Homologs in group_862

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03720 FBDBKF_03720 100.0 Morganella morganii S1 - hydrogenase 4 subunit F
NLDBIP_07140 NLDBIP_07140 100.0 Morganella morganii S4 - hydrogenase 4 subunit F
LHKJJB_06675 LHKJJB_06675 100.0 Morganella morganii S3 - hydrogenase 4 subunit F
HKOGLL_04255 HKOGLL_04255 100.0 Morganella morganii S5 - hydrogenase 4 subunit F
F4V73_RS11150 F4V73_RS11150 95.2 Morganella psychrotolerans - hydrogenase 4 subunit F
PMI_RS12475 PMI_RS12475 76.8 Proteus mirabilis HI4320 - hydrogenase 4 subunit F

Distribution of the homologs in the orthogroup group_862

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_862

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77437 0.0 708 71 2 506 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
A9QPJ1 5.81e-89 284 37 5 452 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
P23482 8.86e-39 153 30 7 353 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
B1I6I5 7.2e-37 145 30 9 391 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q4L4W7 5.14e-35 143 31 14 438 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
P9WIW3 3.54e-33 137 35 12 365 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 3.54e-33 137 35 12 365 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q49VG9 4.08e-33 137 30 17 448 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q52978 6.8e-33 137 29 10 454 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
Q2YWT4 8.19e-33 136 31 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CPU8 1.37e-32 136 28 13 461 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.37e-32 136 28 13 461 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9K2S2 1.94e-32 135 31 9 366 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
P60675 2.05e-32 135 30 15 420 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 2.05e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 2.05e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 2.05e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 2.05e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NXF6 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 2.91e-32 135 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q9ZNG6 3.5e-32 134 30 15 420 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q6GID6 3.59e-32 134 30 15 420 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q9RGZ5 6.63e-32 134 31 10 372 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q96069 1.09e-30 129 29 11 382 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q9PMA7 4.75e-30 127 27 10 415 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B1X491 1.87e-29 126 28 9 350 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q6GJ47 3.62e-29 125 29 9 359 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q8CQ50 3.97e-29 125 29 11 363 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRB2 4.31e-29 125 29 11 363 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q06GK2 5.76e-29 125 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
A1XG02 8.53e-29 124 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q35648 1.03e-28 123 29 14 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q8NXT2 1.21e-28 124 29 10 359 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 1.21e-28 124 29 10 359 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
P03917 1.41e-28 123 29 16 387 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
A6QCE9 1.52e-28 122 28 7 324 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurovum sp. (strain NBC37-1)
Q34879 1.56e-28 123 29 10 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q0Q2K0 1.65e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 1.65e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 1.65e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 1.65e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 1.65e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 1.65e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
P77416 2.28e-28 121 29 8 368 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
Q99VZ2 2.29e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 2.29e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 2.29e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 2.29e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 2.29e-28 123 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WIW1 2.59e-28 122 30 11 359 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 2.59e-28 122 30 11 359 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q02CT1 2.99e-28 121 29 9 359 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
A9L9E4 3.21e-28 122 29 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
P50939 3.52e-28 122 29 18 427 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
F1SVL2 5.14e-28 120 28 9 393 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q576B4 6.88e-28 121 27 12 400 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
P03916 6.9e-28 121 29 15 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
Q49W91 7.78e-28 121 28 13 438 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O78756 8.9e-28 120 28 10 340 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
Q32880 1.08e-27 120 29 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q32S06 1.2e-27 120 29 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q2YST2 1.33e-27 120 29 11 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9JX92 1.34e-27 120 28 9 345 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K1B0 1.55e-27 120 28 9 345 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8W8H5 2.17e-27 120 28 7 344 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
A9LYE7 2.35e-27 120 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
P03920 2.39e-27 119 27 12 400 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q3V4Y7 2.48e-27 120 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
O79437 2.68e-27 119 28 12 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
Q859V1 3.31e-27 119 28 9 358 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
P15958 3.92e-27 119 30 14 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
A8Y9D4 4e-27 119 29 11 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
F1SVK0 4.51e-27 119 26 14 456 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6EW03 4.97e-27 119 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q76LN2 5.29e-27 118 28 16 413 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
Q4L443 5.46e-27 119 31 14 387 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
B5LMS9 7.11e-27 118 28 12 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
P03915 9.17e-27 117 28 13 384 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
Q31952 1.1e-26 117 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q9I0J1 1.48e-26 117 27 14 455 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B1NWJ6 1.75e-26 117 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
B3TN96 1.83e-26 117 30 11 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
P31971 2.21e-26 117 28 16 423 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q33BX5 2.67e-26 117 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q85T01 3.13e-26 116 27 12 423 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
A1EA56 3.59e-26 116 29 11 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q70XW6 3.73e-26 116 28 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
Q32440 4.04e-26 116 29 11 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q32516 4.06e-26 116 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q32RH9 4.44e-26 116 29 9 325 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q95H46 5.2e-26 115 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
O03205 5.39e-26 115 27 14 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
Q3C1N9 5.6e-26 115 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
P06265 6.3e-26 115 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q2MIE0 6.71e-26 115 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
A4GGE3 7.6e-26 115 29 14 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
P24978 7.7e-26 115 24 12 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
P06264 7.76e-26 115 28 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
P0C328 8.03e-26 115 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 8.03e-26 115 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 8.03e-26 115 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 8.03e-26 115 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q9TLC2 8.47e-26 115 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
B1VKJ3 9.47e-26 115 28 8 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q9TDR1 9.95e-26 114 26 12 375 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
Q2VED3 1.11e-25 115 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q55429 1.21e-25 114 28 9 348 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0G9H2 1.34e-25 114 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q8S8V0 1.43e-25 114 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q9ZZY1 1.51e-25 114 27 10 339 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q85FH9 1.51e-25 114 30 11 352 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q2PMM9 1.58e-25 114 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
P46620 1.66e-25 114 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
P50974 1.96e-25 113 26 8 388 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
Q0ZIX1 1.97e-25 114 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
A4QLP4 2.02e-25 114 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
B1A981 2.06e-25 114 28 11 368 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q9ZCG1 2.08e-25 114 27 11 368 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q7YJT6 2.19e-25 114 29 10 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
Q2QD43 2.3e-25 114 28 9 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
P51099 3.45e-25 113 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q33066 3.65e-25 113 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q09FR3 3.77e-25 113 28 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q6L3E3 3.89e-25 113 29 11 346 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q6ENQ0 4.53e-25 113 29 11 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
A1XGU4 5.18e-25 112 28 15 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
A8LC88 6.08e-25 111 29 8 374 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
Q6YXQ6 6.6e-25 112 28 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
P92485 6.75e-25 112 27 11 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
Q06GU9 7.44e-25 112 29 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
B3QY38 7.57e-25 111 28 12 412 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q35099 7.7e-25 112 28 11 366 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
Q9BBP6 7.95e-25 112 27 10 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
A6MMZ2 8.49e-25 112 28 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q49KV1 9.09e-25 112 28 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q06FL7 9.48e-25 112 28 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
A4GYW4 9.61e-25 112 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q32091 1.04e-24 112 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q14FB0 1.07e-24 112 27 6 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
A6MMI0 1.13e-24 112 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
A0A382 1.25e-24 111 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
A4QLF6 1.3e-24 111 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q68RV9 1.33e-24 111 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
P41299 1.38e-24 111 25 9 339 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
A0ZZ82 1.41e-24 111 28 12 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
B0Z5H4 1.52e-24 111 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 1.52e-24 111 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 1.52e-24 111 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 1.52e-24 111 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q32539 1.59e-24 111 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q2L960 1.65e-24 111 28 13 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q68VV7 1.67e-24 111 27 11 360 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P03919 1.85e-24 110 27 12 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
A4QJX9 1.9e-24 111 29 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q953I4 1.94e-24 110 27 13 386 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
Q9MTI4 1.95e-24 111 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
Q09FZ9 1.96e-24 111 28 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q32131 2.05e-24 110 28 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
P50366 2.35e-24 110 27 16 408 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
A4QKF4 2.44e-24 110 28 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
P48656 2.5e-24 110 27 11 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
Q8W9M6 2.66e-24 110 27 13 399 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
P56752 2.85e-24 110 28 11 349 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
Q32384 2.89e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
P03918 3.02e-24 110 27 13 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
O21335 3.25e-24 110 27 12 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q9XAR5 3.35e-24 110 28 13 411 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q31849 3.49e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
A4QKP2 3.83e-24 110 29 13 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
P48921 3.89e-24 109 28 14 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
F1SVH9 4e-24 108 27 12 367 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P51098 4.2e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
Q95885 4.41e-24 109 26 9 347 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
Q33113 4.68e-24 109 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
P51100 4.74e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
A6H5N8 5.53e-24 109 30 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P51095 5.67e-24 109 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q1ACF3 5.87e-24 109 28 11 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q8M9U5 6.24e-24 109 29 9 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
A2T379 6.56e-24 109 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
Q32238 7.33e-24 109 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q9MVL6 7.53e-24 109 27 10 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
P48920 8.1e-24 108 28 10 344 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
P51096 8.38e-24 109 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q09MC9 9.28e-24 108 29 13 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
Q1RKE6 9.33e-24 108 26 13 397 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q9MVK2 9.37e-24 108 26 7 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
P51097 1.03e-23 108 28 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q32551 1.06e-23 108 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
O47815 1.1e-23 108 26 14 402 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P0AFE8 1.15e-23 107 26 13 435 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 1.15e-23 107 26 13 435 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q9I0J0 1.19e-23 107 25 13 429 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9RGZ2 1.33e-23 107 25 7 347 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q06R83 1.37e-23 108 26 11 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
P92699 1.38e-23 108 27 13 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
Q31HE7 1.41e-23 107 25 7 338 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A6LXP5 1.42e-23 107 24 9 431 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P26849 1.42e-23 108 27 15 429 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q7VFT5 1.44e-23 107 25 8 358 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A6MMR6 1.45e-23 108 29 12 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
Q32007 1.46e-23 108 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q7NP39 1.69e-23 107 27 8 365 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q2JWW3 1.92e-23 107 29 5 347 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
P50367 1.98e-23 107 25 14 458 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
A4QLY2 2.15e-23 107 28 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
Q32126 2.34e-23 107 27 12 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q31D31 2.47e-23 107 26 9 380 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
A7Y3K7 2.48e-23 107 28 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
P33607 2.81e-23 107 27 15 429 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
A6MM84 2.93e-23 107 28 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
A4QKY1 2.94e-23 107 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q0G9R5 2.94e-23 107 27 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
P50368 3.28e-23 107 27 12 416 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
P29925 3.29e-23 106 28 5 304 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
B1XJL9 3.75e-23 106 36 2 194 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A4QL68 3.84e-23 107 27 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
B2LMQ1 4.03e-23 107 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
P29924 4.15e-23 107 29 10 337 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
Q4UK26 4.37e-23 105 26 4 279 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9TLA3 4.75e-23 107 27 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
A4QJP7 4.77e-23 107 30 14 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q92G96 4.93e-23 105 26 4 279 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q0H8X0 5.06e-23 106 27 9 352 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
A4QJG3 5.91e-23 106 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
P50365 6.12e-23 106 29 9 315 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
P11661 6.25e-23 106 29 12 345 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
Q5N5W1 6.36e-23 105 31 6 286 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 6.36e-23 105 31 6 286 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q00542 7.16e-23 105 27 13 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
Q9M3J4 7.75e-23 106 27 9 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q9TKV7 1.23e-22 105 28 12 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q7MA37 1.27e-22 104 28 7 300 3 nuoN NADH-quinone oxidoreductase subunit N Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q01561 1.5e-22 105 24 15 475 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
Q9MUK8 1.72e-22 105 27 13 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q8SHP7 1.73e-22 105 24 12 419 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
O63908 1.96e-22 104 25 11 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
A7HY36 2.14e-22 103 27 7 303 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q9ZCG0 2.34e-22 103 26 3 281 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q5HSM5 2.48e-22 103 27 12 389 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter jejuni (strain RM1221)
A8G2F5 2.84e-22 103 25 10 381 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
A2BNU4 3.32e-22 103 25 10 381 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
A3PAL7 3.58e-22 103 25 10 381 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
A4QK67 3.67e-22 103 28 12 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q0C1D1 3.83e-22 102 26 5 341 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
Q37372 3.92e-22 103 26 15 438 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
Q2RJT7 4.36e-22 102 23 11 430 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q92G97 5.18e-22 103 27 11 361 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q30PJ2 5.2e-22 102 27 6 299 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A1AVS5 5.33e-22 102 24 10 415 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
Q7V3C8 5.56e-22 102 26 9 380 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A8SEF0 5.89e-22 103 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
P03921 6.01e-22 103 27 9 343 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q5SCZ9 6.15e-22 103 28 14 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q6GID9 6.93e-22 102 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q8YZV7 7.24e-22 102 26 4 342 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P38602 7.7e-22 102 27 12 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
Q2YWT7 9.03e-22 102 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q09WX1 9.27e-22 102 28 13 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q83BR8 9.28e-22 101 25 12 421 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A5GQH5 9.41e-22 102 26 6 349 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
Q9TA19 9.65e-22 102 26 12 411 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
A8Z056 9.89e-22 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 9.89e-22 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q8DHX4 1.04e-21 102 30 6 303 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9ZZM3 1.06e-21 102 29 12 322 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
Q1IS45 1.07e-21 101 26 9 360 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Koribacter versatilis (strain Ellin345)
P60687 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 1.09e-21 101 25 7 366 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 1.09e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HHD6 1.1e-21 101 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
Q7N2J9 1.2e-21 101 25 14 449 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2XWI8 1.27e-21 102 27 9 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
P72823 1.32e-21 101 27 9 358 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6ANN6 1.33e-21 101 25 9 389 3 nuoN NADH-quinone oxidoreductase subunit N Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9TL56 1.38e-21 102 26 8 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
A7ZBF3 1.6e-21 101 24 7 322 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter concisus (strain 13826)
P05510 1.61e-21 102 25 14 421 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6QU67 1.87e-21 101 25 11 359 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
A2BUC6 2.01e-21 101 25 8 378 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
Q2K9R9 2.1e-21 100 27 7 310 3 nuoN NADH-quinone oxidoreductase subunit N Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B0JS85 2.12e-21 101 27 6 338 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q67KP6 2.25e-21 100 28 8 336 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2I3G4 2.26e-21 101 25 14 413 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
A2CD41 2.64e-21 100 28 8 337 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q7V4E4 3.08e-21 100 28 8 337 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
Q94RJ2 3.5e-21 100 28 13 347 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q3M9C7 3.51e-21 100 26 4 342 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q2JTD6 3.55e-21 100 27 7 352 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
Q1HK80 3.84e-21 100 26 12 388 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q92QN9 4.1e-21 99 25 15 436 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Rhizobium meliloti (strain 1021)
A7HZW1 4.11e-21 99 25 7 300 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P41309 4.2e-21 100 26 11 331 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q3AGZ9 4.53e-21 100 28 6 316 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q7U413 5.14e-21 100 29 8 319 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
P16429 5.14e-21 100 28 9 374 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
B4EZ47 5.25e-21 99 26 12 443 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
Q37680 5.47e-21 100 26 15 417 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
A0LJL8 5.51e-21 99 25 8 411 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A5GD16 5.87e-21 99 27 6 367 3 nuoN NADH-quinone oxidoreductase subunit N Geotalea uraniireducens (strain Rf4)
B1XHP2 6.24e-21 99 32 4 287 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q2JPJ1 6.42e-21 99 32 5 253 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
A4J650 6.98e-21 99 24 10 427 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q2JK43 7.15e-21 99 26 11 404 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q0APX7 7.63e-21 99 26 14 418 3 nuoN NADH-quinone oxidoreductase subunit N Maricaulis maris (strain MCS10)
Q38PR2 8.61e-21 99 26 14 384 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
Q58705 8.8e-21 99 25 5 294 4 MJ1309 Uncharacterized protein MJ1309 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A9B6Y0 8.84e-21 99 30 12 311 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q6V9D9 9.82e-21 99 25 10 358 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
A1WXV4 1.05e-20 98 28 6 271 3 nuoN NADH-quinone oxidoreductase subunit N Halorhodospira halophila (strain DSM 244 / SL1)
Q34313 1.07e-20 99 27 12 357 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
B9KDV9 1.08e-20 98 26 8 304 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q56227 1.28e-20 99 28 9 323 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q46HM4 1.38e-20 98 25 6 354 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
Q1RKE5 1.43e-20 98 24 6 350 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q1DDD3 1.44e-20 98 25 9 416 3 nuoN NADH-quinone oxidoreductase subunit N Myxococcus xanthus (strain DK1622)
Q7VE41 1.45e-20 98 27 8 358 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A8M609 1.68e-20 98 27 10 383 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
Q9ZZ57 1.78e-20 98 27 11 346 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
P20679 1.88e-20 98 25 10 358 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q2LCP6 1.97e-20 98 26 13 426 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
A5GP41 2.19e-20 98 29 6 310 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
C1AZG0 2.3e-20 97 29 7 306 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
P11628 2.33e-20 98 26 13 348 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q7NGP8 2.45e-20 97 28 13 434 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B8IUV9 2.64e-20 97 27 7 298 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A7NPD6 2.71e-20 97 28 10 351 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q68VV6 3.01e-20 97 25 3 279 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P57262 3.07e-20 97 25 16 432 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q4UK27 3.25e-20 97 25 10 365 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B5YKJ2 3.51e-20 96 27 10 353 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
O79411 4.26e-20 97 29 10 309 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
Q3ASV8 4.3e-20 97 26 5 337 3 nuoN NADH-quinone oxidoreductase subunit N Chlorobium chlorochromatii (strain CaD3)
P9WIW8 4.36e-20 97 24 8 419 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5N060 4.42e-20 97 25 8 400 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 4.42e-20 97 25 8 400 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P9WIW9 4.56e-20 97 25 7 400 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 4.56e-20 97 25 7 400 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0I6X0 4.65e-20 97 33 2 199 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
A5FQX9 5.55e-20 96 23 10 388 3 nuoN NADH-quinone oxidoreductase subunit N Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
P48176 7.45e-20 96 29 12 319 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
A1USY0 7.57e-20 95 25 15 435 3 nuoN NADH-quinone oxidoreductase subunit N Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A2BZX6 8.41e-20 96 25 6 354 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
Q3B063 9.13e-20 96 33 2 199 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q8HHD2 1.06e-19 96 25 11 363 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q9B8C9 1.19e-19 95 24 13 453 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9ZZ44 1.2e-19 95 28 13 343 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
B9LGS9 1.39e-19 95 26 9 383 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
P29388 1.43e-19 95 26 15 417 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
Q19V60 1.66e-19 95 27 11 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
A9BD08 1.81e-19 95 32 2 196 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
Q9I0I9 1.86e-19 94 27 8 372 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B2J565 2.23e-19 94 27 9 328 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B7K1G4 2.56e-19 94 25 10 389 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
A4XV14 2.64e-19 94 28 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas mendocina (strain ymp)
Q9B6D3 2.66e-19 95 25 15 433 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9RUA0 2.66e-19 94 29 7 305 3 nuoN NADH-quinone oxidoreductase subunit N Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
C6D5D2 2.7e-19 94 27 13 351 3 nuoN NADH-quinone oxidoreductase subunit N Paenibacillus sp. (strain JDR-2)
P92669 2.72e-19 94 25 12 351 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q95918 2.87e-19 94 26 14 369 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
O79556 3.58e-19 94 27 12 353 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
A0KJ55 3.65e-19 94 28 11 378 3 nuoN NADH-quinone oxidoreductase subunit N Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q10ZG8 3.75e-19 94 28 5 307 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
Q5HQL3 3.93e-19 94 25 5 335 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1X5V5 4.03e-19 94 27 11 390 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
Q8CPV1 4.07e-19 94 25 5 335 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8YQ78 4.29e-19 94 25 4 328 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q64Y15 4.69e-19 93 23 5 330 3 nuoN NADH-quinone oxidoreductase subunit N Bacteroides fragilis (strain YCH46)
Q17Z65 4.87e-19 93 24 9 373 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter acinonychis (strain Sheeba)
Q3MCB9 5.14e-19 93 24 7 401 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6A6H1 5.49e-19 93 26 8 395 3 nuoN NADH-quinone oxidoreductase subunit N Cutibacterium acnes (strain DSM 16379 / KPA171202)
P32421 5.82e-19 93 24 5 352 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O78688 5.98e-19 94 27 10 308 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q81K10 6.33e-19 93 25 6 382 3 nuoN NADH-quinone oxidoreductase subunit N Bacillus anthracis
Q4JQH7 8.18e-19 93 28 9 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
P34195 9.02e-19 93 28 9 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
B7GME1 1.01e-18 92 27 8 383 3 nuoN NADH-quinone oxidoreductase subunit N Anoxybacillus flavithermus (strain DSM 21510 / WK1)
P24979 1.08e-18 93 26 10 317 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
Q47LF7 1.1e-18 92 31 8 285 3 nuoN NADH-quinone oxidoreductase subunit N Thermobifida fusca (strain YX)
P55782 1.12e-18 92 28 10 310 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
C1F9D0 1.23e-18 92 28 8 326 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B0C4B4 1.47e-18 92 26 8 350 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
C4LB43 1.59e-18 92 29 7 300 3 nuoN NADH-quinone oxidoreductase subunit N Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q8MA16 1.6e-18 92 26 6 321 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chaetosphaeridium globosum
Q49VH2 1.67e-18 92 26 5 278 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q37376 1.93e-18 92 23 10 385 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Acanthamoeba castellanii
A4G631 1.93e-18 91 24 15 462 3 nuoN NADH-quinone oxidoreductase subunit N Herminiimonas arsenicoxydans
Q8W9M7 2.29e-18 91 25 6 331 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dugong dugon
P56911 2.33e-18 91 24 8 342 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Rhizobium meliloti (strain 1021)
P26848 2.39e-18 91 23 5 290 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
Q8DMR6 2.39e-18 91 27 9 337 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B3E9V6 2.45e-18 91 25 10 370 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q4L446 2.45e-18 91 24 6 373 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
P48915 2.49e-18 91 24 7 327 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
Q8KX56 2.61e-18 91 27 7 293 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8DKY0 2.83e-18 91 25 6 364 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9MIY0 3.12e-18 91 28 9 294 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
P18940 3.37e-18 91 29 10 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q37617 3.47e-18 91 25 7 319 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
B0JPG4 3.78e-18 90 25 7 393 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A1SE40 3.79e-18 90 27 14 400 3 nuoN NADH-quinone oxidoreductase subunit N Nocardioides sp. (strain ATCC BAA-499 / JS614)
A9R6K9 4.09e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Angola)
B1JGM5 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669B2 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM24 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis (strain Pestoides F)
Q1CHR3 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CJ84 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis
B2K809 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6C1 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGR6 4.2e-18 90 26 10 376 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A0LEQ8 4.29e-18 90 26 6 312 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
O03174 4.62e-18 90 26 11 313 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
A5FXI8 4.83e-18 90 32 9 288 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Acidiphilium cryptum (strain JF-5)
O67391 5.89e-18 90 26 12 339 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Aquifex aeolicus (strain VF5)
Q3MB63 6.53e-18 90 27 10 387 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B1WUS5 6.56e-18 90 26 8 384 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8YMQ0 8.1e-18 90 27 10 387 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A4WCQ5 8.4e-18 89 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
Q3AC87 8.42e-18 89 26 12 395 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A2T383 9.01e-18 89 26 4 293 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
Q8YM86 9.1e-18 90 31 1 191 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MAR0 9.89e-18 89 31 1 191 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q32RL9 1.08e-17 89 27 8 387 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
Q1ACE9 1.12e-17 89 24 8 393 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
P93313 1.27e-17 89 25 6 297 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
A1ALQ2 1.32e-17 89 26 6 303 3 nuoN NADH-quinone oxidoreductase subunit N Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q5ZNA1 1.34e-17 89 29 2 207 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Zaglossus bruijni
Q8M9U1 1.48e-17 89 27 5 316 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
Q2W3J7 1.52e-17 89 23 13 468 3 nuoN NADH-quinone oxidoreductase subunit N Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q118H6 1.55e-17 89 24 7 393 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
Q9TKV8 1.8e-17 89 27 5 297 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
A8GH04 1.82e-17 88 27 14 387 3 nuoN NADH-quinone oxidoreductase subunit N Serratia proteamaculans (strain 568)
O67342 1.86e-17 88 27 9 355 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
P9WIW5 1.88e-17 89 24 12 400 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 1.88e-17 89 24 12 400 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P06263 1.98e-17 88 28 5 297 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
P93401 2.18e-17 88 27 8 329 2 ND2 NADH-ubiquinone oxidoreductase chain 2 Oenothera berteroana
P11993 2.27e-17 89 26 11 339 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q36458 2.74e-17 87 29 2 207 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ornithorhynchus anatinus
B1ZUK1 2.75e-17 88 26 8 395 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A8ADW3 2.9e-17 88 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
O05229 3e-17 88 24 4 348 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
P10330 3.14e-17 88 26 16 413 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
B2VIN7 3.44e-17 87 27 11 378 3 nuoN NADH-quinone oxidoreductase subunit N Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
O47497 4.18e-17 87 25 4 294 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
B4U8I1 5.04e-17 87 24 9 360 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Hydrogenobaculum sp. (strain Y04AAS1)
Q608Y9 5.13e-17 87 30 7 233 3 nuoN NADH-quinone oxidoreductase subunit N Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6YXR9 5.16e-17 87 27 6 280 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
Q9TL07 5.4e-17 87 26 4 303 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Nephroselmis olivacea
Q32S08 5.49e-17 87 26 11 453 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
Q5N5T8 5.74e-17 87 27 9 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 5.74e-17 87 27 9 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P12776 5.84e-17 87 26 12 388 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
P0CD37 5.94e-17 87 26 7 323 3 ndhB2 NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic Psilotum nudum
P0CD36 5.94e-17 87 26 7 323 3 ndhB1 NAD(P)H-quinone oxidoreductase subunit 2 A, chloroplastic Psilotum nudum
Q6GJ44 6.09e-17 87 23 10 413 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
P48919 6.82e-17 87 26 11 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
O79678 7.7e-17 87 25 11 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
Q8K9X7 7.85e-17 87 26 12 332 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8CQ47 8.25e-17 86 26 7 310 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O05000 8.29e-17 86 27 8 328 1 ND2 NADH-ubiquinone oxidoreductase chain 2 Arabidopsis thaliana
Q9MUQ6 8.61e-17 86 28 9 357 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
Q57M40 8.96e-17 86 26 11 378 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella choleraesuis (strain SC-B67)
Q36459 9.1e-17 87 26 12 332 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
A7MHT8 9.63e-17 86 27 11 380 3 nuoN NADH-quinone oxidoreductase subunit N Cronobacter sakazakii (strain ATCC BAA-894)
C5D978 9.82e-17 86 27 8 314 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
Q5HRA9 9.82e-17 86 26 7 310 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1JLL1 1.04e-16 86 27 14 385 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q89AT5 1.06e-16 86 28 9 250 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P27572 1.17e-16 86 25 6 297 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
Q82TV6 1.35e-16 85 26 11 350 3 nuoN NADH-quinone oxidoreductase subunit N Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P34194 1.42e-16 85 31 2 185 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Formosania lacustris
Q9MIY1 1.45e-16 85 31 2 187 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Danio rerio
C6XJX0 1.5e-16 85 26 15 382 3 nuoN NADH-quinone oxidoreductase subunit N Hirschia baltica (strain ATCC 49814 / DSM 5838 / IFAM 1418)
P55781 1.55e-16 85 31 2 187 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gadus morhua
Q5SCY2 1.66e-16 85 26 6 283 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
B5XNW6 1.66e-16 85 27 12 380 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae (strain 342)
Q2RU27 1.68e-16 85 25 7 309 3 nuoN NADH-quinone oxidoreductase subunit N Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q09WW8 1.98e-16 85 25 4 304 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
Q85FH5 1.99e-16 85 25 6 308 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q32RP6 2.1e-16 85 25 9 336 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Zygnema circumcarinatum
Q3BRP2 2.15e-16 85 25 11 396 3 nuoN NADH-quinone oxidoreductase subunit N Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A9MJA9 2.15e-16 85 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5FPF7 2.23e-16 85 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella dublin (strain CT_02021853)
A6TBW2 2.31e-16 85 27 12 380 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q19V61 2.32e-16 85 28 3 280 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
P15584 2.4e-16 85 24 13 403 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q8ZNE4 2.46e-16 85 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_06815
Feature type CDS
Gene -
Product hydrogenase 4 subunit F
Location 99344 - 100924 (strand: 1)
Length 1581 (nucleotides) / 526 (amino acids)
In genomic island -

Contig

Accession ZDB_216
Length 269970 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_862
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0651 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)
CP Formate hydrogenlyase subunit 3/Multisubunit Na+/H+ antiporter, MnhD subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12141 hydrogenase-4 component F [EC:1.-.-.-] - -

Protein Sequence

MSQTMLLTLLMATPLVISLLAFACRLAGGGAKGVVTLVHTTGISLMLVFSLWMVYTISAEGDLLMANRWIHLDSLAGLFLAILGIVGFLTGLYSIGYMNHEVNDGEVSVATLCNYYGFFHLFLFTMLLVITSNNLILMWAAVEATTLSSAFLVGIYGQRSSLEAAWKYIIICSVGVAFGLFGTILVYANAASVMPDPELAIFWTEVLKHTALLDPTLMHLAFVFVLIGFGTKTGLFPMHAWLPDAHSEAPSPVSALLSAVLLNCALLIIIRYYIIITSAIGGEFTQTLLLVFGLLSVAVAAFFILIQRDMKRLLAYSSVENMGLIAVALGIGGPLGVLAALLHTLNHSLGKTLLFCGSGNVLLKYGTRDITVVKGMLRTMPFTAVVFAGGALALGGMPPFNVFLSEFMTVVAGLAADHFWLTLLLLILLTIVLGGLVRMVSKTLFGAQPDCVSRGEAGILTTLPMAILIVLMLVMGTHIPQPVSRLLENAATIVLTDSALPGTELTTPDYRWPWGVDTTSTSSQEK

Flanking regions ( +/- flanking 50bp)

GCTCAACACACTGAACGTGGATCAACTGACCGCGCTGAAGGGGTGATGAGATGAGTCAAACCATGTTGTTAACGTTATTAATGGCAACGCCGCTGGTGATTTCACTGCTGGCATTTGCCTGCCGCCTGGCAGGCGGCGGGGCGAAAGGTGTGGTCACTCTGGTACATACCACCGGTATCTCCCTGATGCTCGTCTTCTCGCTGTGGATGGTGTACACCATCAGTGCGGAAGGTGATTTGCTGATGGCGAACCGCTGGATCCACCTGGACAGCCTGGCCGGATTATTCCTGGCGATCCTCGGGATTGTCGGTTTCCTGACCGGTCTGTATTCTATCGGTTACATGAACCACGAAGTGAATGATGGTGAAGTGAGTGTGGCAACACTCTGTAACTATTACGGTTTCTTCCACCTGTTCCTGTTCACCATGCTGCTGGTGATCACCAGTAACAACCTGATCCTGATGTGGGCGGCAGTCGAAGCCACCACACTCAGTTCTGCGTTCCTGGTGGGTATCTACGGACAGCGCTCTTCCCTGGAAGCGGCGTGGAAATACATCATCATCTGTAGTGTGGGTGTGGCGTTCGGTCTGTTCGGCACCATCCTCGTGTATGCGAATGCGGCGAGTGTGATGCCGGATCCGGAACTGGCTATCTTCTGGACCGAAGTGCTGAAACATACCGCGCTGCTGGATCCGACCCTGATGCACCTGGCCTTTGTGTTTGTGCTGATTGGTTTCGGTACCAAAACCGGTCTGTTCCCGATGCACGCCTGGCTGCCGGATGCACACAGTGAGGCGCCGAGCCCGGTCTCCGCGCTGCTGTCCGCGGTTCTGCTGAACTGCGCACTGCTGATTATCATCCGTTACTACATCATTATCACCTCGGCTATCGGCGGGGAATTCACTCAGACACTGCTGCTGGTCTTCGGGCTGCTCTCTGTGGCAGTGGCGGCGTTCTTCATTCTGATCCAGCGTGATATGAAACGTCTGCTGGCGTACTCCAGTGTGGAAAACATGGGGCTGATTGCCGTGGCGCTGGGTATCGGTGGTCCGCTGGGTGTGCTGGCCGCGCTGCTGCATACGCTGAACCACAGCCTGGGCAAAACCCTGCTGTTCTGCGGTTCCGGTAACGTGTTACTGAAGTACGGTACCCGTGATATCACGGTGGTCAAAGGGATGCTGCGCACCATGCCGTTTACGGCAGTTGTCTTTGCGGGCGGCGCGCTGGCACTCGGTGGTATGCCGCCGTTTAACGTGTTCCTGAGTGAGTTTATGACGGTGGTTGCGGGTCTGGCGGCTGATCATTTCTGGCTGACGCTGCTGCTTTTGATCCTGCTCACTATCGTCCTCGGCGGGTTGGTTAGAATGGTATCGAAAACCCTGTTCGGCGCACAGCCTGACTGCGTGTCACGCGGCGAGGCAGGGATCCTGACGACATTGCCGATGGCCATCCTCATTGTACTGATGCTGGTGATGGGCACCCACATTCCGCAGCCGGTCAGCCGTCTGCTCGAAAATGCCGCCACTATTGTCCTGACGGACAGTGCATTACCAGGTACAGAATTAACCACCCCGGACTACCGCTGGCCGTGGGGTGTTGATACAACATCCACATCATCGCAGGAGAAATAAACGTGAGCTATCAGAATTACACAGATACCCTTCAGGGCGTTCGTAAAGGC