B1X491 3.81e-31 131 29 11 355 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
B1NWJ6 6.84e-31 130 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
Q9JX92 7.6e-31 130 27 10 357 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K1B0 1.06e-30 129 27 10 357 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
F1SVK0 1.25e-30 129 29 17 462 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q06GK2 1.91e-30 129 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q6EW03 2.73e-30 129 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
P31971 2.8e-30 128 30 11 350 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P9WIW1 5.64e-30 127 30 11 359 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 5.64e-30 127 30 11 359 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q32S06 7.01e-30 127 30 11 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
A9L9E4 1.13e-29 127 30 10 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
A9LYE7 1.39e-29 126 29 11 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q3V4Y7 1.45e-29 126 29 11 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
Q31952 1.53e-29 126 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q8W8H5 1.76e-29 126 27 18 476 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q49VG9 2.16e-29 126 30 12 357 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q32880 2.47e-29 125 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
P06265 3.07e-29 125 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q3C1N9 3.15e-29 125 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q859V1 3.27e-29 125 29 10 364 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q0ZIX1 3.82e-29 125 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
A6H5N8 4.83e-29 125 29 12 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P0C328 4.87e-29 125 28 13 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 4.87e-29 125 28 13 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 4.87e-29 125 28 13 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 4.87e-29 125 28 13 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
P9WIW3 5.12e-29 124 32 9 354 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 5.12e-29 124 32 9 354 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2QD43 5.29e-29 125 29 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q68RV9 5.32e-29 125 30 12 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q49KV1 5.79e-29 124 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q33BX5 6.91e-29 124 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q32440 7.63e-29 124 28 13 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
A1EA56 8.75e-29 124 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q55429 9.46e-29 124 29 10 348 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q32516 1.08e-28 124 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q34879 1.1e-28 123 28 12 345 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
A8Y9D4 1.39e-28 123 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
B1A981 1.41e-28 123 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q2MIE0 1.56e-28 123 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q70XW6 1.57e-28 123 30 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
Q95H46 2.04e-28 123 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
Q8CQ50 2.07e-28 123 27 10 385 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B0Z5H4 2.2e-28 123 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 2.2e-28 123 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 2.2e-28 123 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 2.2e-28 123 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q5HRB2 2.25e-28 123 27 10 385 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2VED3 2.43e-28 123 30 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q9MTI4 2.61e-28 123 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
P46620 3.46e-28 122 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
P33607 3.47e-28 122 27 18 511 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q33113 3.6e-28 122 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
F1SVL2 3.65e-28 120 28 11 448 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q2PMM9 3.94e-28 122 30 12 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
A0A382 4.04e-28 122 28 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
B3TN96 4.36e-28 122 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q6GJ47 4.45e-28 122 28 15 443 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
A2T379 4.77e-28 122 30 12 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
A0ZZ82 5.13e-28 122 30 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q09FZ9 5.25e-28 122 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q09MC9 5.45e-28 122 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
Q33066 5.5e-28 122 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q6L3E3 5.6e-28 122 29 11 349 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q6ENQ0 5.86e-28 122 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
P51099 6.14e-28 121 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q2L960 6.21e-28 121 30 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q4L443 6.63e-28 121 29 18 467 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
A6QCE9 9.04e-28 119 28 9 336 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurovum sp. (strain NBC37-1)
Q96069 9.37e-28 120 28 13 371 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q06FL7 9.68e-28 121 29 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
Q32RH9 1.09e-27 120 29 10 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q06R83 1.23e-27 120 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q32131 1.35e-27 120 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
A6MM84 1.5e-27 120 30 12 381 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
P06264 1.72e-27 120 30 12 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q8NXT2 1.77e-27 120 28 12 369 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 1.77e-27 120 28 12 369 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
A4QLP4 1.97e-27 120 30 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
P15958 2.03e-27 120 30 14 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
P51097 2.03e-27 120 30 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q02CT1 2.08e-27 118 28 8 360 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
B1VKJ3 2.22e-27 120 28 10 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q0Q2K0 2.34e-27 120 28 13 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 2.34e-27 120 28 13 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 2.34e-27 120 28 13 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 2.34e-27 120 28 13 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 2.34e-27 120 28 13 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 2.34e-27 120 28 13 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q8S8V0 2.52e-27 120 29 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q9TLC2 2.68e-27 119 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
Q32539 2.98e-27 119 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q8M9U5 3.49e-27 119 30 12 386 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q99VZ2 4.82e-27 119 28 12 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 4.82e-27 119 28 12 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 4.82e-27 119 28 12 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 4.82e-27 119 28 12 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 4.82e-27 119 28 12 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q09FR3 5.17e-27 119 30 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q32384 5.73e-27 119 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
A6MMI0 6.34e-27 118 29 10 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
Q31849 6.74e-27 118 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51095 6.75e-27 118 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
P51098 7.56e-27 118 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
B5LMS9 7.6e-27 118 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
P77416 7.63e-27 117 27 9 392 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
A4GGE3 7.67e-27 118 29 15 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q32091 7.72e-27 118 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q32238 9.14e-27 118 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
P51100 9.53e-27 118 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q85FH9 9.99e-27 118 30 9 350 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q9I0J1 1.06e-26 117 28 14 434 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P51096 1.15e-26 117 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q9MVL6 1.15e-26 117 29 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
A1XGU4 1.18e-26 117 29 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
O78756 1.19e-26 117 28 10 341 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
Q32551 1.32e-26 117 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q576B4 1.33e-26 117 28 10 342 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
Q2YST2 1.52e-26 117 29 14 374 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q32126 1.57e-26 117 29 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q7NP39 1.73e-26 116 27 8 380 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q06GU9 1.8e-26 117 30 12 383 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
Q0G9H2 1.85e-26 117 29 11 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
A4GYW4 1.96e-26 117 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q85T01 2.02e-26 117 27 13 420 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q7YJT6 2.05e-26 117 31 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
Q14FB0 2.77e-26 116 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
Q32007 2.86e-26 116 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q9MVK2 2.91e-26 116 28 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q6YXQ6 2.94e-26 116 28 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
P03920 3.23e-26 116 26 10 364 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
P29924 3.29e-26 116 28 15 420 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
Q1ACF3 3.34e-26 116 26 18 515 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q9ZCG1 3.49e-26 116 26 16 454 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q9TL56 4.31e-26 116 29 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
B2XWI8 4.78e-26 115 29 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
A4QLF6 4.96e-26 115 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
B3QY38 5.65e-26 114 30 7 329 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A4QJX9 5.89e-26 115 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q9MUK8 5.91e-26 115 29 14 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
A4QKF4 6.69e-26 115 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
A6MMZ2 7.7e-26 115 29 10 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q0G9R5 7.88e-26 115 29 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q9TKV7 8.03e-26 115 28 12 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
P56752 8.46e-26 115 29 12 349 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
A8SEF0 9.02e-26 115 27 13 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
B2LMQ1 9.36e-26 115 29 12 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q92G96 1.18e-25 113 27 3 280 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9TLA3 1.63e-25 114 28 13 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
P50939 1.69e-25 114 29 12 344 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q6ANN6 1.7e-25 112 27 7 390 3 nuoN NADH-quinone oxidoreductase subunit N Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9BBP6 1.86e-25 114 28 12 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q35648 2.14e-25 113 29 13 323 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
A4QKP2 2.66e-25 113 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
Q76LN2 2.83e-25 113 29 10 305 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
P03917 3.05e-25 113 28 13 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
A8LC88 6.11e-25 111 27 8 380 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
Q95885 6.15e-25 112 27 10 347 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
Q1DDD3 6.27e-25 111 27 10 416 3 nuoN NADH-quinone oxidoreductase subunit N Myxococcus xanthus (strain DK1622)
P48920 6.36e-25 112 29 12 347 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
A7Y3K7 6.47e-25 112 28 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
A4QKY1 6.56e-25 112 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
P24978 7.07e-25 112 25 8 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
A4QL68 7.31e-25 112 28 13 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
A6MMR6 8.14e-25 112 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
A4QJG3 9.15e-25 112 29 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
Q9ZZY1 9.38e-25 111 26 10 342 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q09WX1 1e-24 112 29 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q2JTD6 1.02e-24 111 28 11 372 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
Q6QU67 1.77e-24 110 24 14 440 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
O79437 1.78e-24 110 26 9 363 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
P03916 1.8e-24 110 29 13 323 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
Q8YZV7 1.89e-24 110 27 7 352 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2JK43 1.98e-24 110 27 10 383 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q3M9C7 2.07e-24 110 29 5 307 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P41299 2.39e-24 110 25 8 347 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
P0AFE8 2.41e-24 109 26 12 413 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 2.41e-24 109 26 12 413 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
P50365 2.45e-24 110 28 13 351 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q92G97 2.69e-24 110 25 14 431 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B1XJL9 2.93e-24 109 37 2 194 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
O03205 3.14e-24 110 28 13 346 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
A4QLY2 3.47e-24 110 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
Q9TDR1 3.53e-24 109 27 11 329 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
A4QJP7 3.76e-24 110 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q7VE41 3.81e-24 109 29 8 354 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q2JWW3 4.06e-24 109 27 7 396 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
Q9ZCG0 4.53e-24 108 27 3 291 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q4UK26 5.38e-24 108 26 3 291 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
O63908 6.31e-24 108 27 9 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
B0JS85 6.95e-24 108 37 2 189 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q1RKE6 7.13e-24 108 26 11 355 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q1IS45 8.4e-24 107 28 10 363 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Koribacter versatilis (strain Ellin345)
P26849 9.26e-24 108 27 12 363 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
A5GP41 1.06e-23 108 27 10 412 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A4QK67 1.1e-23 108 28 14 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
P9WIW5 1.42e-23 107 27 11 386 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 1.42e-23 107 27 11 386 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q01561 1.77e-23 107 25 9 362 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
Q9M3J4 1.85e-23 108 27 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
P72823 2.04e-23 107 31 7 303 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P50367 2.29e-23 107 25 13 422 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
Q68VV7 2.32e-23 107 27 11 354 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P29925 2.66e-23 106 25 13 522 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q9I0J0 2.87e-23 106 26 11 393 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q68VV6 3.28e-23 106 27 3 280 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P03919 3.28e-23 107 26 11 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
P60687 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 3.3e-23 106 25 11 479 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 3.3e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
O21335 3.35e-23 107 27 12 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
A8Z056 3.59e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 3.59e-23 106 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q5SCZ9 3.65e-23 107 28 12 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
O47815 3.67e-23 106 28 10 321 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
Q8W9M6 3.72e-23 106 27 11 346 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q9XAR5 3.82e-23 107 28 9 348 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1RKE5 3.87e-23 105 26 3 280 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
P48921 4.18e-23 106 29 11 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
Q8SHP7 4.31e-23 106 25 8 353 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
O05229 4.37e-23 105 25 5 383 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
Q5N5W1 4.44e-23 106 28 4 285 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 4.44e-23 106 28 4 285 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5HHD6 4.52e-23 105 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
P50974 4.84e-23 105 27 12 384 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
Q6V9D9 5.38e-23 106 25 13 419 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
P92485 5.39e-23 106 29 10 309 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
Q6GID9 6.58e-23 105 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q31D31 6.99e-23 105 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
Q19V60 7.32e-23 105 27 12 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
F1SVH9 7.34e-23 105 27 12 364 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q2YWT7 7.35e-23 105 25 11 479 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P03915 9.18e-23 105 27 12 344 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
Q953I4 9.18e-23 105 25 14 425 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
Q2RJT7 1.32e-22 104 24 11 429 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P11661 1.4e-22 105 28 11 346 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
Q8DHX4 1.62e-22 104 29 5 305 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A9BD08 1.88e-22 104 30 5 315 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
A2BNU4 1.9e-22 104 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
A8G2F5 1.99e-22 104 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
A1AVS5 2.09e-22 103 23 10 424 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
P11628 2.14e-22 104 24 16 447 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q46HM4 2.35e-22 103 28 3 284 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
Q3AGZ9 2.36e-22 103 29 4 286 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
P48656 2.42e-22 104 28 10 309 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
P05510 3.07e-22 104 26 9 341 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A5GQH5 3.2e-22 103 26 9 399 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
A3PAL7 3.71e-22 103 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
Q9RGZ2 3.99e-22 102 24 7 371 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q37680 4.46e-22 103 28 12 365 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
Q7V3C8 4.85e-22 103 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q34313 5.19e-22 103 27 12 355 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
A2CD41 5.44e-22 103 28 5 334 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q3ASV8 6.4e-22 102 27 10 395 3 nuoN NADH-quinone oxidoreductase subunit N Chlorobium chlorochromatii (strain CaD3)
P50366 7.15e-22 103 27 12 369 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q7V4E4 7.26e-22 102 28 5 334 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
P38602 8.26e-22 102 27 9 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
P16429 8.31e-22 102 28 9 351 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
Q0H8X0 9.03e-22 102 26 9 347 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
Q00542 9.2e-22 102 27 9 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
Q2LCP6 9.43e-22 102 27 12 355 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q7U413 9.48e-22 102 29 4 286 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q7MA37 1.07e-21 101 25 6 325 3 nuoN NADH-quinone oxidoreductase subunit N Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B9KDV9 1.11e-21 101 25 8 375 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q8W9M7 1.17e-21 101 26 8 383 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dugong dugon
A2BUC6 1.2e-21 102 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
A2BZX6 1.21e-21 101 28 3 284 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
C1AZG0 1.29e-21 101 29 9 325 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
Q4UK27 1.37e-21 102 25 15 432 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A4J650 1.81e-21 100 25 9 426 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q31HE7 1.9e-21 100 25 8 337 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5HSM5 2.03e-21 100 29 9 321 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter jejuni (strain RM1221)
Q7VFT5 2.27e-21 100 26 8 339 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter hepaticus (strain ATCC 51449 / 3B1)
P32421 2.36e-21 100 27 9 346 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P57262 2.62e-21 101 25 14 423 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O78688 2.81e-21 100 29 12 320 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q37372 3.03e-21 101 29 11 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
Q9ZZM3 3.06e-21 100 28 11 320 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
Q9TA19 3.6e-21 100 27 10 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
Q8HHD2 3.92e-21 100 26 12 363 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q1HK80 4.05e-21 100 27 9 321 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q9ZZ57 4.12e-21 100 27 9 321 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
P03921 4.25e-21 100 27 11 344 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
A7ZBF3 4.44e-21 99 23 6 322 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter concisus (strain 13826)
P20679 4.66e-21 100 25 10 354 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q2I3G4 4.98e-21 100 27 10 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
Q0I6X0 5.83e-21 99 29 5 290 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
Q3B063 6.79e-21 99 29 4 286 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
P29388 7.18e-21 99 27 12 365 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
Q30PJ2 7.57e-21 99 26 7 324 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P92699 8.3e-21 99 25 15 425 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
Q38PR2 8.38e-21 99 27 10 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
A6LXP5 8.5e-21 98 22 11 463 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A1SE40 8.54e-21 99 25 12 422 3 nuoN NADH-quinone oxidoreductase subunit N Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q35099 1.1e-20 99 27 11 344 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
P41309 1.39e-20 99 25 9 323 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q10ZG8 1.64e-20 98 36 2 187 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
B0C4B4 1.66e-20 98 28 12 426 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
A7HY36 1.71e-20 97 25 5 295 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q7N2J9 1.74e-20 97 24 13 464 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1WXV4 1.91e-20 97 27 8 297 3 nuoN NADH-quinone oxidoreductase subunit N Halorhodospira halophila (strain DSM 244 / SL1)
P9WIW9 2.09e-20 97 25 8 380 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 2.09e-20 97 25 8 380 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q83BR8 2.09e-20 97 26 8 373 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5N060 2.38e-20 97 26 5 349 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 2.38e-20 97 26 5 349 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2JPJ1 2.47e-20 97 30 4 252 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
B4EZ47 2.54e-20 97 27 13 473 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
P9WIW8 2.79e-20 97 25 8 380 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8YM86 2.83e-20 97 33 2 187 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MAR0 3.14e-20 97 33 2 187 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q94RJ2 3.75e-20 97 25 10 337 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
B1XHP2 3.8e-20 97 30 5 279 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P03918 3.98e-20 97 25 13 399 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
Q67KP6 4.29e-20 97 27 9 358 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B7K1G4 6.13e-20 96 26 8 382 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
B9LGS9 6.19e-20 96 26 8 356 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
Q9MIY0 6.21e-20 96 28 10 308 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
Q95918 6.54e-20 96 26 13 369 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
B0JPG4 6.63e-20 96 26 7 344 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P48176 9.16e-20 96 28 11 320 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
Q5HQL3 1.03e-19 95 25 4 335 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q0C1D1 1.04e-19 95 25 5 349 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
A7HZW1 1.2e-19 95 25 6 301 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q8CPV1 1.25e-19 95 25 4 335 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5ZNA1 1.32e-19 95 31 1 199 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Zaglossus bruijni
O03174 1.57e-19 95 27 12 311 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
Q58705 1.77e-19 94 26 5 289 4 MJ1309 Uncharacterized protein MJ1309 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P92669 1.81e-19 95 26 11 330 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q19V61 1.88e-19 95 29 8 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
P55782 2.03e-19 95 27 9 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
C4LB43 2.16e-19 94 30 8 309 3 nuoN NADH-quinone oxidoreductase subunit N Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q118H6 2.29e-19 94 25 6 333 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
P26848 2.43e-19 94 24 11 371 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
A9B6Y0 2.56e-19 94 27 8 314 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
C1F9D0 2.71e-19 94 29 9 362 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
O79411 2.77e-19 94 28 12 320 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
A2T383 2.86e-19 94 26 6 353 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
P24979 2.99e-19 94 29 11 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
P56911 2.99e-19 94 26 11 403 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Rhizobium meliloti (strain 1021)
Q591M5 3.28e-19 94 23 7 384 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus simmonsi
Q81K10 3.64e-19 94 26 4 323 3 nuoN NADH-quinone oxidoreductase subunit N Bacillus anthracis
Q9MIY1 4.07e-19 93 31 4 215 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Danio rerio
P06263 4.22e-19 94 29 6 285 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
Q56227 4.96e-19 94 27 12 326 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q36458 5.39e-19 93 30 1 199 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ornithorhynchus anatinus
Q64Y15 5.65e-19 93 24 5 317 3 nuoN NADH-quinone oxidoreductase subunit N Bacteroides fragilis (strain YCH46)
O79678 5.97e-19 94 26 10 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
A8M609 5.98e-19 93 27 9 379 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
O67391 6.07e-19 93 26 8 335 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Aquifex aeolicus (strain VF5)
Q3MCB9 6.17e-19 93 28 6 283 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A0KJ55 6.55e-19 93 29 13 376 3 nuoN NADH-quinone oxidoreductase subunit N Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9I0I9 6.57e-19 93 27 6 344 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4JQH7 6.74e-19 93 27 10 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
Q8YQ78 9.07e-19 92 27 6 283 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q37376 9.22e-19 92 26 11 358 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Acanthamoeba castellanii
Q92QN9 9.32e-19 92 27 14 407 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Rhizobium meliloti (strain 1021)
O79555 1.01e-18 92 25 6 351 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lycodon semicarinatus
Q9ZZ44 1.09e-18 92 27 10 319 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
A0LJL8 1.14e-18 92 25 8 395 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
P11993 1.29e-18 92 26 11 348 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q2K9R9 1.38e-18 92 26 9 355 3 nuoN NADH-quinone oxidoreductase subunit N Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P18940 1.49e-18 92 30 12 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q9B8C9 1.7e-18 92 24 9 346 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q95917 2.29e-18 91 31 6 263 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Polypterus ornatipinnis
Q85FH5 2.38e-18 91 26 5 298 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q9ZZM4 2.54e-18 91 26 6 330 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Salmo salar
Q9TKV8 2.54e-18 91 28 5 297 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
Q8W9G4 2.72e-18 90 32 2 207 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Tachyglossus aculeatus aculeatus
P10330 2.74e-18 92 28 14 365 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
C5D978 2.86e-18 91 27 7 324 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
O78687 3.02e-18 90 30 5 248 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Carassius auratus
P55781 3.1e-18 90 33 2 187 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gadus morhua
Q9B6D3 3.34e-18 91 24 13 411 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q35543 3.61e-18 91 26 12 348 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
Q32RL9 3.69e-18 90 29 5 282 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
Q32S08 3.69e-18 90 26 12 430 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
P11631 3.82e-18 90 26 4 292 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oncorhynchus mykiss
A7Y3L2 4.04e-18 90 27 5 290 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
Q8K9X7 4.47e-18 91 26 10 324 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B7GME1 4.56e-18 90 28 9 357 3 nuoN NADH-quinone oxidoreductase subunit N Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A4XV14 4.57e-18 90 28 6 349 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas mendocina (strain ymp)
B5YKJ2 4.69e-18 90 26 11 352 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q3AC87 4.98e-18 90 25 11 394 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8DKY0 5.42e-18 90 24 5 332 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9RUA0 5.56e-18 90 27 7 332 3 nuoN NADH-quinone oxidoreductase subunit N Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q1ACE9 5.79e-18 90 27 7 326 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
Q9MUM8 6.6e-18 90 29 5 280 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
P50368 6.92e-18 90 26 10 337 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
P34195 7.7e-18 90 27 10 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
P34194 7.8e-18 89 31 2 185 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Formosania lacustris
P48915 8.88e-18 89 24 8 316 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
Q37617 1e-17 89 25 7 310 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q36459 1.05e-17 89 26 12 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
P93313 1.12e-17 89 26 8 305 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
Q8DMR6 1.16e-17 89 27 6 317 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B3DZT0 1.21e-17 89 26 14 425 3 nuoN NADH-quinone oxidoreductase subunit N Methylacidiphilum infernorum (isolate V4)
Q47LF7 1.27e-17 89 29 10 385 3 nuoN NADH-quinone oxidoreductase subunit N Thermobifida fusca (strain YX)
Q5GS15 1.58e-17 88 25 11 361 3 nuoN NADH-quinone oxidoreductase subunit N Wolbachia sp. subsp. Brugia malayi (strain TRS)
P03911 1.7e-17 88 29 2 204 1 Mtnd4 NADH-ubiquinone oxidoreductase chain 4 Mus musculus
Q591Y7 1.73e-17 88 23 7 384 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus sambiranensis
O79410 1.74e-17 88 25 7 347 3 MTND4 NADH-ubiquinone oxidoreductase chain 4 Scyliorhinus canicula
B1MAF7 1.78e-17 89 24 8 404 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q8KX53 2.07e-17 88 25 9 356 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A0LEQ8 2.31e-17 88 26 14 378 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
P15584 2.45e-17 88 26 13 348 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
O79436 2.46e-17 88 29 3 217 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oryctolagus cuniculus
P12776 2.49e-17 89 32 6 196 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
A8GH04 2.55e-17 88 27 12 383 3 nuoN NADH-quinone oxidoreductase subunit N Serratia proteamaculans (strain 568)
Q0APX7 2.63e-17 88 26 8 328 3 nuoN NADH-quinone oxidoreductase subunit N Maricaulis maris (strain MCS10)
Q8M9U1 2.68e-17 88 28 7 294 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
O67342 2.79e-17 87 27 9 341 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
O47497 2.92e-17 88 26 5 283 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
A5FXI8 3.6e-17 87 31 8 285 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Acidiphilium cryptum (strain JF-5)
Q9MUQ6 3.71e-17 87 27 8 354 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
B1JGM5 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669B2 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM24 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis (strain Pestoides F)
Q1CHR3 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6K9 3.92e-17 87 27 11 381 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Angola)
Q7CJ84 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis
B2K809 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6C1 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGR6 3.92e-17 87 27 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8KX56 4e-17 87 27 6 292 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
O79556 4.04e-17 88 26 10 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
B1WUS5 4.46e-17 87 26 8 378 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2I3G5 4.54e-17 87 23 7 348 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Elephas maximus
Q5N5T8 4.79e-17 87 26 6 321 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 4.79e-17 87 26 6 321 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B2TW57 5.32e-17 87 29 8 303 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
O21047 5.75e-17 87 27 7 306 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
Q3JC27 5.77e-17 87 29 12 371 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1VKI4 6.11e-17 87 27 5 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cryptomeria japonica
Q38PR3 6.44e-17 86 24 7 344 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Mammuthus primigenius
Q2I3F2 6.75e-17 86 27 4 241 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Loxodonta africana
Q8MA16 7.01e-17 87 27 8 310 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chaetosphaeridium globosum
B7MXV5 7.09e-17 87 28 8 303 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O81 (strain ED1a)
O21334 7.19e-17 86 23 5 351 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dasypus novemcinctus
A9MJA9 7.62e-17 86 28 9 304 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O78755 7.66e-17 86 23 6 333 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ovis aries
Q89AT5 7.82e-17 86 27 5 246 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P27572 7.93e-17 86 26 11 343 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
B2J565 8e-17 87 27 8 324 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P48919 8.56e-17 87 25 11 349 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
O79881 9.42e-17 86 25 7 354 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Sus scrofa
B1W506 9.67e-17 86 28 7 324 3 nuoN3 NADH-quinone oxidoreductase subunit N 3 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q85DA7 9.68e-17 86 24 7 330 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lepilemur septentrionalis
Q0TFH0 9.7e-17 86 28 8 303 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q96068 9.94e-17 86 28 3 223 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Rhinoceros unicornis
P48916 9.94e-17 86 31 3 204 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Felis catus
Q1LTA1 1.01e-16 86 26 11 366 3 nuoN NADH-quinone oxidoreductase subunit N Baumannia cicadellinicola subsp. Homalodisca coagulata
Q1R9E1 1.02e-16 86 28 8 303 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain UTI89 / UPEC)
Q8FFK3 1.02e-16 86 28 8 303 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ADC4 1.02e-16 86 28 8 303 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O1:K1 / APEC
B4U8I1 1.05e-16 86 26 13 374 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Hydrogenobaculum sp. (strain Y04AAS1)
Q492I8 1.07e-16 86 25 5 327 3 nuoN NADH-quinone oxidoreductase subunit N Blochmanniella pennsylvanica (strain BPEN)
Q598S9 1.09e-16 86 25 3 288 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Caperea marginata
Q17Z65 1.11e-16 86 25 12 399 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter acinonychis (strain Sheeba)
P15552 1.13e-16 86 34 5 165 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
Q57M40 1.25e-16 86 28 9 302 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella choleraesuis (strain SC-B67)
Q5SCY2 1.25e-16 86 27 8 299 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
Q32905 1.33e-16 79 37 3 127 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
B0JHK5 1.38e-16 86 26 7 322 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12475
Feature type CDS
Gene -
Product hydrogenase 4 subunit F
Location 2765532 - 2767100 (strand: -1)
Length 1569 (nucleotides) / 522 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_793
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0651 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)		 CP Formate hydrogenlyase subunit 3/Multisubunit Na+/H+ antiporter, MnhD subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12141 hydrogenase-4 component F [EC:1.-.-.-] - -

Protein Sequence

MNQTTMLTILMFAPLVFSILAFLSPLLKAAARPIVTGIHTIGIFVLVIAALGTVADVMSHGEILAAAKWVHVDSLGALFLAILGIIGFLTGLYSIGYMNHEVDEGEISVRTLCNYYGFFHLFLFTMLLAITSNNLILMWAAIEATTLSSAFLVGIYGQRSSLEAAWKYIIICSVGVAFGLFGTILVYANAASFMPDPDQAIFWTEVLKYTHQLDPTLMHLAFVFILIGFGTKTGLFPMHAWLPDAHSEAPSPVSALLSAVLLNCALLIIIRYYIIIDAAIGTEFTRNLLLIFGFLSVAIAAFFILIQRDMKRLLAYSSVENMGLIAVALGIGGPIGILAALFHTLNHSLAKALLFCGSGNVLLKYGTRDLNVVKGMFKVMPLSAALFAGGALALGGMPPFNVFISEFMIVVAGLAAKHMGLTILLLLLLTVVLGGLVRMVAKTVFGPKPDVVAKGELGLLTTLPMIILIALMLLMGTHIPKPVSELLENAANIVMNIDESGSPNYTWPTTLISNPSISVQEK

Flanking regions ( +/- flanking 50bp)

GCTCAACACACTGAACGTGGATCAACTGACCGCGCTGAAGGGGTGAGGAGATGAATCAAACAACCATGTTAACAATCTTAATGTTTGCACCGCTGGTATTTTCGATATTGGCATTTTTAAGCCCATTATTGAAAGCAGCGGCACGTCCTATCGTTACAGGCATTCATACTATAGGTATTTTTGTCTTAGTCATTGCCGCGTTAGGCACTGTTGCTGATGTGATGTCCCATGGCGAAATACTGGCGGCAGCGAAATGGGTTCATGTTGATAGTTTAGGGGCACTATTTCTAGCCATTTTAGGCATCATTGGTTTTTTAACCGGCCTGTATTCTATTGGTTATATGAATCATGAAGTGGATGAGGGCGAAATTTCTGTTCGTACTTTATGTAACTACTATGGTTTCTTCCACCTCTTCCTTTTCACCATGTTATTAGCGATCACCAGTAATAACTTGATCTTGATGTGGGCCGCGATTGAAGCCACAACATTAAGCTCTGCTTTTTTAGTAGGGATTTATGGTCAACGCTCTTCATTAGAAGCTGCATGGAAGTACATTATTATCTGTAGTGTCGGTGTCGCATTTGGTCTTTTTGGCACAATTTTAGTTTATGCCAATGCAGCAAGCTTTATGCCTGATCCTGATCAGGCCATCTTCTGGACAGAAGTGTTGAAATATACACATCAGTTAGATCCAACACTGATGCATTTAGCTTTTGTATTTATTTTGATCGGTTTCGGTACCAAAACCGGGTTATTCCCAATGCATGCATGGTTACCAGATGCTCACAGTGAAGCGCCAAGCCCTGTTAGTGCGCTGTTATCTGCGGTGTTATTAAACTGTGCGCTGTTAATCATTATTCGTTACTACATTATTATTGATGCAGCAATAGGCACTGAATTCACTCGTAACCTATTGTTAATCTTTGGCTTCCTCTCTGTTGCTATCGCCGCGTTCTTTATTCTGATCCAGCGCGATATGAAACGCTTATTAGCGTACTCCAGTGTGGAAAACATGGGGTTAATTGCAGTGGCTCTGGGTATTGGTGGCCCGATTGGGATTTTGGCGGCTTTATTCCACACGTTAAACCACAGCTTAGCAAAAGCATTGCTGTTCTGCGGCTCTGGTAACGTGTTACTGAAATACGGTACACGGGATCTAAATGTCGTGAAAGGTATGTTTAAAGTAATGCCATTAAGTGCTGCATTATTTGCTGGCGGTGCTTTGGCATTAGGGGGCATGCCACCATTTAATGTCTTTATCAGTGAATTTATGATTGTTGTTGCAGGCTTAGCAGCTAAGCATATGGGATTAACAATTCTATTATTATTGTTATTAACCGTAGTATTAGGTGGATTAGTTCGTATGGTAGCTAAAACGGTATTTGGTCCAAAACCGGATGTGGTTGCCAAAGGTGAATTAGGTCTGTTAACCACACTACCGATGATCATTTTGATTGCGCTTATGTTGTTAATGGGAACACATATTCCTAAGCCAGTCAGTGAGTTATTGGAGAACGCAGCCAATATCGTGATGAATATCGATGAGAGTGGATCACCAAATTATACATGGCCAACAACGTTAATCAGCAATCCATCAATATCGGTTCAGGAGAAGTAACGTGAGCTATCAAAATTATGTCAGTAGAAAAGAGGGAAACGAACTCGGTG