Homologs in group_434

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00385 FBDBKF_00385 51.8 Morganella morganii S1 rcsC two-component system sensor histidine kinase RcsC
EHELCC_01160 EHELCC_01160 51.8 Morganella morganii S2 rcsC two-component system sensor histidine kinase RcsC
NLDBIP_02300 NLDBIP_02300 51.8 Morganella morganii S4 rcsC two-component system sensor histidine kinase RcsC
LHKJJB_03815 LHKJJB_03815 51.8 Morganella morganii S3 rcsC two-component system sensor histidine kinase RcsC
HKOGLL_03230 HKOGLL_03230 51.8 Morganella morganii S5 rcsC two-component system sensor histidine kinase RcsC
F4V73_RS06365 F4V73_RS06365 52.6 Morganella psychrotolerans rcsC two-component system sensor histidine kinase RcsC

Distribution of the homologs in the orthogroup group_434

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_434

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DMC5 0.0 848 46 11 954 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 0.0 847 46 11 954 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P58662 0.0 815 44 9 952 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 0.0 813 44 9 952 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P48027 2.95e-53 204 30 15 523 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q9F8D7 5.19e-53 204 28 10 522 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P59342 6.31e-52 200 32 13 515 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0AEC5 1.22e-50 196 31 13 515 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.22e-50 196 31 13 515 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.22e-50 196 31 13 515 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q54U87 4.39e-44 177 40 4 261 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54U87 4.23e-11 71 32 2 119 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54YH4 2.38e-41 169 37 3 262 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YH4 5.79e-12 73 27 3 147 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q5AHA0 2.45e-41 169 27 14 512 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q87GU5 1.01e-40 165 33 2 277 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87GU5 5.15e-07 57 27 1 116 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P58356 1.74e-39 162 38 2 230 3 torS Sensor protein TorS Escherichia coli O157:H7
P39453 1.97e-38 158 38 2 230 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q9KLK7 3.74e-38 157 34 1 250 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLK7 0.000219 48 24 2 143 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P54302 1.17e-37 155 34 3 254 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P54302 1.85e-06 55 28 1 116 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q3S4A7 1.77e-37 155 35 4 271 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q3S4A7 7.19e-10 67 26 1 142 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P16575 7.67e-37 154 37 7 261 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P16575 4e-16 87 41 2 124 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q54YZ9 8.21e-37 154 39 2 235 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YZ9 4.15e-13 77 34 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
O14002 1.34e-36 154 35 3 282 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14002 1.07e-09 66 31 2 128 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P26762 4.6e-36 151 37 7 261 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P26762 1.39e-16 89 42 2 119 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P40330 4.64e-36 151 37 7 261 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P40330 1.26e-16 89 42 2 119 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8ZPP5 8.22e-36 150 35 1 237 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZPP5 1.03e-06 56 27 1 112 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0C0F6 1.49e-35 148 34 1 243 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F6 7.23e-08 60 29 1 116 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 1.54e-35 148 34 1 243 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F7 9.58e-08 59 29 1 116 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q86CZ2 3.6e-34 145 29 4 305 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q86CZ2 5.96e-14 80 33 1 121 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q41342 4.52e-34 144 31 8 339 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q41342 2.24e-05 52 25 3 124 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q54RP6 6.48e-34 145 39 3 218 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q54RP6 5.27e-15 84 34 2 124 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q7MD16 1.39e-33 143 32 1 252 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q7MD16 3.46e-10 67 34 1 120 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 1.76e-33 142 32 1 252 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q8D5Z6 3.37e-10 67 34 1 120 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
O49230 2.48e-33 141 31 6 317 2 ETR1 Ethylene receptor 1 Brassica oleracea
O49230 0.000117 49 25 3 117 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9XH58 1.83e-32 139 28 9 360 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q9XH58 5.79e-08 60 27 4 140 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
P30855 1.94e-32 140 33 4 277 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P30855 5.39e-22 106 48 0 109 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q9XH57 2.31e-32 138 28 9 354 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9XH57 2.71e-05 52 27 2 116 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P44578 2.42e-32 132 32 4 249 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1A697 3.17e-32 139 23 13 604 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
O49187 3.25e-32 138 29 4 322 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
O49187 3.69e-07 57 29 3 119 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
O82436 3.58e-32 138 30 6 306 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
O82436 1.92e-06 55 29 3 117 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9ZWL6 4.3e-32 137 29 5 350 2 ETR1 Ethylene receptor Passiflora edulis
Q9ZWL6 0.000393 48 24 5 146 2 ETR1 Ethylene receptor Passiflora edulis
P58402 5.09e-32 139 33 4 277 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P58402 1.6e-21 104 47 0 109 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P49333 5.61e-32 137 30 7 321 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P49333 1.41e-05 52 26 3 118 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q53RH0 6.05e-32 136 36 3 244 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 6.05e-32 136 36 3 244 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q551X9 1.23e-31 137 31 10 363 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q551X9 6.43e-11 70 32 3 121 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q9SSY6 2.48e-31 135 30 6 306 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9SSY6 2.09e-06 55 29 3 117 2 ETR1 Ethylene receptor 1 Cucumis sativus
P58363 2.7e-31 135 35 7 234 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P58363 7.88e-10 66 30 4 142 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P0AEC4 2.8e-31 135 35 7 234 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC4 8.01e-10 66 30 4 142 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.8e-31 135 35 7 234 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P0AEC3 8.01e-10 66 30 4 142 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
Q9P896 3.46e-31 134 31 4 251 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P896 1.45e-11 72 34 2 116 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9C5U1 6.51e-31 135 30 3 281 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9C5U1 9.41e-09 63 27 2 123 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
O81122 1.1e-30 133 30 5 309 2 ETR1 Ethylene receptor Malus domestica
O81122 7.53e-05 50 27 3 117 2 ETR1 Ethylene receptor Malus domestica
Q38846 2.31e-30 131 29 4 313 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q5A599 2.47e-30 133 38 3 232 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A599 1.33e-09 66 30 1 111 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9M7M1 4.09e-30 131 32 2 235 2 ETR1 Ethylene receptor Prunus persica
Q9M7M1 0.000266 48 28 4 117 2 ETR1 Ethylene receptor Prunus persica
Q9HUI3 4.36e-30 132 33 2 252 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI3 8.36e-10 66 32 1 116 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9C5U2 9.05e-30 131 22 17 605 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9P7Q7 1.76e-29 130 30 1 262 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7Q7 9.87e-07 57 28 2 116 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q95PI2 5.36e-29 129 32 10 282 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q95PI2 1.03e-07 60 30 1 121 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q2T0V9 2.86e-28 124 33 3 227 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9SXL4 3.3e-28 126 30 6 292 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9SXL4 1.77e-06 55 24 5 154 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
O48929 5.38e-28 124 29 4 322 2 ETR1 Ethylene receptor Nicotiana tabacum
O48929 3.66e-07 57 28 3 119 2 ETR1 Ethylene receptor Nicotiana tabacum
Q9KHI5 8.46e-28 124 36 5 228 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q52969 2.55e-27 120 32 3 250 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
B8AY75 5.6e-27 120 32 4 243 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q0DKM0 5.86e-27 120 32 4 243 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q869S5 7.57e-27 122 31 2 232 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q869S5 1.49e-12 75 34 2 117 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
T2KMF4 8.36e-27 122 32 9 263 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
T2KMF4 1.21e-07 59 33 2 106 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
E0X9C7 1.15e-26 121 32 4 229 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 1.26e-09 66 28 10 237 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 2.76e-05 52 32 3 131 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 1.22e-26 121 32 4 229 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 1.24e-09 66 28 10 237 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 4.14e-05 51 32 3 131 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A7N6S2 2.49e-26 119 24 18 541 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P23545 5.83e-26 117 30 3 229 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q8DKG0 6.52e-26 118 34 3 241 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A2WYI4 1.13e-25 118 27 7 348 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A2WYI4 2.56e-06 55 25 2 122 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 1.2e-25 118 27 7 348 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A1A696 2.63e-06 55 25 2 122 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q8KIY1 1.27e-25 117 30 4 239 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 1.87e-12 75 26 9 284 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 0.000478 47 32 2 109 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P74111 2.6e-25 116 32 5 265 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54SP4 2.94e-25 117 30 5 253 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 3.68e-18 94 28 7 292 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 2.82e-05 52 28 3 126 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 0.000219 49 32 2 104 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q55E44 5.72e-25 116 35 5 212 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 1.37e-11 72 34 3 119 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 1.36e-07 59 45 1 70 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
A1A699 2.09e-24 114 37 0 151 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 3.84e-10 67 28 4 157 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
P37894 3.44e-24 113 31 6 252 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q03228 3.05e-23 108 29 6 259 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6X5X4 4.03e-23 110 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A9M715 7.04e-23 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q45614 9.7e-23 107 29 4 234 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q8FZ86 9.75e-23 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 1.03e-22 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRX4 1.03e-22 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57BR6 1.12e-22 108 29 5 263 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.12e-22 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.12e-22 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8YIM6 1.16e-22 108 29 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P42245 1.79e-22 102 28 3 233 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q8DPL8 2.17e-22 105 27 8 324 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 2.17e-22 105 27 8 324 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A1A698 2.57e-22 107 36 2 159 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 4.44e-09 64 30 3 123 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 1.61e-06 55 39 0 73 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
O34206 3.09e-22 105 26 5 256 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q9P4U6 3.76e-22 106 25 10 341 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P4U6 3.92e-06 54 28 3 177 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B1WYT4 4.53e-22 102 31 6 231 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A3BE68 4.69e-22 106 33 3 183 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 3.25e-12 74 47 1 82 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 2.2e-11 72 27 1 147 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 4.98e-22 106 33 3 183 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 3.4e-12 74 47 1 82 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 2.29e-11 71 27 1 147 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q55630 6.28e-22 102 31 6 236 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54Q69 6.92e-22 106 28 11 403 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 2.73e-08 62 30 2 122 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P20169 7e-22 105 31 7 242 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9C5U0 7.99e-22 105 35 0 159 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 9.55e-19 95 24 13 382 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
P94414 1.54e-21 102 29 3 241 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P35164 6.83e-21 101 28 6 239 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
O74539 1.17e-20 102 28 6 258 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74539 9.21e-08 60 27 2 122 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9RQQ9 1.91e-20 100 26 6 269 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B7K3M6 2.38e-20 97 30 6 230 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P39928 1.3e-19 98 26 12 366 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 0.000181 49 33 2 135 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2JWK9 1.61e-19 95 30 6 235 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
O69729 1.85e-19 96 28 8 246 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B2J946 2.38e-19 95 30 6 236 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P30847 4.71e-19 95 26 4 241 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
B0JK50 5.38e-19 93 29 5 231 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q1XD95 8.42e-19 95 29 6 241 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q2JKD9 1.03e-18 92 30 6 228 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P08400 2.67e-18 92 26 11 336 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q8GP19 3.33e-18 92 24 4 229 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q0IBF4 4.73e-18 90 26 10 297 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
O22267 5.2e-18 93 25 7 283 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
O22267 9e-07 57 30 5 147 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q9ZHD4 6.88e-18 91 27 5 239 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q7A5H7 1.6e-17 90 29 8 235 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 1.6e-17 90 29 8 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P45609 1.66e-17 89 25 9 331 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q55932 1.68e-17 90 26 3 222 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06904 1.79e-17 89 28 6 229 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8NWF3 1.95e-17 90 29 8 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.95e-17 90 29 8 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.95e-17 90 29 8 235 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.95e-17 90 29 8 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 2.02e-17 90 29 8 235 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6GGK7 2.04e-17 90 29 8 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
P23621 2.3e-17 89 30 3 228 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7KFU0 2.56e-17 89 29 5 231 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P45608 2.98e-17 89 25 11 336 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P33529 3.15e-17 90 25 11 349 2 PHY Phytochrome Mougeotia scalaris
P94608 3.4e-17 90 30 6 231 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q07737 3.55e-17 89 27 6 254 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KM66 7e-17 89 22 15 518 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0QR01 9.16e-17 87 27 5 224 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P39838 1.09e-16 89 22 20 574 1 rcsD Phosphotransferase RcsD Escherichia coli (strain K12)
Q40762 1.21e-16 89 27 10 275 2 None Phytochrome Picea abies
Q86AT9 2.09e-16 88 34 2 166 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 1.08e-12 76 34 2 123 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 3.66e-05 51 33 2 115 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q8DMT2 2.35e-16 85 29 6 240 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9RDT3 2.76e-16 85 28 10 239 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
P08401 4.08e-16 85 24 7 245 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q8FK37 4.4e-16 85 26 6 238 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77485 4.68e-16 85 26 6 238 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q44007 6.77e-16 85 27 6 238 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A6QD58 7.33e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q8YR50 8.53e-16 84 28 7 243 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8XBY4 8.71e-16 85 26 6 241 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q7A215 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 9.11e-16 85 27 10 240 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 9.11e-16 85 27 10 240 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 9.11e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GKS6 9.19e-16 85 27 10 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P51392 1.08e-15 85 28 6 241 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
P52101 1.14e-15 84 28 7 231 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q3M8A7 1.15e-15 84 28 7 243 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P72292 1.16e-15 85 27 7 251 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P18769 1.49e-15 85 24 12 367 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q8XA47 1.77e-15 84 28 7 234 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q4L8M0 2.69e-15 83 27 7 240 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
A5A2P0 3.02e-15 82 26 6 226 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q8CU87 3.19e-15 83 27 8 236 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 3.19e-15 83 27 8 236 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7V6P7 3.22e-15 82 27 8 256 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
A0A0H3GPN8 3.35e-15 82 25 5 238 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
O34989 3.56e-15 83 26 5 229 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P21865 3.64e-15 84 24 5 237 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
P0DMK6 4.22e-15 82 23 4 253 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q55168 4.22e-15 83 26 5 246 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06067 4.52e-15 83 28 12 277 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q4A159 5.59e-15 82 25 7 236 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7BWI3 5.62e-15 81 25 10 292 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q4LAJ8 5.72e-15 82 25 8 268 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9HWR3 5.96e-15 83 29 8 240 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P18540 7e-15 83 29 9 255 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
I1WSZ3 8.41e-15 81 22 4 253 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
A2C884 9.07e-15 80 27 8 255 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q7U871 9.75e-15 80 27 9 270 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
P33113 1.05e-14 81 24 4 246 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P14377 1.08e-14 81 27 7 222 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q51455 1.2e-14 74 38 2 113 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37739 1.21e-14 82 26 6 226 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q01549 1.21e-14 82 26 8 280 3 PHY1 Phytochrome 1 Selaginella martensii
P36505 1.37e-14 82 26 7 245 2 PHY1 Phytochrome 1 Physcomitrium patens
Q8X614 1.4e-14 80 26 7 222 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q3AYV8 1.63e-14 80 26 9 270 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P0C5S6 1.76e-14 81 37 1 111 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
A7HD43 1.79e-14 80 26 8 224 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
A7MRY4 1.85e-14 81 37 1 111 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
Q93CB7 2.9e-14 80 27 3 242 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q39557 4.28e-14 80 26 8 266 3 PHY2 Phytochrome 2 Ceratodon purpureus
P0AE82 5.38e-14 79 25 5 238 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 5.38e-14 79 25 5 238 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 5.38e-14 79 25 5 238 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q9M8Y4 6.23e-14 73 38 2 109 2 ARR22 Two-component response regulator ARR22 Arabidopsis thaliana
P19862 7.41e-14 80 30 8 224 3 PHYA1 Phytochrome A Zea mays
P51586 9.23e-14 72 36 1 108 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P0A2D5 1.23e-13 72 37 3 123 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 1.23e-13 72 37 3 123 3 cheY Chemotaxis protein CheY Salmonella typhi
A0QTK3 1.26e-13 78 24 2 241 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9FAD7 1.69e-13 71 35 3 123 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P71380 1.76e-13 77 26 5 223 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54883 2.06e-13 77 25 6 288 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q93P00 2.12e-13 71 36 3 123 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q9APE0 2.6e-13 77 25 9 261 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q8D0P1 2.64e-13 70 36 3 123 3 cheY Chemotaxis protein CheY Yersinia pestis
Q08408 2.65e-13 77 22 4 233 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
O31671 2.82e-13 77 24 4 221 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q8FW53 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 3.05e-13 70 30 1 118 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 3.05e-13 70 30 1 118 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
P0AE69 4.13e-13 70 35 3 123 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 4.13e-13 70 35 3 123 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 4.13e-13 70 35 3 123 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q9KQD5 4.81e-13 70 34 2 115 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 4.81e-13 70 34 2 115 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8FGP6 5.26e-13 70 35 3 123 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P9WGK5 5.58e-13 75 25 4 225 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 5.58e-13 75 25 4 225 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 5.58e-13 75 25 4 225 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9LCC2 5.8e-13 76 26 6 240 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2FWH7 7.94e-13 76 25 8 255 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q04804 9e-13 75 25 7 229 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49ZT9 1.17e-12 75 26 7 244 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O25153 1.28e-12 75 20 11 395 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q8Z332 1.4e-12 74 27 9 232 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P15939 1.54e-12 75 24 7 267 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HZ47 1.58e-12 74 23 5 243 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL3 1.76e-12 75 25 7 249 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P08982 1.76e-12 74 22 6 237 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.76e-12 74 22 6 237 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P9WGL2 1.85e-12 75 25 7 249 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O69730 2.15e-12 71 32 0 113 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q41046 2.23e-12 75 23 6 233 2 None Phytochrome Pinus sylvestris
P18392 2.42e-12 73 24 4 224 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P37461 3.52e-12 73 27 9 232 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HU20 3.85e-12 73 23 7 242 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P07168 4.68e-12 73 27 8 247 3 virA Wide host range VirA protein Rhizobium radiobacter
A6X580 4.7e-12 67 28 1 118 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q31AE8 4.97e-12 72 26 9 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
P10799 5.6e-12 73 27 8 247 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
F4JZT3 6.92e-12 67 33 1 113 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
P06594 6.97e-12 73 27 8 248 1 PHYA4 Phytochrome A type 4 Avena sativa
A0A4P7TSF2 7.71e-12 72 24 8 250 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 7.71e-12 72 24 8 250 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 7.71e-12 72 24 8 250 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P93528 1.16e-11 72 27 9 273 2 PHYC Phytochrome C Sorghum bicolor
Q08430 1.24e-11 71 25 7 248 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P41406 1.82e-11 71 21 6 237 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
P29130 2.42e-11 71 25 6 216 2 PHYB Phytochrome B Nicotiana tabacum
P16497 2.65e-11 71 25 8 262 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P30733 2.71e-11 71 27 6 246 2 PHYA Phytochrome A Solanum tuberosum
A3PDI2 2.93e-11 70 26 10 245 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P9WGK8 3.05e-11 70 24 4 249 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 3.05e-11 70 24 4 249 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CCJ1 3.3e-11 70 23 4 247 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
O31661 3.34e-11 70 24 11 285 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q54W36 3.34e-11 71 31 2 154 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 8.19e-08 60 30 5 133 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 7.51e-06 53 38 0 75 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q9WY30 3.44e-11 69 36 2 109 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2HWH1 4.53e-11 64 33 2 104 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 4.53e-11 64 33 2 104 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
P9WGK9 4.79e-11 70 23 4 249 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A2BRQ6 5.78e-11 68 25 7 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
P93526 6.53e-11 70 28 10 252 2 PHYA Phytochrome a Sorghum bicolor
Q8DMC5 6.72e-11 68 29 10 227 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P34094 7.05e-11 70 25 5 216 3 PHYB Phytochrome B Solanum tuberosum
Q8CTI3 8.38e-11 68 22 4 249 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 8.38e-11 68 22 4 249 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P39764 8.94e-11 68 24 11 272 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
A8G5E7 8.95e-11 68 26 10 245 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
P43501 9.48e-11 63 34 2 112 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P14712 1.17e-10 69 26 6 234 1 PHYA Phytochrome A Arabidopsis thaliana
A1W0A5 1.19e-10 63 33 3 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 1.19e-10 63 33 3 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 1.19e-10 63 33 3 116 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q04943 1.23e-10 68 23 7 260 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P71403 1.4e-10 63 34 3 116 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P48259 1.49e-10 65 36 1 102 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P33530 1.58e-10 68 27 6 246 3 PHYA1 Phytochrome A1 Nicotiana tabacum
Q8DXQ8 1.61e-10 67 24 5 221 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9ZS62 1.72e-10 68 25 5 216 2 PHYB1 Phytochrome B1 Solanum lycopersicum
Q9HWA7 1.89e-10 68 22 9 258 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5A872 2e-10 68 31 3 128 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.37e-09 66 34 1 101 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 7.42e-09 63 33 4 160 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2KCH7 2.05e-10 62 34 2 112 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8GVV6 2.08e-10 62 31 2 106 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 2.08e-10 62 31 2 106 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
P10955 2.09e-10 68 28 12 231 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q2HWG0 2.41e-10 62 30 2 113 2 RR13 Two-component response regulator ORR13 Oryza sativa subsp. japonica
Q9KSB1 2.43e-10 67 32 2 126 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q52977 2.44e-10 67 28 13 260 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
P07167 2.47e-10 68 24 13 325 3 virA Limited host range VirA protein Rhizobium radiobacter
Q2HWG4 2.69e-10 65 31 3 113 2 RR1 Two-component response regulator ORR1 Oryza sativa subsp. japonica
Q4GZL0 2.69e-10 65 31 3 113 2 RR1 Two-component response regulator ORR1 Oryza sativa subsp. indica
P06593 2.96e-10 68 27 9 259 1 PHYA3 Phytochrome A type 3 Avena sativa
O32193 3.16e-10 67 24 10 262 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q8E3C7 3.45e-10 66 24 5 221 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q47745 4.05e-10 67 26 7 211 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q2HWG1 4.3e-10 61 30 2 113 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
E5KK10 5.29e-10 67 25 7 248 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q9ZM64 5.32e-10 61 33 3 116 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q03069 5.65e-10 65 23 6 230 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
P14714 6.07e-10 67 27 7 213 1 PHYC Phytochrome C Arabidopsis thaliana
I1MGE5 6.24e-10 67 23 7 251 1 GLYMA_15G140000 Phytochrome B-2 Glycine max
P0A4I6 6.26e-10 66 23 5 233 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 6.26e-10 66 23 5 233 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O78428 7.9e-10 63 35 1 102 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q6H468 9.13e-10 61 32 2 104 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 9.13e-10 61 32 2 104 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
Q8THF6 9.26e-10 66 22 5 248 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P36557 9.51e-10 65 27 8 224 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1B3X8 9.56e-10 63 32 0 106 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 9.56e-10 63 32 0 106 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 9.56e-10 63 32 0 106 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q2RAP3 1.16e-09 62 32 2 122 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. japonica
Q4GZK2 1.16e-09 62 32 2 122 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. indica
Q2QXY3 1.17e-09 62 32 2 122 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. japonica
B8BLZ4 1.17e-09 62 32 2 122 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. indica
P28257 1.17e-09 63 35 1 102 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q7V113 1.37e-09 64 26 9 234 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P46384 1.52e-09 60 32 1 106 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06592 1.68e-09 65 27 8 253 2 PHYA Phytochrome A Cucurbita pepo
P28835 1.77e-09 62 29 1 107 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q10DU0 2.22e-09 65 26 8 245 2 PHYA Phytochrome A Oryza sativa subsp. japonica
A2XLG5 2.22e-09 65 26 8 245 3 PHYA Phytochrome A Oryza sativa subsp. indica
P38889 2.25e-09 65 29 0 114 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P09431 2.46e-09 63 24 11 297 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O34638 2.46e-09 64 23 6 240 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
P9WGM1 2.82e-09 62 33 0 89 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 2.82e-09 62 33 0 89 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 2.82e-09 62 33 0 89 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0R3I8 2.83e-09 62 32 0 106 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0PVB3 3.22e-09 61 30 2 104 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
P76340 3.41e-09 61 28 1 108 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
O82798 3.74e-09 62 29 2 126 1 ARR4 Two-component response regulator ARR4 Arabidopsis thaliana
P42499 3.89e-09 64 24 7 241 3 PHYB Phytochrome B Glycine max
Q7A0U4 4.76e-09 61 36 1 102 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 4.76e-09 61 36 1 102 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 4.76e-09 61 36 1 102 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 4.76e-09 61 36 1 102 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 4.76e-09 61 36 1 102 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 4.76e-09 61 36 1 102 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 4.76e-09 61 36 1 102 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 4.76e-09 61 36 1 102 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q75KW7 4.96e-09 58 29 2 121 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
Q47457 5.06e-09 63 25 5 224 3 pcoS Probable sensor protein PcoS Escherichia coli
P42707 5.67e-09 63 20 5 235 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
Q06240 5.94e-09 62 23 7 265 1 vanS Sensor protein VanS Enterococcus faecium
P38684 6.39e-09 60 32 1 106 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
Q2YY04 6.82e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A0W5 6.88e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 6.88e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q6GGZ4 6.88e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A5N3 6.88e-09 63 23 5 245 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 6.88e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 6.88e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 6.88e-09 63 23 5 245 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 6.88e-09 63 23 5 245 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q54SK5 8.15e-09 63 29 2 117 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
Q54SK5 2.87e-08 62 40 2 79 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
Q742C1 8.52e-09 60 30 0 108 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 8.52e-09 60 30 0 108 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P58357 8.61e-09 60 32 1 106 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q44930 8.8e-09 62 23 5 238 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q9TLQ4 9.06e-09 60 36 1 102 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
A1TEL7 9.06e-09 60 31 0 106 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q7XN30 1.01e-08 58 33 4 114 3 RR42 Two-component response regulator ORR42 Oryza sativa subsp. japonica
Q8NV46 1.03e-08 62 26 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.03e-08 62 26 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
A0PWB4 1.12e-08 60 31 0 106 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
A1KHB7 1.17e-08 60 31 0 106 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.17e-08 60 31 0 106 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P30844 1.24e-08 61 26 8 226 1 basS Sensor protein BasS Escherichia coli (strain K12)
A0QTK2 1.52e-08 59 35 1 100 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0DWC7 1.92e-08 62 19 7 292 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. japonica
Q7XQA6 2.08e-08 58 30 2 108 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
A2XYV5 2.1e-08 58 30 2 108 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
Q5SML4 2.14e-08 62 24 11 334 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
Q5SML4 2e-06 55 30 4 128 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 2.14e-08 62 24 11 334 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YA15 2e-06 55 30 4 128 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
P9WGM9 2.23e-08 59 31 0 106 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 2.23e-08 59 31 0 106 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 2.23e-08 59 31 0 106 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q44006 2.6e-08 58 30 1 108 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P96368 2.62e-08 61 27 7 236 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9CD68 2.69e-08 58 30 0 108 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P87323 3.11e-08 61 27 2 143 4 mcs4 Response regulator mcs4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HV27 3.51e-08 60 38 4 119 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42497 3.64e-08 61 23 6 215 1 PHYD Phytochrome D Arabidopsis thaliana
Q9SB04 3.75e-08 57 28 2 125 1 ARR5 Two-component response regulator ARR5 Arabidopsis thaliana
Q8Z333 3.86e-08 60 33 0 115 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P25852 3.93e-08 60 33 0 115 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8Z553 3.99e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 3.99e-08 60 25 4 239 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 3.99e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 3.99e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 3.99e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
P42421 4.11e-08 58 31 1 106 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P33639 4.11e-08 60 27 9 221 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9AE24 4.15e-08 58 31 1 116 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P0AEV3 4.58e-08 59 30 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 4.58e-08 59 30 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 4.58e-08 59 30 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q2YZ23 4.91e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9SHC2 5.1e-08 57 31 4 126 1 ARR16 Two-component response regulator ARR16 Arabidopsis thaliana
Q49XM6 5.46e-08 60 23 4 236 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q02540 5.8e-08 58 25 0 108 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q7A3X0 5.84e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 5.84e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 5.84e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 5.84e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 5.84e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE72 6.1e-08 60 25 4 239 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
P42244 6.11e-08 58 30 2 106 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P51358 6.5e-08 58 32 1 102 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q5HLN2 6.9e-08 57 30 1 109 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q50136 7.09e-08 57 31 0 89 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q8CSL7 7.18e-08 59 23 4 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1XDC9 7.27e-08 58 32 1 102 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q8CN92 7.29e-08 57 30 1 109 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O80365 7.53e-08 57 29 2 127 1 ARR8 Two-component response regulator ARR8 Arabidopsis thaliana
P9WGK7 7.71e-08 59 24 5 222 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 7.71e-08 59 24 5 222 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 7.71e-08 59 24 5 222 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23620 8.18e-08 57 33 1 105 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A2XM23 8.23e-08 60 26 10 266 3 PHYC Phytochrome C Oryza sativa subsp. indica
Q10CQ8 8.59e-08 60 26 10 266 2 PHYC Phytochrome C Oryza sativa subsp. japonica
P0AFB7 8.66e-08 58 22 11 297 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 8.66e-08 58 22 11 297 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 8.66e-08 58 22 11 297 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q7G8V2 9.03e-08 57 29 2 122 1 ARR15 Two-component response regulator ARR15 Arabidopsis thaliana
Q6GIT7 9.15e-08 58 24 9 258 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q9ZEP3 9.97e-08 59 23 9 246 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7A1J2 1e-07 58 24 9 258 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1e-07 58 24 9 258 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1e-07 58 24 9 258 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1e-07 58 24 9 258 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1e-07 58 24 9 258 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q49ZT8 1.02e-07 57 30 1 109 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9ZWS9 1.08e-07 57 27 2 120 1 ARR3 Two-component response regulator ARR3 Arabidopsis thaliana
Q8ZPP6 1.14e-07 59 34 3 98 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19906 1.15e-07 58 22 8 293 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q5HPC4 1.16e-07 58 23 4 240 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A039 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.16e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P93527 1.2e-07 59 23 8 252 1 PHYB Phytochrome B Sorghum bicolor
Q6T5K2 1.23e-07 59 19 4 248 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. indica
Q9ZTP3 1.27e-07 59 29 3 119 1 EIN4 Protein EIN4 Arabidopsis thaliana
Q9ZTP3 1.43e-05 52 21 5 244 1 EIN4 Protein EIN4 Arabidopsis thaliana
Q6GE73 1.37e-07 57 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q82EB2 1.39e-07 58 22 6 210 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9ZWS7 1.4e-07 56 28 2 124 1 ARR7 Two-component response regulator ARR7 Arabidopsis thaliana
Q6K9T0 1.43e-07 54 29 2 104 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 1.43e-07 54 29 2 104 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q840P7 1.46e-07 58 24 9 258 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q9ZWS6 1.48e-07 56 27 2 122 1 ARR6 Two-component response regulator ARR6 Arabidopsis thaliana
Q55890 1.6e-07 57 29 1 102 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9FPR6 1.7e-07 55 30 3 120 2 ARR17 Two-component response regulator ARR17 Arabidopsis thaliana
Q8X738 1.71e-07 56 30 0 102 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q9FXD6 1.82e-07 58 31 2 111 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
Q5HHW5 1.84e-07 57 24 9 258 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.84e-07 57 24 9 258 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.84e-07 57 24 9 258 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
P35163 1.96e-07 56 33 1 102 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q7XX84 2.01e-07 58 21 3 232 1 ETR2 Ethylene receptor 2 Oryza sativa subsp. japonica
Q7XX84 9.66e-05 50 27 8 180 1 ETR2 Ethylene receptor 2 Oryza sativa subsp. japonica
P13792 2.03e-07 56 30 0 102 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P37478 2.04e-07 56 33 1 102 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q8CQK0 2.08e-07 56 34 1 102 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 2.08e-07 56 34 1 102 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A6QJK3 2.23e-07 56 31 3 111 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 2.23e-07 56 31 3 111 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P42496 2.31e-07 58 25 7 236 2 PHY1 Phytochrome 1 Adiantum capillus-veneris
Q7A216 2.33e-07 56 34 1 102 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 2.33e-07 56 34 1 102 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 2.33e-07 56 34 1 102 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 2.33e-07 56 34 1 102 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08495
Feature type CDS
Gene rcsC
Product two-component system sensor histidine kinase RcsC
Location 1848619 - 1851447 (strand: -1)
Length 2829 (nucleotides) / 942 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_434
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF09456 RcsC Alpha-Beta-Loop (ABL)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07677 two-component system, NarL family, capsular synthesis sensor histidine kinase RcsC [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MRYLSSFKTSLKISRYLFRALGIMLWAMGALLTMFYLINIFNDTKSDIRQEYSNNYTDLLGFFRQTSSTIRDLQYLAERHQEQLNLNPKMNNSFFYEGPFSLHKLSESADCELFKGQTNNYFRSFNSILYYWKDNTPALQGINQVFMVGSHSMCMINFPLRASPIDTELLKKMVYENTRNYINQRAQGKESNQYWIVPDAKGDSGILYVMSPVYASGKFIALIGIERAIRLEYFSPTKDRVISIHLLNNKNNPVLSYPEENNYRSVRDVPDVSAPYFGFDDDFSDLVAKRKLLPSSFSVVYSLPLKQILNEFKFTIFNAIILNIISAIVIFIFVWIFERKIFSPAENNASRLEEHEQFNHKIVASAPVGISILRIRDGMIILSNELAHNYFRLLSHSDKQNILSIIAEKSSNIVDVVTNNHNHLQISFVNSRYQNEDVAICVLVDISARVKMERSLQNMATAAEQANQAKSMFLATVSHELRTPLYGIIGNLELLQSLTQNEETARLLKTMDNSSSLLLKIISDILDFSKIESKQLKIDVKPFNCRQVVSFVISNYLPLIAKKDLAIYCFIEPDVPKIVNNDPVRVQQVISNLLNNSIKFTTTGCITLHLYRDEYYLYFDIHDTGRGINEKMLHQLFEPFFQVSQNTESASEGTGLGLAICEKLINLMDGDISVVSQENVGSRFTVRIPLYGALNSSDGQTKYNLYKESTIRCFISIKNLYLESFVERYLSYVGLHCQLFTEVTQVSENDFIITDHDECLDNSCQFIRIYEHYFEPAKKISENNWLCSTYKLNELIKIILQLPQTKLESDDSENNALMTDHDLQLLTVLIVDDHPINRLLLTDQLKKIGFNTATAEDGCDALAFMQENHVDIILTDVNMPNMNGYQLATTVRELSRTIPIIGVTANAIAEEKQRCIDAGMNDCVSKPVSLTVLKDVLLTYVA

Flanking regions ( +/- flanking 50bp)

CTGTTAGAATGAGAAAGTTGATTATCTGTATTACCGATTAGGGTGGTTATTTGCGATATCTTTCGTCATTTAAAACGTCATTAAAAATTTCCCGCTACCTTTTTCGTGCACTGGGTATCATGTTGTGGGCAATGGGCGCATTATTAACCATGTTTTATCTCATCAACATCTTTAATGATACTAAATCAGATATCCGACAAGAATATAGTAATAACTATACCGATTTATTGGGCTTCTTTCGCCAAACCTCGAGTACTATCCGCGATTTGCAATATTTAGCAGAGCGGCATCAAGAGCAACTCAATTTAAACCCTAAGATGAATAATTCTTTTTTTTATGAAGGGCCTTTTTCACTTCATAAATTAAGTGAAAGTGCCGATTGTGAATTATTCAAAGGGCAAACAAACAATTATTTTCGATCATTTAATAGTATTCTGTATTACTGGAAAGATAATACCCCTGCTTTACAAGGTATCAACCAAGTATTTATGGTTGGCTCTCATAGTATGTGTATGATTAATTTCCCATTGCGTGCATCACCTATTGATACTGAACTGTTGAAAAAAATGGTTTATGAAAATACACGTAATTACATTAATCAACGAGCTCAAGGGAAAGAGAGTAATCAATACTGGATAGTACCTGATGCCAAGGGGGATAGCGGTATCCTCTATGTCATGTCGCCAGTTTATGCGTCAGGGAAATTTATTGCACTCATTGGTATCGAAAGGGCGATCCGATTGGAGTATTTTTCACCTACGAAAGATCGCGTTATCTCTATTCATCTTTTAAACAATAAAAATAATCCAGTCTTAAGTTATCCTGAAGAGAATAATTATCGCAGTGTAAGGGATGTACCGGATGTTAGTGCTCCTTACTTTGGCTTTGATGATGATTTTAGTGATTTAGTTGCAAAACGTAAGCTACTTCCTTCTTCTTTTAGTGTGGTTTATTCACTACCATTAAAACAAATTTTAAATGAATTTAAGTTTACTATTTTTAATGCCATTATTTTAAATATCATTTCGGCGATTGTTATCTTTATTTTCGTTTGGATTTTTGAGCGAAAAATATTTTCACCTGCAGAAAATAATGCTTCACGCTTAGAGGAGCATGAGCAGTTTAATCATAAAATTGTCGCGTCAGCCCCAGTAGGAATAAGTATCTTAAGAATACGTGATGGCATGATTATTTTAAGTAATGAGCTCGCCCATAATTATTTTCGCTTATTAAGTCATAGTGATAAACAAAATATTCTCTCTATTATTGCTGAAAAAAGTAGCAATATAGTGGATGTGGTCACTAATAATCATAATCATTTGCAAATTAGTTTTGTGAATTCACGTTATCAGAATGAAGATGTGGCGATTTGCGTATTAGTAGATATCAGCGCTCGTGTTAAAATGGAACGCTCTCTACAAAATATGGCAACGGCCGCAGAACAAGCAAACCAAGCTAAATCAATGTTCTTAGCGACAGTCAGCCATGAGCTGCGTACACCACTGTATGGCATTATTGGTAACTTAGAATTATTACAATCATTGACGCAAAATGAAGAGACTGCCAGATTATTAAAAACAATGGATAACTCTTCATCGCTGCTACTCAAAATTATCAGCGATATCCTTGATTTCTCGAAGATAGAATCGAAACAATTAAAAATTGACGTTAAACCATTCAATTGTCGCCAAGTTGTCTCTTTTGTTATCTCTAACTATTTGCCGTTAATTGCTAAAAAAGATTTAGCTATTTACTGCTTTATTGAGCCGGATGTACCTAAAATCGTTAATAACGATCCGGTTCGTGTCCAACAAGTTATCTCTAATCTACTAAATAATAGTATTAAATTTACTACGACAGGATGTATTACTTTGCACCTGTATCGAGATGAATATTATCTCTATTTCGATATTCATGATACCGGCAGAGGGATAAATGAAAAAATGCTTCATCAGCTTTTTGAACCCTTCTTTCAGGTCTCGCAAAATACAGAAAGTGCTTCAGAAGGTACAGGATTAGGATTAGCAATTTGTGAAAAACTGATTAACTTGATGGATGGTGATATCAGTGTTGTTTCTCAAGAAAATGTGGGTAGCCGTTTTACTGTGCGGATCCCTTTATATGGGGCACTAAATTCGAGTGATGGACAAACCAAATATAATCTCTATAAAGAGAGTACTATTCGCTGCTTTATCAGTATTAAAAATCTCTATCTAGAAAGCTTTGTTGAACGATATCTAAGTTATGTGGGCTTACATTGTCAATTATTCACGGAAGTGACTCAGGTATCTGAGAATGATTTTATTATCACCGATCATGATGAATGTTTAGATAACTCTTGCCAATTTATCCGTATTTATGAACACTATTTTGAGCCTGCAAAGAAAATCTCTGAGAATAATTGGTTATGTAGTACATATAAATTAAATGAATTAATTAAGATTATCCTACAATTACCACAAACAAAATTAGAGTCTGATGACTCAGAAAATAATGCGTTAATGACGGATCACGATCTACAATTATTGACAGTGCTCATTGTTGATGATCACCCTATCAATCGTTTATTGTTGACCGATCAACTGAAAAAAATTGGTTTTAATACCGCAACGGCAGAAGATGGCTGTGATGCTTTAGCCTTTATGCAAGAAAATCATGTCGATATTATTTTAACCGATGTCAATATGCCAAATATGAATGGCTATCAATTAGCGACAACAGTGCGTGAATTGAGTCGCACTATTCCTATTATTGGCGTTACAGCAAATGCAATTGCCGAAGAAAAACAACGTTGTATTGATGCGGGAATGAATGATTGTGTTTCCAAGCCAGTCTCTCTTACTGTATTAAAAGACGTATTACTCACCTATGTGGCATAATCCAACGATTAATCTCGGAAAAACGAGGTTTTTTCATGGTAGATCTGATT