Homologs in group_862

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03720 FBDBKF_03720 95.2 Morganella morganii S1 - hydrogenase 4 subunit F
EHELCC_06815 EHELCC_06815 95.2 Morganella morganii S2 - hydrogenase 4 subunit F
NLDBIP_07140 NLDBIP_07140 95.2 Morganella morganii S4 - hydrogenase 4 subunit F
LHKJJB_06675 LHKJJB_06675 95.2 Morganella morganii S3 - hydrogenase 4 subunit F
HKOGLL_04255 HKOGLL_04255 95.2 Morganella morganii S5 - hydrogenase 4 subunit F
PMI_RS12475 PMI_RS12475 77.5 Proteus mirabilis HI4320 - hydrogenase 4 subunit F

Distribution of the homologs in the orthogroup group_862

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_862

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77437 0.0 712 70 2 527 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
A9QPJ1 2.61e-87 280 37 5 447 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
P23482 2.52e-38 152 30 6 350 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
B1I6I5 1.53e-37 147 30 9 391 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q4L4W7 1.78e-33 138 30 15 453 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q52978 4e-33 137 29 10 451 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
Q9K2S2 5.56e-33 137 30 14 441 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q2YWT4 2.09e-32 135 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WIW3 2.11e-32 134 34 12 365 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 2.11e-32 134 34 12 365 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8CPU8 3.69e-32 134 28 13 458 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 3.69e-32 134 28 13 458 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49VG9 4.22e-32 134 30 16 441 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P60675 6.65e-32 134 30 13 419 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 6.65e-32 134 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 6.65e-32 134 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 6.65e-32 134 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 6.65e-32 134 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9RGZ5 7.4e-32 134 31 10 368 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9ZNG6 1.06e-31 133 30 13 419 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q8NXF6 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 1.15e-31 133 30 13 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q6GID6 1.35e-31 133 30 14 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q96069 1.77e-31 131 29 12 382 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q9PMA7 2.34e-30 128 27 9 410 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A6QCE9 3.62e-29 124 28 8 329 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurovum sp. (strain NBC37-1)
Q5HRB2 3.66e-29 125 29 11 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 3.86e-29 125 29 11 370 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P77416 5.13e-29 123 29 8 368 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
B1X491 5.85e-29 124 28 9 350 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
A1XG02 9.17e-29 124 28 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
P03917 9.63e-29 123 29 17 387 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
Q35648 9.9e-29 123 29 15 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q49W91 1.53e-28 124 29 14 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q02CT1 1.61e-28 122 28 7 359 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
Q06GK2 1.64e-28 123 28 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q32S06 1.69e-28 123 29 8 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q9JX92 1.98e-28 123 28 12 357 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q34879 2.19e-28 122 27 13 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
P9WIW1 2.23e-28 122 30 11 360 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 2.23e-28 122 30 11 360 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9K1B0 2.42e-28 122 28 12 357 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O79437 4.19e-28 121 27 16 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
A9L9E4 4.78e-28 122 29 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q31952 5.53e-28 122 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q6GJ47 7.46e-28 121 29 9 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
P03916 8.38e-28 120 29 16 386 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
F1SVL2 8.39e-28 119 28 12 435 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q33BX5 1.04e-27 121 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q8NXT2 1.28e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 1.28e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q32516 1.42e-27 120 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
B1NWJ6 1.45e-27 120 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
Q0Q2K0 1.8e-27 120 29 11 361 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 1.8e-27 120 29 11 361 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 1.8e-27 120 29 11 361 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 1.8e-27 120 29 11 361 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 1.8e-27 120 29 11 361 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 1.8e-27 120 29 11 361 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
P15958 1.86e-27 120 30 13 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
Q99VZ2 2.09e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 2.09e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 2.09e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 2.09e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 2.09e-27 120 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q32880 2.41e-27 120 30 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q576B4 2.45e-27 119 27 13 396 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
P06265 2.49e-27 120 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q2MIE0 2.53e-27 120 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q3C1N9 2.53e-27 120 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q2VED3 3.7e-27 119 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
O78756 3.74e-27 119 27 13 384 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
B5LMS9 4.52e-27 119 28 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
Q8W8H5 4.7e-27 119 28 6 344 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q76LN2 5.24e-27 118 27 17 429 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
Q6EW03 5.25e-27 119 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
P03920 5.46e-27 118 27 13 387 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q859V1 6.3e-27 118 27 10 377 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
A9LYE7 7.44e-27 118 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
A8Y9D4 7.88e-27 118 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
Q3V4Y7 8e-27 118 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
Q85T01 9.26e-27 118 26 12 435 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P06264 9.47e-27 118 29 10 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
F1SVK0 1.05e-26 117 27 15 457 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q2YST2 1.48e-26 117 29 10 360 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
B3TN96 1.49e-26 117 29 10 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
P31971 2.19e-26 117 28 11 361 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P24978 2.28e-26 116 25 13 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
Q0ZIX1 2.57e-26 117 27 7 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
Q70XW6 2.87e-26 116 28 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
Q55429 2.92e-26 116 28 9 359 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9I0J1 3.03e-26 116 26 12 427 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O03205 3.23e-26 116 28 16 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
Q8S8V0 4.27e-26 116 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q2PMM9 4.42e-26 116 28 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
P03915 4.6e-26 115 28 15 384 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
B1VKJ3 5.32e-26 115 28 6 344 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q09FZ9 5.67e-26 115 28 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q9ZZY1 5.94e-26 115 27 10 324 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
A4GGE3 5.95e-26 115 29 14 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q4L443 6.09e-26 115 29 15 432 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q9TDR1 6.24e-26 115 26 13 375 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
A0A382 6.29e-26 115 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
P50939 8.85e-26 115 29 12 350 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q32440 9.11e-26 115 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q49KV1 9.2e-26 115 28 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
A4QLP4 9.9e-26 115 29 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
A1EA56 9.97e-26 115 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
P0C328 1.03e-25 115 30 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 1.03e-25 115 30 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 1.03e-25 115 30 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 1.03e-25 115 30 13 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q2QD43 1.04e-25 115 28 8 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q95H46 1.09e-25 115 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
B1A981 1.21e-25 114 28 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q68RV9 1.28e-25 114 29 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q9TLC2 1.64e-25 114 28 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
A1XGU4 2.5e-25 114 28 13 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
Q9BBP6 2.82e-25 113 27 10 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q9ZCG1 3.39e-25 113 27 12 361 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q85FH9 3.41e-25 113 30 11 352 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
P92485 3.44e-25 113 27 12 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
P46620 3.52e-25 113 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
B0Z5H4 3.6e-25 113 27 9 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 3.6e-25 113 27 9 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 3.6e-25 113 27 9 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 3.6e-25 113 27 9 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
P51099 3.88e-25 113 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
P50366 3.92e-25 113 27 15 418 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
P41299 3.94e-25 112 25 11 378 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
Q0G9H2 3.97e-25 113 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q9MTI4 4.07e-25 113 27 9 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
Q33113 4.33e-25 113 28 12 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
Q32RH9 4.33e-25 113 28 8 325 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
A2T379 4.75e-25 113 25 10 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
Q33066 5.23e-25 112 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
A0ZZ82 5.63e-25 112 28 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q09FR3 6.18e-25 112 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
P51095 6.21e-25 112 26 17 488 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q7YJT6 6.51e-25 112 28 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
Q6ENQ0 6.61e-25 112 29 13 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
F1SVH9 6.63e-25 111 28 13 363 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6L3E3 6.67e-25 112 29 13 359 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
O47815 8.03e-25 112 27 12 365 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
Q2L960 8.32e-25 112 28 12 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q8W9M6 8.45e-25 111 28 14 384 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q14FB0 8.71e-25 112 28 7 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
A4GYW4 9.11e-25 112 29 8 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q32091 9.38e-25 112 25 16 487 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q32539 1.1e-24 112 24 16 494 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
O21335 1.11e-24 111 27 14 376 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q8M9U5 1.16e-24 111 28 9 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
P0AFE8 1.2e-24 110 26 14 438 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 1.2e-24 110 26 14 438 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q06R83 1.21e-24 111 27 11 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
B3QY38 1.36e-24 110 27 10 402 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q06GU9 1.41e-24 111 29 8 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
P48656 1.42e-24 111 27 12 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
Q68VV7 1.71e-24 111 27 11 360 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8LC88 1.77e-24 110 29 8 374 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
A4QLF6 1.97e-24 111 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
A6MMI0 2.02e-24 111 28 9 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
A6MMZ2 2.05e-24 111 28 8 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
P50974 2.11e-24 110 25 8 388 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
A4QKF4 2.19e-24 110 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
Q32131 2.35e-24 110 28 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q31HE7 2.35e-24 109 26 9 338 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A6H5N8 2.4e-24 110 27 9 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P48921 2.54e-24 110 28 15 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
Q06FL7 2.67e-24 110 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
Q09MC9 2.76e-24 110 28 11 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
A4QJX9 3.01e-24 110 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q32384 3.16e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
A6MM84 3.23e-24 110 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
Q6YXQ6 3.33e-24 110 28 12 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q2JWW3 3.59e-24 109 28 5 347 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
P56752 3.8e-24 110 28 11 349 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
P51097 4.24e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q32126 4.25e-24 110 28 12 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q31849 4.33e-24 110 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51100 4.74e-24 110 28 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
P03918 5.01e-24 109 27 14 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
Q953I4 5.02e-24 109 27 13 386 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
A6LXP5 5.08e-24 108 24 9 432 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P03919 5.79e-24 109 27 13 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
P48920 6.13e-24 109 28 10 344 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
Q7NP39 6.39e-24 108 28 8 365 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9MVK2 6.54e-24 109 26 6 344 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
P51098 6.76e-24 109 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
Q9MVL6 6.94e-24 109 27 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q95885 7.14e-24 108 27 12 351 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
P50365 7.36e-24 108 30 12 315 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q35099 7.39e-24 108 27 11 366 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
P33607 7.51e-24 108 26 15 447 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q32551 7.83e-24 109 25 17 488 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q32238 8.01e-24 109 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q92G96 9.05e-24 107 26 3 278 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A4QKP2 9.15e-24 108 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
Q9XAR5 9.53e-24 108 27 8 355 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5N5W1 9.6e-24 108 27 9 377 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 9.6e-24 108 27 9 377 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P51096 9.85e-24 108 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
O63908 1.25e-23 108 25 14 372 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
P29924 1.3e-23 108 28 16 439 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
P11661 1.4e-23 108 29 12 345 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
Q32007 1.48e-23 108 24 15 487 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q1RKE6 1.52e-23 108 25 13 410 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
A4QLY2 1.55e-23 108 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
Q0H8X0 1.66e-23 108 26 11 405 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
B1XJL9 1.76e-23 107 31 7 307 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q7VFT5 1.97e-23 107 25 8 358 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9RGZ2 2.17e-23 106 24 6 346 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P92699 2.36e-23 107 27 14 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
A7Y3K7 2.64e-23 107 28 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
Q9MUK8 2.77e-23 107 27 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
P50367 2.78e-23 107 25 14 458 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
A4QKY1 2.99e-23 107 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q1ACF3 3.31e-23 107 27 10 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
P16429 3.97e-23 106 29 11 375 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
Q8SHP7 4.11e-23 107 25 8 354 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
Q00542 4.24e-23 106 27 14 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
Q01561 5.11e-23 106 26 13 415 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
A7HY36 5.18e-23 105 28 7 303 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4QL68 5.21e-23 106 27 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
B2LMQ1 5.22e-23 106 27 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q9TLA3 5.39e-23 106 27 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q4UK26 6.32e-23 105 27 3 280 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A4QJG3 6.58e-23 106 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
Q9TKV7 6.62e-23 106 26 21 503 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
A6MMR6 6.69e-23 106 28 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
Q37372 7.14e-23 106 26 16 460 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
P29925 7.85e-23 105 28 3 285 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q0G9R5 8.31e-23 106 27 8 345 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
P03921 1e-22 105 28 12 359 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q30PJ2 1.08e-22 104 28 6 299 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A4QJP7 1.37e-22 105 30 14 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q0C1D1 1.39e-22 104 26 5 341 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
Q6ANN6 1.4e-22 104 25 8 387 3 nuoN NADH-quinone oxidoreductase subunit N Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9TL56 1.53e-22 105 27 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
Q1RKE5 1.61e-22 104 24 6 350 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q9I0J0 1.65e-22 104 24 11 426 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YZV7 1.86e-22 104 27 6 350 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8SEF0 2.33e-22 104 27 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q2K9R9 2.33e-22 103 28 6 306 3 nuoN NADH-quinone oxidoreductase subunit N Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A8Z056 2.44e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 2.44e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
P72823 2.67e-22 103 27 9 358 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6GID9 2.7e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q09WX1 2.73e-22 104 27 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q2YWT7 2.85e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HHD6 3.02e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
P60687 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 3.1e-22 103 25 7 366 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 3.1e-22 103 25 7 366 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5SCZ9 3.15e-22 104 27 13 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
A2CD41 3.37e-22 103 27 5 340 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q7MA37 3.39e-22 103 27 7 322 3 nuoN NADH-quinone oxidoreductase subunit N Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9M3J4 3.48e-22 104 27 9 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q7V4E4 3.5e-22 103 27 5 340 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
Q9TA19 3.53e-22 103 26 17 466 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
Q1HK80 3.93e-22 103 25 14 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q92QN9 4.13e-22 102 26 14 436 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Rhizobium meliloti (strain 1021)
Q31D31 4.24e-22 103 25 8 362 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
P38602 4.26e-22 103 27 13 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
Q6QU67 4.47e-22 103 24 14 423 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q92G97 4.52e-22 103 27 11 358 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A4QK67 4.84e-22 103 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q2RJT7 5.1e-22 102 24 9 386 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9ZCG0 5.19e-22 102 26 3 278 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
A0LJL8 6.47e-22 102 26 9 411 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2XWI8 7.53e-22 103 27 8 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
P50368 7.61e-22 103 26 12 416 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
Q3M9C7 7.97e-22 102 26 6 350 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P05510 8.95e-22 102 26 10 363 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A1AVS5 9.49e-22 101 25 10 372 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
Q9ZZM3 9.9e-22 102 28 9 305 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
Q83BR8 9.99e-22 101 25 6 331 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B0JS85 1e-21 102 27 6 338 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9ZZ57 1.02e-21 102 25 16 417 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
A9B6Y0 1.09e-21 101 29 10 327 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q8DHX4 1.17e-21 102 28 5 305 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q1IS45 1.17e-21 101 24 9 430 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Koribacter versatilis (strain Ellin345)
Q67KP6 1.26e-21 101 27 8 360 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q94RJ2 1.39e-21 102 26 15 442 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q5HSM5 1.52e-21 100 26 15 458 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter jejuni (strain RM1221)
Q2I3G4 1.88e-21 101 25 13 413 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
Q6V9D9 2.44e-21 101 24 11 374 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
P26849 2.47e-21 101 26 15 429 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q7V3C8 2.52e-21 100 26 9 376 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B5YKJ2 2.54e-21 100 28 9 324 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q38PR2 2.78e-21 100 26 14 384 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
Q46HM4 2.87e-21 100 28 3 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
A7ZBF3 3.44e-21 100 24 7 322 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter concisus (strain 13826)
A8M609 3.67e-21 100 28 9 378 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
Q2JPJ1 4.68e-21 100 30 3 252 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
A5GD16 5.21e-21 99 28 7 370 3 nuoN NADH-quinone oxidoreductase subunit N Geotalea uraniireducens (strain Rf4)
Q2JK43 5.31e-21 99 27 10 379 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
A8G2F5 5.81e-21 99 25 9 379 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
Q34313 5.88e-21 100 26 14 358 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
B8IUV9 6.04e-21 99 28 7 299 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A7HZW1 6.08e-21 99 24 6 301 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A2BNU4 6.24e-21 99 25 9 379 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
B1XHP2 6.41e-21 99 30 5 339 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A3PAL7 6.5e-21 99 24 8 363 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
Q3AGZ9 6.68e-21 99 27 6 316 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
A4J650 6.92e-21 99 24 10 427 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q7N2J9 7.12e-21 99 24 15 481 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2LCP6 7.25e-21 100 27 15 358 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
B9KDV9 7.51e-21 99 25 8 324 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A5GQH5 7.58e-21 99 26 5 348 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
P41309 7.93e-21 99 25 13 410 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q68VV6 7.99e-21 99 25 3 278 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7U413 8.29e-21 99 29 8 319 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
C1AZG0 8.78e-21 99 29 7 316 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
A2BUC6 9.49e-21 99 25 9 376 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
A1WXV4 1.01e-20 98 28 6 271 3 nuoN NADH-quinone oxidoreductase subunit N Halorhodospira halophila (strain DSM 244 / SL1)
P11628 1.04e-20 99 26 13 348 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q2JTD6 1.14e-20 99 27 7 340 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
Q4UK27 1.15e-20 99 26 12 361 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P20679 1.2e-20 99 25 10 358 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
A7NPD6 1.23e-20 98 28 10 351 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q37680 1.25e-20 99 27 12 350 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
A2BZX6 1.54e-20 98 27 3 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
Q56227 1.6e-20 98 27 10 324 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1DDD3 1.71e-20 98 26 9 416 3 nuoN NADH-quinone oxidoreductase subunit N Myxococcus xanthus (strain DK1622)
P57262 1.73e-20 98 25 16 431 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B4EZ47 1.86e-20 97 25 10 437 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
Q0APX7 2.12e-20 97 27 12 401 3 nuoN NADH-quinone oxidoreductase subunit N Maricaulis maris (strain MCS10)
Q58705 2.13e-20 97 26 5 294 4 MJ1309 Uncharacterized protein MJ1309 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O79411 2.7e-20 98 28 9 305 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
B9LGS9 2.87e-20 97 25 7 352 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
Q7VE41 3.07e-20 97 26 9 362 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A4XV14 4.52e-20 96 25 10 443 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas mendocina (strain ymp)
P48176 4.6e-20 97 28 9 301 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
A5GP41 4.96e-20 97 28 5 319 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
Q3ASV8 5.2e-20 96 27 10 393 3 nuoN NADH-quinone oxidoreductase subunit N Chlorobium chlorochromatii (strain CaD3)
P9WIW8 5.77e-20 96 24 9 443 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WIW9 6.48e-20 96 25 7 377 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 6.48e-20 96 25 7 377 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8HHD2 6.7e-20 97 25 11 363 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q95918 7.81e-20 96 26 11 349 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
Q5HQL3 9.78e-20 95 24 6 357 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPV1 9.87e-20 95 24 6 357 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q0I6X0 1.41e-19 95 32 2 199 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
P92669 1.49e-19 95 26 13 365 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
C1F9D0 1.56e-19 95 28 7 326 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B0C4B4 1.57e-19 95 25 12 441 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
P48915 1.74e-19 95 24 8 327 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
A9BD08 1.81e-19 95 32 1 185 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
Q9ZZ44 1.94e-19 95 28 11 325 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
O78688 2e-19 95 27 9 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q3B063 2.18e-19 95 28 5 302 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q19V60 2.24e-19 95 27 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
O67391 2.49e-19 94 26 10 338 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Aquifex aeolicus (strain VF5)
P34195 2.74e-19 94 27 9 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
A0KJ55 2.97e-19 94 28 12 384 3 nuoN NADH-quinone oxidoreductase subunit N Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P29388 3e-19 94 27 12 350 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
P26848 3.01e-19 94 24 5 290 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
Q8MA16 3.25e-19 94 26 5 317 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chaetosphaeridium globosum
Q7NGP8 3.35e-19 94 27 14 456 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9RUA0 3.36e-19 94 29 6 305 3 nuoN NADH-quinone oxidoreductase subunit N Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B2J565 3.45e-19 94 27 9 328 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P55782 3.55e-19 94 27 9 304 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
Q37617 3.76e-19 94 25 4 295 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q17Z65 4.37e-19 93 24 8 369 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter acinonychis (strain Sheeba)
P9WIW5 4.41e-19 94 24 10 395 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 4.41e-19 94 24 10 395 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9I0I9 4.6e-19 93 28 5 296 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B1X5V5 4.69e-19 94 27 9 385 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
O79556 4.98e-19 94 28 13 342 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
Q9MIY0 4.99e-19 94 27 8 284 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
P32421 5.04e-19 93 24 5 352 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
C6D5D2 5.06e-19 93 27 13 351 3 nuoN NADH-quinone oxidoreductase subunit N Paenibacillus sp. (strain JDR-2)
Q4JQH7 5.53e-19 94 27 9 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
Q6A6H1 5.69e-19 93 26 9 395 3 nuoN NADH-quinone oxidoreductase subunit N Cutibacterium acnes (strain DSM 16379 / KPA171202)
A9R6K9 6.23e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Angola)
B7K1G4 6.69e-19 93 25 10 389 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
P56911 6.72e-19 93 25 8 342 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Rhizobium meliloti (strain 1021)
Q3AC87 6.92e-19 93 26 12 395 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P24979 7.08e-19 93 27 9 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
B3E9V6 7.13e-19 93 25 10 370 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B1JGM5 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669B2 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM24 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis (strain Pestoides F)
Q1CHR3 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CJ84 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis
B2K809 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6C1 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGR6 7.19e-19 93 27 10 418 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1SE40 8.9e-19 93 25 17 498 3 nuoN NADH-quinone oxidoreductase subunit N Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8DMR6 9.34e-19 92 27 9 336 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O03174 9.75e-19 93 27 11 310 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
Q10ZG8 1.04e-18 92 29 5 301 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
Q5N060 1.05e-18 92 25 7 394 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 1.05e-18 92 25 7 394 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L446 1.06e-18 92 23 6 373 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
C4LB43 1.08e-18 92 29 7 300 3 nuoN NADH-quinone oxidoreductase subunit N Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A5FQX9 1.25e-18 92 23 10 388 3 nuoN NADH-quinone oxidoreductase subunit N Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q64Y15 1.35e-18 92 23 5 330 3 nuoN NADH-quinone oxidoreductase subunit N Bacteroides fragilis (strain YCH46)
Q8KX56 1.46e-18 92 27 7 293 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B0JPG4 1.46e-18 92 24 9 397 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q37376 1.46e-18 92 23 10 385 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Acanthamoeba castellanii
P93313 1.73e-18 92 25 6 297 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
A2T383 2.05e-18 91 26 3 293 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
Q9B8C9 2.06e-18 92 23 13 453 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0LEQ8 2.18e-18 91 26 6 313 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B7GME1 2.29e-18 91 28 9 358 3 nuoN NADH-quinone oxidoreductase subunit N Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A4G631 2.33e-18 91 25 10 374 3 nuoN NADH-quinone oxidoreductase subunit N Herminiimonas arsenicoxydans
Q8YQ78 2.72e-18 91 24 4 336 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B4U8I1 2.81e-18 91 26 11 363 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Hydrogenobaculum sp. (strain Y04AAS1)
A1ALQ2 2.91e-18 90 25 10 381 3 nuoN NADH-quinone oxidoreductase subunit N Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q9B6D3 2.94e-18 91 24 16 436 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
P18940 3.37e-18 91 28 10 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q36459 3.78e-18 91 26 12 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
Q3MCB9 3.79e-18 90 23 7 394 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MAR0 4.56e-18 90 32 1 185 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q1ACE9 4.68e-18 90 24 9 395 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
Q8YM86 4.75e-18 90 32 1 185 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O05229 5.12e-18 90 24 4 348 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
O79678 6.06e-18 90 26 12 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
Q81K10 6.19e-18 90 24 6 381 3 nuoN NADH-quinone oxidoreductase subunit N Bacillus anthracis
Q49VH2 6.94e-18 90 26 7 279 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q47LF7 7.32e-18 90 32 8 285 3 nuoN NADH-quinone oxidoreductase subunit N Thermobifida fusca (strain YX)
A1USY0 8.1e-18 89 27 10 308 3 nuoN NADH-quinone oxidoreductase subunit N Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q8M9U1 8.18e-18 89 27 5 316 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
Q5ZNA1 8.89e-18 89 29 2 207 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Zaglossus bruijni
Q8W9M7 8.98e-18 89 25 5 304 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Dugong dugon
Q9TL07 9.19e-18 89 27 7 361 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Nephroselmis olivacea
A5FXI8 9.31e-18 89 29 8 334 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Acidiphilium cryptum (strain JF-5)
A8GH04 1.12e-17 89 27 14 403 3 nuoN NADH-quinone oxidoreductase subunit N Serratia proteamaculans (strain 568)
P27572 1.16e-17 89 26 6 297 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
Q9TKV8 1.25e-17 89 28 5 299 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
C4XGW8 1.3e-17 89 25 9 396 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
O47497 1.36e-17 89 24 8 375 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
Q2W3J7 1.38e-17 89 24 9 378 3 nuoN NADH-quinone oxidoreductase subunit N Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q36458 1.43e-17 89 30 2 207 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Ornithorhynchus anatinus
Q3MB63 1.43e-17 89 26 10 387 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DKY0 1.44e-17 89 23 7 372 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8YMQ0 1.68e-17 89 26 10 387 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6GJ44 1.74e-17 89 22 6 375 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
P93401 1.79e-17 88 27 9 331 2 ND2 NADH-ubiquinone oxidoreductase chain 2 Oenothera berteroana
B1WUS5 2.09e-17 88 26 8 384 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8K9X7 2.12e-17 89 26 12 332 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9MUQ6 2.29e-17 88 28 8 356 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
P06263 2.48e-17 88 28 6 298 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
Q9MIY1 2.57e-17 88 30 4 212 3 mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Danio rerio
O21047 3.01e-17 88 24 5 304 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
Q2RU27 3.14e-17 87 27 9 306 3 nuoN NADH-quinone oxidoreductase subunit N Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q32RL9 3.44e-17 87 27 8 350 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
P0CD37 3.5e-17 87 27 7 323 3 ndhB2 NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic Psilotum nudum
P0CD36 3.5e-17 87 27 7 323 3 ndhB1 NAD(P)H-quinone oxidoreductase subunit 2 A, chloroplastic Psilotum nudum
Q5N5T8 3.81e-17 87 27 8 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 3.81e-17 87 27 8 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q19V61 4.11e-17 87 27 4 289 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
Q6YXR9 4.24e-17 87 27 6 280 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
B1ZUK1 4.26e-17 87 25 8 425 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q5GS15 4.29e-17 87 24 10 362 3 nuoN NADH-quinone oxidoreductase subunit N Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q85FH5 4.36e-17 87 26 6 308 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q8NXT1 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 4.5e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q09WW8 4.57e-17 87 25 3 304 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
Q0Q2J7 5.21e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
A4WCQ5 5.33e-17 87 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
P55781 5.62e-17 87 30 2 201 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Gadus morhua
A1JLL1 5.78e-17 87 27 12 382 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P10330 6.19e-17 87 26 11 347 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
B8G6L3 6.91e-17 87 24 11 429 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aggregans (strain MD-66 / DSM 9485)
O05000 7e-17 87 27 9 330 1 ND2 NADH-ubiquinone oxidoreductase chain 2 Arabidopsis thaliana
Q7A725 7.29e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 7.29e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 7.29e-17 87 22 6 379 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
B2VIN7 7.63e-17 86 26 9 375 3 nuoN NADH-quinone oxidoreductase subunit N Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P34194 8.35e-17 86 31 2 185 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Formosania lacustris
Q19V78 8.43e-17 86 27 5 328 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chlorokybus atmophyticus
Q35813 8.57e-17 87 27 11 342 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q118H6 8.66e-17 86 24 7 393 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
C5D978 8.67e-17 86 27 8 313 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
O67342 8.68e-17 86 26 5 318 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
P12776 8.7e-17 87 27 13 379 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
Q8CQ47 1e-16 86 25 8 339 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11150
Feature type CDS
Gene -
Product hydrogenase 4 subunit F
Location 369678 - 371258 (strand: 1)
Length 1581 (nucleotides) / 526 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_862
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0651 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)
CP Formate hydrogenlyase subunit 3/Multisubunit Na+/H+ antiporter, MnhD subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12141 hydrogenase-4 component F [EC:1.-.-.-] - -

Protein Sequence

MSQTMLLTLLMATPLVISLLAFICRALGGGAKAAVTLVHTVGIVLLLVFSLWMVYTIGEEGDLLMAERWIHLDSLAGLFLAILGIVGFLTGLYSIGYMNHEVADGEISVGTLCNYYGFFHLFLFTMLLVITSNNLILMWAAVEATTLSSAFLVGIYGQRSSLEAAWKYIIICSVGVAFGLFGTILVYANAASVMPDPELAIFWTEVLKYTSLLDPTLMQLAFVFVLIGFGTKTGLFPMHAWLPDAHSEAPSPVSALLSAVLLNCALLIIVRYYIIITSAIGGEFTQTLLLVFGLLSVAVAAFFILIQRDMKRLLAYSSVENMGLIAVALGIGGPLGVLAALLHTLNHSLGKTLLFCGSGNVLLKYGTRDISVVKGMLRTMPFTAVVFAGGALALGGMPPFNVFLSEFMVVVAGLAANHFWLTLLLLILLTIVLGGLVRMVSKTLFGAQPDCVSRGELGLLTTLPMAILIVLMLVMGTHIPQPVSRLLENAATIVLTDSSLPGTELTTPDYRWPWGVDTTSISSQEK

Flanking regions ( +/- flanking 50bp)

GCTCAACACACTGAACGTGGATCAACTGACCGCGCTGAAGGGGTGATGAGATGAGCCAAACCATGTTGTTAACGTTATTAATGGCAACGCCGCTGGTGATTTCACTGCTGGCGTTTATCTGCCGCGCACTGGGCGGCGGTGCAAAAGCCGCTGTCACCCTGGTGCATACTGTGGGTATCGTGCTGCTGCTCGTATTTTCTCTGTGGATGGTTTACACCATCGGTGAAGAAGGCGATCTGCTGATGGCAGAGCGCTGGATCCATCTGGACAGCCTGGCGGGGTTATTCCTGGCTATCCTGGGTATTGTCGGCTTCCTGACAGGGCTTTACTCCATCGGCTATATGAATCATGAAGTGGCTGATGGTGAGATTAGTGTCGGAACACTCTGTAATTATTATGGATTTTTCCATCTGTTCCTGTTCACCATGCTGCTGGTTATCACCAGTAACAACCTGATCCTGATGTGGGCGGCGGTTGAAGCCACAACACTCAGTTCAGCGTTTCTGGTGGGGATTTACGGACAGCGCTCTTCTCTTGAAGCGGCGTGGAAATACATCATTATCTGTAGTGTGGGTGTGGCATTTGGTCTGTTCGGTACCATTCTGGTTTATGCAAACGCCGCAAGCGTGATGCCTGATCCGGAACTGGCTATCTTCTGGACGGAAGTGCTGAAATATACCTCACTGCTTGATCCGACTCTGATGCAACTGGCATTTGTGTTTGTGCTGATTGGTTTCGGTACAAAAACCGGGCTGTTCCCGATGCACGCCTGGCTGCCGGATGCGCACAGTGAAGCACCAAGCCCGGTATCAGCGCTGCTCTCAGCGGTTCTGCTGAACTGTGCGCTGCTGATTATCGTGCGCTACTACATCATTATCACCTCTGCTATCGGCGGTGAATTCACACAAACACTGCTGCTGGTCTTCGGGCTGCTCTCTGTGGCGGTTGCTGCGTTCTTTATCCTTATTCAGCGGGATATGAAACGTCTGCTGGCGTATTCCAGTGTGGAAAACATGGGGCTTATCGCAGTGGCTCTGGGTATCGGCGGTCCGTTAGGTGTGCTGGCAGCGCTGCTGCACACACTGAATCACAGCCTGGGTAAAACCCTGCTGTTCTGTGGCTCCGGTAACGTATTACTGAAATACGGCACCCGTGATATCAGTGTTGTCAAAGGTATGCTGCGTACCATGCCGTTTACCGCGGTCGTCTTTGCGGGCGGTGCGCTGGCACTGGGCGGTATGCCGCCGTTTAACGTCTTCCTGAGTGAGTTTATGGTGGTGGTTGCCGGTCTGGCAGCCAATCATTTCTGGCTGACGCTGCTCCTTTTGATCCTGCTCACTATCGTTCTCGGCGGGTTGGTTAGAATGGTATCGAAAACCTTATTCGGCGCACAGCCTGACTGTGTATCGCGCGGCGAATTAGGGCTCCTGACGACATTGCCGATGGCCATCCTCATAGTACTGATGCTGGTGATGGGCACCCACATCCCGCAGCCGGTCAGCCGTCTGCTCGAAAATGCCGCCACGATTGTCCTGACGGACAGTTCATTACCAGGCACAGAATTAACCACCCCGGACTACCGCTGGCCGTGGGGTGTTGATACAACATCCATATCATCGCAGGAGAAATAACGTGAGCTATCAGAATTATACAGATACCCTTCATGGCGTTCGTAAAGGCG