Homologs in group_510

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_01160 EHELCC_01160 100.0 Morganella morganii S2 rcsC two-component system sensor histidine kinase RcsC
NLDBIP_02300 NLDBIP_02300 100.0 Morganella morganii S4 rcsC two-component system sensor histidine kinase RcsC
LHKJJB_03815 LHKJJB_03815 100.0 Morganella morganii S3 rcsC two-component system sensor histidine kinase RcsC
HKOGLL_03230 HKOGLL_03230 100.0 Morganella morganii S5 rcsC two-component system sensor histidine kinase RcsC
F4V73_RS06365 F4V73_RS06365 85.9 Morganella psychrotolerans rcsC two-component system sensor histidine kinase RcsC
PMI_RS08495 PMI_RS08495 51.8 Proteus mirabilis HI4320 rcsC two-component system sensor histidine kinase RcsC

Distribution of the homologs in the orthogroup group_510

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_510

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DMC5 0.0 799 43 7 950 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 0.0 796 43 7 950 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q56128 0.0 779 43 10 954 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 0.0 778 43 10 954 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9F8D7 2.38e-53 204 30 7 519 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q3S4A7 1.17e-51 199 27 13 590 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P48027 1.15e-50 196 30 11 534 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q5A599 7.6e-49 192 29 10 533 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q54YH4 9.94e-40 164 35 4 277 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YH4 9.49e-11 70 30 2 129 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YZ9 5.96e-38 158 38 3 240 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YZ9 2.88e-16 88 36 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P26762 6.76e-38 157 38 5 250 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P26762 6.59e-17 90 40 2 122 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P40330 9.65e-38 157 38 5 250 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P40330 6.7e-17 90 40 2 122 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q87GU5 1.48e-37 155 34 1 252 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87GU5 1.69e-08 62 28 2 126 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P54302 3.84e-37 154 34 1 252 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P54302 8.97e-07 56 27 1 117 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P16575 3.86e-37 155 38 5 250 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P16575 2.9e-16 87 36 2 133 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P58356 3.83e-36 151 37 4 236 3 torS Sensor protein TorS Escherichia coli O157:H7
P58356 2.59e-05 52 25 1 117 3 torS Sensor protein TorS Escherichia coli O157:H7
Q54U87 6.88e-36 151 35 7 287 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54U87 1.49e-06 56 24 3 150 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q9KLK7 7.4e-36 150 33 1 249 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLK7 4.18e-10 67 29 2 131 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q551X9 1.42e-35 150 37 4 254 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q551X9 8.18e-10 66 26 1 121 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P39453 5.92e-35 147 36 4 236 1 torS Sensor protein TorS Escherichia coli (strain K12)
P39453 6.66e-05 50 24 1 117 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8ZPP5 2.4e-34 145 31 5 317 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZPP5 3.22e-07 58 27 1 113 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEC5 1.75e-33 142 40 1 231 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC5 7.84e-12 73 33 3 130 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.75e-33 142 40 1 231 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC6 7.84e-12 73 33 3 130 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.75e-33 142 40 1 231 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P0AEC7 7.84e-12 73 33 3 130 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q8D5Z6 1.84e-33 142 33 5 255 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q8D5Z6 5.34e-11 70 28 1 134 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 1.94e-33 142 33 5 255 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q7MD16 5.58e-11 70 28 1 134 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q5AHA0 1.96e-33 144 25 14 504 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P59342 2.03e-33 142 40 1 231 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P59342 9.46e-12 73 33 3 130 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0C0F7 5.71e-33 140 33 2 247 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F7 1.74e-07 58 30 2 118 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 6.46e-33 140 33 2 247 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F6 1.79e-07 58 30 2 118 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O14002 6.8e-33 142 33 3 260 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14002 8.99e-09 63 31 3 122 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9XH57 3.32e-31 135 31 2 243 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9XH57 0.000273 48 22 3 144 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P30855 4.05e-31 135 34 6 262 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P30855 1.95e-24 114 44 2 141 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q41342 5.98e-31 134 31 6 282 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q41342 0.000831 47 23 3 121 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
O49230 1.13e-30 133 26 9 405 2 ETR1 Ethylene receptor 1 Brassica oleracea
O49230 2.37e-05 52 22 4 166 2 ETR1 Ethylene receptor 1 Brassica oleracea
P0AEC4 1.58e-30 133 33 4 228 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC4 1.11e-10 69 31 3 136 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 1.58e-30 133 33 4 228 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P0AEC3 1.11e-10 69 31 3 136 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 1.69e-30 132 33 4 228 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P58363 1.19e-10 69 31 3 136 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q54RP6 2.85e-30 133 29 8 342 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q54RP6 8.8e-13 76 33 3 122 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P58402 3.69e-30 132 34 4 260 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P58402 1.18e-23 111 44 2 142 3 evgS Sensor protein EvgS Escherichia coli O157:H7
O81122 6.63e-30 130 31 4 247 2 ETR1 Ethylene receptor Malus domestica
O81122 5e-05 50 26 4 137 2 ETR1 Ethylene receptor Malus domestica
Q53RH0 8.24e-30 129 31 2 282 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 8.24e-30 129 31 2 282 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q9P7Q7 9.75e-30 131 33 2 250 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7Q7 1.43e-05 53 27 2 118 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9XH58 1.1e-29 130 28 2 271 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q9XH58 0.000171 49 23 2 120 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q9C5U1 1.38e-29 130 29 1 279 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9C5U1 5.64e-10 67 29 3 137 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9SSY6 2.46e-29 129 32 3 245 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9SSY6 1.62e-05 52 25 2 120 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9M7M1 2.91e-29 129 31 4 247 2 ETR1 Ethylene receptor Prunus persica
P49333 5e-29 128 29 2 253 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P49333 2.46e-06 55 24 8 187 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
O82436 1.11e-28 127 32 3 245 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
O82436 1.48e-05 52 25 2 120 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
O49187 3.53e-28 125 28 4 295 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
O49187 8.53e-06 53 28 3 116 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q869S5 3.58e-28 126 31 5 270 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q869S5 2.97e-12 75 32 3 132 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P44578 3.98e-28 119 31 3 225 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZWL6 8.37e-28 124 31 1 243 2 ETR1 Ethylene receptor Passiflora edulis
A2WYI4 1.12e-27 124 28 2 283 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A2WYI4 8.19e-08 60 26 3 136 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 1.16e-27 124 28 2 283 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A1A696 8.4e-08 60 26 3 136 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q9P896 1.2e-27 123 31 4 242 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P896 5.08e-13 77 36 3 122 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q95PI2 1.34e-27 124 32 5 252 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q95PI2 3.78e-08 61 30 2 125 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q86CZ2 2.03e-27 124 32 4 250 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q86CZ2 1.66e-11 72 30 1 125 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q38846 3.76e-27 121 31 2 248 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q9HUI3 7.25e-27 122 31 8 332 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI3 1.28e-06 56 27 1 124 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52969 8.2e-27 119 32 4 268 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
P37894 1.94e-26 120 34 6 239 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6X5X4 1.9e-25 117 29 5 264 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
O48929 2.1e-25 116 29 4 284 2 ETR1 Ethylene receptor Nicotiana tabacum
O48929 6.67e-05 50 25 3 120 2 ETR1 Ethylene receptor Nicotiana tabacum
A9M715 3.85e-25 116 30 6 264 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
T2KMF4 4.15e-25 116 27 15 339 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
T2KMF4 0.000111 50 29 2 114 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
A5VRX4 5.24e-25 115 30 6 264 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B0CI82 5.52e-25 115 30 6 264 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q0DKM0 5.73e-25 114 30 5 295 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q8FZ86 5.81e-25 115 30 6 264 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q57BR6 5.96e-25 115 30 5 263 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 5.96e-25 115 30 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 5.96e-25 115 30 5 263 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
B8AY75 6.04e-25 114 30 5 295 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q8YIM6 6.06e-25 115 30 6 264 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9SXL4 1.31e-24 114 27 5 294 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9SXL4 9.12e-09 63 28 5 161 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q55E44 1.69e-24 114 33 2 189 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 7.37e-09 63 29 3 127 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 3.72e-06 55 45 2 70 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P23545 3.92e-24 111 32 4 227 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q2T0V9 6.63e-24 111 27 7 319 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P35164 1.18e-23 110 25 10 357 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q9C5U2 3.27e-23 110 29 8 285 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9C5U2 2.55e-08 62 26 2 137 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q03228 3.78e-23 108 28 5 266 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9KHI5 1.21e-22 107 34 5 230 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q06904 3.95e-22 103 28 6 254 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1A697 7.26e-22 105 33 0 162 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A697 1.72e-08 62 26 2 137 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
E0X9C7 1.03e-21 105 26 7 293 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 1.86e-10 68 26 8 282 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 9.33e-08 60 30 3 140 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 1.08e-21 105 26 7 293 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 1.95e-10 68 26 8 282 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 1.18e-07 59 30 3 140 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A3BE68 1.41e-21 104 32 3 209 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 3.96e-14 80 29 2 158 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 2.23e-08 62 38 0 86 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 1.47e-21 104 32 3 209 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 3.77e-14 80 29 2 158 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 2.23e-08 62 38 0 86 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A1A699 2.15e-21 104 35 0 155 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 3.43e-09 64 29 3 135 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
B1WYT4 6.56e-21 99 29 5 231 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8KIY1 8e-21 102 27 5 228 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 1.07e-11 72 25 10 286 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 4.73e-07 57 30 2 122 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q55630 1.68e-20 98 30 6 236 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74111 1.71e-20 100 30 5 243 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A7N6S2 2.27e-20 100 22 16 515 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q54SP4 3.73e-20 100 28 4 241 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 3.96e-12 74 26 6 271 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.71e-07 59 32 4 129 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 3.45e-06 55 28 3 132 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q9C5U0 4.5e-20 100 26 3 294 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 1.4e-11 72 31 4 135 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
A1A698 5.63e-20 99 29 2 207 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 4.54e-10 67 28 3 137 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q1XD95 6.08e-20 99 29 7 247 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
P21865 2.13e-19 97 26 8 288 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q45614 2.42e-19 97 30 9 239 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q55932 5.58e-19 94 27 3 223 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O34206 5.69e-19 95 28 5 226 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
A5A2P0 7.18e-19 94 28 9 267 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P42245 7.22e-19 92 27 5 254 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P20169 9.03e-19 95 28 7 253 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2JWK9 1.26e-18 92 29 7 251 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
P33529 1.4e-18 95 30 9 276 2 PHY Phytochrome Mougeotia scalaris
P51586 1.69e-18 85 41 1 122 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q9RDT3 1.74e-18 92 28 9 271 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q8DKG0 2.18e-18 94 30 4 243 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P94414 2.37e-18 92 25 3 241 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
B7K3M6 2.37e-18 92 28 5 229 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8DPL8 2.47e-18 92 28 5 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 2.47e-18 92 28 5 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P51392 3.37e-18 93 29 9 248 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q86AT9 4.13e-18 94 33 1 162 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 3.2e-12 74 33 2 124 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 4.8e-05 51 39 0 68 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
B0JK50 8.65e-18 90 27 4 231 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q7A215 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 1.02e-17 91 28 9 271 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD58 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q5HJX6 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 1.02e-17 91 28 9 271 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 1.02e-17 91 28 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ8 1.41e-17 91 27 8 270 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q8CU87 1.78e-17 90 27 9 271 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.78e-17 90 27 9 271 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q54Q69 2.71e-17 91 33 4 203 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 1.19e-11 73 34 2 123 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 3.52e-05 52 39 1 69 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q6GKS6 3.31e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q2JKD9 3.45e-17 88 29 6 241 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q4A159 3.57e-17 90 27 8 270 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q0IBF4 3.65e-17 88 25 9 290 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q8DMT2 3.8e-17 88 27 9 294 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P77485 4.13e-17 89 25 4 242 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8FK37 7.69e-17 88 25 5 242 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9RQQ9 8.86e-17 89 26 4 267 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8GP19 1.25e-16 87 24 7 287 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P39764 1.75e-16 86 24 9 293 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q8YR50 1.94e-16 86 26 5 241 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8XBY4 2.1e-16 87 25 5 241 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q3M8A7 2.57e-16 85 26 5 241 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6GGK7 2.99e-16 87 28 6 240 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q7A5H7 3.53e-16 86 28 6 240 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 3.53e-16 86 28 6 240 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NWF3 4.58e-16 86 28 6 240 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 4.58e-16 86 28 6 240 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 4.58e-16 86 28 6 240 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 4.58e-16 86 28 6 240 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 4.82e-16 86 28 6 240 1 srrB Sensor protein SrrB Staphylococcus aureus
O74539 1.02e-15 86 25 4 253 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74539 4.05e-07 58 27 3 147 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B2J946 1.18e-15 84 25 6 241 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P52101 1.28e-15 84 26 6 226 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q51455 1.35e-15 77 37 2 122 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7KFU0 1.73e-15 83 28 7 238 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q8XA47 2.05e-15 83 26 6 226 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
I1WSZ3 2.48e-15 83 23 3 225 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q08408 3.73e-15 83 25 4 233 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P14377 5.16e-15 82 26 7 222 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q3AYV8 5.57e-15 81 25 7 258 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P94608 6.89e-15 83 26 5 246 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q40762 6.92e-15 83 26 13 339 2 None Phytochrome Picea abies
Q01549 1.01e-14 82 26 8 279 3 PHY1 Phytochrome 1 Selaginella martensii
O31661 1.23e-14 82 26 12 278 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P39928 1.26e-14 82 24 12 366 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 1.26e-06 56 32 3 151 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A2C884 1.36e-14 80 26 9 258 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
O22267 1.39e-14 82 24 7 287 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
O22267 0.000229 48 30 6 125 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
A1TEL7 1.43e-14 77 34 0 121 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P0DMK6 1.43e-14 80 22 3 225 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q2FWH7 1.54e-14 82 26 9 256 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P18392 1.57e-14 80 23 3 227 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q7BWI3 1.8e-14 80 25 10 297 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q1B3X8 1.88e-14 77 33 0 121 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.88e-14 77 33 0 121 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.88e-14 77 33 0 121 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q8FW53 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 2.07e-14 73 33 1 116 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 2.07e-14 73 33 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
O34989 2.32e-14 80 23 5 245 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q7V6P7 2.46e-14 79 26 8 261 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q9ZHD4 2.51e-14 80 25 4 209 3 silS Probable sensor kinase SilS Salmonella typhimurium
A6X580 2.56e-14 73 32 1 116 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8D0P1 2.81e-14 73 37 2 112 3 cheY Chemotaxis protein CheY Yersinia pestis
P30847 3.27e-14 79 24 3 225 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P72292 3.65e-14 80 25 5 235 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
A1KHB7 4.66e-14 76 33 0 124 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 4.66e-14 76 33 0 124 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q93P00 6.1e-14 72 37 2 112 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P9WGM9 7.78e-14 75 33 0 124 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 7.78e-14 75 33 0 124 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 7.78e-14 75 33 0 124 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8X614 8.34e-14 78 25 7 222 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q9APE0 1.09e-13 78 25 7 222 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q9M8Y4 1.21e-13 72 35 2 117 2 ARR22 Two-component response regulator ARR22 Arabidopsis thaliana
A0QR01 1.27e-13 77 26 4 223 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9KQD5 1.53e-13 71 38 2 113 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.53e-13 71 38 2 113 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7U871 1.55e-13 77 25 7 256 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q44007 1.78e-13 77 26 6 242 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q742C1 2.29e-13 73 33 0 121 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 2.29e-13 73 33 0 121 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A0R3I8 2.66e-13 73 37 0 108 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A0H3GPN8 3.4e-13 76 25 4 239 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q9CD68 6.35e-13 72 33 0 124 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A0QTK3 8.61e-13 75 25 5 270 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGL2 9.2e-13 76 25 5 221 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WGL3 9.28e-13 76 25 5 221 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P32040 1.12e-12 72 31 1 122 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q49XM6 1.17e-12 75 28 9 237 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0A4I6 1.25e-12 74 22 4 236 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.25e-12 74 22 4 236 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
E5KK10 1.51e-12 75 25 7 249 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
A0PWB4 1.56e-12 71 36 0 108 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q06067 1.66e-12 75 24 8 270 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
A3PDI2 2.47e-12 73 25 7 254 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
A2BRQ6 2.67e-12 73 25 7 254 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
P36505 2.9e-12 74 25 8 270 2 PHY1 Phytochrome 1 Physcomitrium patens
Q04804 3.26e-12 73 25 8 237 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q31AE8 3.44e-12 72 24 7 262 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
F4JZT3 4.22e-12 67 31 3 134 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
Q8CSL7 4.54e-12 73 28 8 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPC4 4.75e-12 73 28 6 238 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P37739 5.8e-12 73 24 7 229 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
A8G5E7 6e-12 72 25 7 254 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q54W36 6.49e-12 73 31 1 147 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 3.13e-09 65 34 3 114 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 0.00011 50 41 1 73 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q9TLQ4 6.51e-12 70 30 1 134 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q7A0W5 7.48e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 7.48e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 7.48e-12 72 25 6 242 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 7.48e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 7.48e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 7.48e-12 72 25 6 242 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 7.48e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
P0C5S6 7.72e-12 73 27 3 154 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
A7MRY4 7.86e-12 73 27 3 154 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
Q6GGZ4 7.95e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
P0AE82 8.51e-12 72 25 4 239 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 8.51e-12 72 25 4 239 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 8.51e-12 72 25 4 239 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q2YY04 8.76e-12 72 25 6 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
O69730 8.89e-12 69 33 0 106 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZHD3 1.06e-11 69 33 1 124 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q39557 1.08e-11 72 25 6 244 3 PHY2 Phytochrome 2 Ceratodon purpureus
Q93CB7 1.12e-11 72 26 6 241 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P37461 1.35e-11 71 24 7 223 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 1.48e-11 71 24 7 222 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P0AEV3 2.14e-11 70 36 1 112 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 2.14e-11 70 36 1 112 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 2.14e-11 70 36 1 112 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q4L8M0 2.3e-11 70 25 6 240 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
P08400 2.35e-11 70 23 7 277 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
O31671 2.56e-11 70 24 7 263 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q8FGP6 3.1e-11 65 34 2 111 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P08401 3.39e-11 70 22 6 242 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q9HWR3 3.6e-11 70 27 7 233 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49ZT8 4.41e-11 67 35 1 105 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8GVV6 4.57e-11 64 33 2 106 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 4.57e-11 64 33 2 106 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
I1MGE5 5e-11 70 28 11 278 1 GLYMA_15G140000 Phytochrome B-2 Glycine max
Q9HU20 5.02e-11 70 23 11 312 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q07737 5.38e-11 70 22 3 235 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P10955 5.62e-11 69 27 9 233 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q9WY30 5.88e-11 68 33 1 112 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P0DM78 6.74e-11 66 30 0 113 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 6.74e-11 66 30 0 113 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 6.74e-11 66 30 0 113 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 6.74e-11 66 30 0 113 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 6.74e-11 66 30 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z7H2 7.13e-11 66 30 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q55168 7.21e-11 70 26 6 241 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06240 7.7e-11 68 22 7 265 1 vanS Sensor protein VanS Enterococcus faecium
P0AE69 7.85e-11 63 33 2 111 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 7.85e-11 63 33 2 111 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 7.85e-11 63 33 2 111 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q41046 8.08e-11 70 27 9 236 2 None Phytochrome Pinus sylvestris
Q2HWG1 8.17e-11 63 33 2 109 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
Q8THF6 9.38e-11 69 24 5 248 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9P4U6 1e-10 69 27 3 136 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P4U6 3.14e-10 68 24 10 321 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9FAD7 1.12e-10 63 33 3 111 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P43501 1.35e-10 63 32 1 113 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45609 1.42e-10 68 24 4 227 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P38889 1.47e-10 68 31 0 119 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9CCJ1 1.55e-10 68 25 6 241 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P9WGK8 1.72e-10 68 25 7 262 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.72e-10 68 25 7 262 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KM66 1.84e-10 68 28 1 139 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KM66 1.09e-07 59 24 7 234 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0ACZ8 1.85e-10 65 31 1 118 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 1.85e-10 65 31 1 118 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 1.85e-10 65 31 1 118 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q44006 1.86e-10 65 32 1 125 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P48259 2.03e-10 65 31 1 121 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P9WGK9 2.04e-10 68 25 7 262 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q2HWG0 2.2e-10 62 33 2 106 2 RR13 Two-component response regulator ORR13 Oryza sativa subsp. japonica
P14714 2.21e-10 68 26 6 232 1 PHYC Phytochrome C Arabidopsis thaliana
Q57QC3 2.27e-10 65 30 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
P18540 2.41e-10 68 25 9 286 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2KCH7 2.41e-10 62 31 2 119 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
L7N689 2.53e-10 65 29 0 111 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q4L8L9 2.54e-10 65 34 1 113 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
P0A2D5 2.58e-10 62 34 3 111 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 2.58e-10 62 34 3 111 3 cheY Chemotaxis protein CheY Salmonella typhi
A7HD43 2.97e-10 67 23 6 256 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q4L6C5 3.12e-10 67 27 6 237 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
P29130 3.18e-10 68 25 8 276 2 PHYB Phytochrome B Nicotiana tabacum
P0CL17 3.34e-10 64 31 1 123 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 3.34e-10 64 31 1 123 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q7V113 3.44e-10 66 23 6 226 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
O78428 3.9e-10 65 32 1 112 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
P93528 4.03e-10 67 26 9 268 2 PHYC Phytochrome C Sorghum bicolor
A1W0A5 4.26e-10 62 28 3 128 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 4.26e-10 62 28 3 128 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 4.26e-10 62 28 3 128 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q83RR0 4.39e-10 64 28 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 4.39e-10 64 28 0 113 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9HZ47 4.58e-10 66 24 5 220 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23836 4.61e-10 64 28 0 113 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q9ZWS9 4.98e-10 64 30 4 139 1 ARR3 Two-component response regulator ARR3 Arabidopsis thaliana
P34094 5.11e-10 67 25 7 274 3 PHYB Phytochrome B Solanum tuberosum
Q9LCC2 5.55e-10 67 26 6 249 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5A872 6.56e-10 67 29 3 174 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.12e-09 66 30 4 125 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 4.19e-05 51 34 0 73 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5HLN2 6.88e-10 63 34 1 108 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN92 7.01e-10 63 34 1 108 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q75KW7 8.66e-10 60 27 2 127 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
P13792 9.01e-10 63 28 1 126 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P39663 9.97e-10 63 30 2 131 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P33113 1.14e-09 65 23 8 250 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q49ZT9 1.14e-09 65 26 5 228 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6H805 1.25e-09 65 34 2 118 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 1.28e-09 65 34 2 118 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q06065 1.29e-09 65 34 0 115 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q4GZL0 1.32e-09 63 31 3 114 2 RR1 Two-component response regulator ORR1 Oryza sativa subsp. indica
Q2HWG4 1.45e-09 62 31 3 114 2 RR1 Two-component response regulator ORR1 Oryza sativa subsp. japonica
P26489 1.64e-09 65 26 9 263 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O25153 1.93e-09 65 31 2 118 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
P06594 2.04e-09 65 24 11 271 1 PHYA4 Phytochrome A type 4 Avena sativa
P33530 2.06e-09 65 26 9 278 3 PHYA1 Phytochrome A1 Nicotiana tabacum
P71403 2.08e-09 59 28 3 117 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q2HWH1 2.12e-09 60 32 2 104 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 2.12e-09 60 32 2 104 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
P28835 2.14e-09 62 28 1 118 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P07168 2.15e-09 65 25 8 273 3 virA Wide host range VirA protein Rhizobium radiobacter
Q9ZM64 2.22e-09 59 28 3 117 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P45608 2.29e-09 64 22 6 277 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P71380 2.49e-09 64 25 6 225 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0DWC7 2.72e-09 65 21 5 243 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. japonica
P16497 2.79e-09 64 27 7 250 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P45605 2.89e-09 62 30 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P10799 3.11e-09 64 26 7 236 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
Q02540 3.51e-09 61 29 1 117 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
P45607 3.52e-09 61 30 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P36557 3.53e-09 63 25 5 212 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q47745 3.76e-09 63 26 8 245 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q04943 3.76e-09 63 33 3 116 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P45606 3.86e-09 61 30 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
A6WZ81 3.96e-09 61 30 0 102 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P0AFJ5 3.97e-09 61 30 1 126 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 3.97e-09 61 30 1 126 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q2RAP3 3.99e-09 60 28 2 132 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. japonica
Q4GZK2 3.99e-09 60 28 2 132 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. indica
O34971 4.07e-09 64 25 7 231 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q8FZ93 4.11e-09 61 30 0 102 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 4.11e-09 61 30 0 102 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 4.11e-09 61 30 0 102 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 4.11e-09 61 30 0 102 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 4.11e-09 61 30 0 102 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 4.11e-09 61 30 0 102 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 4.11e-09 61 30 0 102 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 4.11e-09 61 30 0 102 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P33639 4.14e-09 63 26 8 225 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9FPR6 4.16e-09 59 25 2 136 2 ARR17 Two-component response regulator ARR17 Arabidopsis thaliana
Q6H468 4.51e-09 59 29 2 118 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 4.51e-09 59 29 2 118 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
P42499 4.53e-09 64 26 10 276 3 PHYB Phytochrome B Glycine max
Q2QXY3 4.77e-09 60 28 2 132 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. japonica
B8BLZ4 4.77e-09 60 28 2 132 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. indica
P38684 5.39e-09 61 29 1 117 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P23621 5.55e-09 63 26 3 227 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P15939 5.87e-09 63 23 9 265 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8B3I4 6.17e-09 63 31 2 118 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q5SML5 6.33e-09 63 31 2 118 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
P58357 7e-09 60 29 1 117 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q9I4F9 7.14e-09 60 28 0 112 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P72781 7.23e-09 60 30 2 122 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O82798 8.11e-09 61 28 2 132 1 ARR4 Two-component response regulator ARR4 Arabidopsis thaliana
B8H358 8.48e-09 60 27 0 102 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 8.48e-09 60 27 0 102 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P87323 8.65e-09 62 27 2 143 4 mcs4 Response regulator mcs4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8X738 8.68e-09 60 27 0 113 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P42421 8.88e-09 60 30 1 115 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P42244 8.9e-09 60 30 3 126 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q08430 8.94e-09 62 25 7 225 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P44918 9.52e-09 60 27 1 120 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P28257 9.65e-09 60 31 1 118 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q9I4N3 1.03e-08 62 32 2 126 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6T5K2 1.04e-08 63 21 5 243 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. indica
Q5N6V8 1.06e-08 62 34 2 116 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q9ZS62 1.09e-08 63 25 7 269 2 PHYB1 Phytochrome B1 Solanum lycopersicum
P51358 1.27e-08 60 31 1 115 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q9ZTP3 1.39e-08 62 23 4 243 1 EIN4 Protein EIN4 Arabidopsis thaliana
Q9ZTP3 2.57e-08 61 27 5 165 1 EIN4 Protein EIN4 Arabidopsis thaliana
A6QJK3 1.53e-08 59 31 2 119 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.53e-08 59 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
B8GZM2 1.53e-08 62 40 1 104 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 1.53e-08 62 40 1 104 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9HV32 1.58e-08 59 30 0 113 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P46384 1.68e-08 57 26 1 131 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1XDC9 1.69e-08 60 31 1 115 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q47457 1.77e-08 61 24 6 230 3 pcoS Probable sensor protein PcoS Escherichia coli
Q1XDE4 1.97e-08 59 30 2 119 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P9WGK7 2e-08 61 22 5 230 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 2e-08 61 22 5 230 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 2e-08 61 22 5 230 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZEP3 2.03e-08 61 24 7 223 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P23222 2.06e-08 61 22 6 262 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P9WGK5 2.26e-08 61 23 8 282 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.26e-08 61 23 8 282 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.26e-08 61 23 8 282 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGN1 2.27e-08 59 31 1 103 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 2.27e-08 59 31 1 103 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5SML4 2.37e-08 62 27 4 161 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
Q5SML4 4.44e-07 57 29 3 119 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 2.37e-08 62 27 4 161 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YA15 4.44e-07 57 29 3 119 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
Q6K8X6 2.37e-08 61 33 2 118 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
B8AEH1 2.41e-08 61 33 2 118 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q6K9T0 2.71e-08 56 32 2 104 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 2.71e-08 56 32 2 104 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
Q0PVB3 2.88e-08 58 31 2 109 2 RR7 Two-component response regulator ORR7 Oryza sativa subsp. japonica
P40138 3.11e-08 60 30 2 121 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q689G6 3.15e-08 61 30 2 118 2 PRR95 Two-component response regulator-like PRR95 Oryza sativa subsp. japonica
P07167 3.28e-08 61 24 8 255 3 virA Limited host range VirA protein Rhizobium radiobacter
A0QTK2 3.29e-08 58 36 1 101 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7A039 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 3.48e-08 58 31 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE73 3.58e-08 58 32 4 124 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q7D9K0 3.76e-08 58 31 0 108 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 3.76e-08 58 31 0 108 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q742C0 3.79e-08 60 25 11 267 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P76340 4.1e-08 58 29 1 118 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q6YVX7 4.23e-08 58 27 3 144 2 RR2 Two-component response regulator ORR2 Oryza sativa subsp. japonica
Q4GZK9 4.23e-08 58 27 3 144 2 RR2 Two-component response regulator ORR2 Oryza sativa subsp. indica
P18769 4.83e-08 60 31 1 113 1 frzE Gliding motility regulatory protein Myxococcus xanthus
O32193 5.51e-08 60 23 9 243 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P19862 5.75e-08 60 25 8 226 3 PHYA1 Phytochrome A Zea mays
Q9FXD6 5.77e-08 60 30 2 118 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P9WGM3 6.03e-08 57 29 2 124 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 6.03e-08 57 29 2 124 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P14712 6.15e-08 60 25 9 273 1 PHYA Phytochrome A Arabidopsis thaliana
P09431 6.15e-08 59 23 12 342 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P06628 6.6e-08 55 28 0 116 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
Q7A1J1 7.41e-08 57 28 1 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 7.41e-08 57 28 1 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 7.41e-08 57 28 1 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 7.41e-08 57 28 1 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 7.41e-08 57 28 1 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 7.41e-08 57 28 1 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 7.41e-08 57 28 1 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 7.41e-08 57 28 1 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 7.41e-08 57 28 1 106 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 7.41e-08 57 28 1 106 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P0A4H8 7.42e-08 57 32 2 118 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 7.42e-08 57 32 2 118 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O33071 7.51e-08 59 23 7 238 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P54883 8.87e-08 59 23 6 270 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P93527 9.85e-08 60 25 11 275 1 PHYB Phytochrome B Sorghum bicolor
P31079 1.09e-07 57 35 1 117 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P37478 1.19e-07 57 30 1 112 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P42497 1.32e-07 59 24 5 213 1 PHYD Phytochrome D Arabidopsis thaliana
Q55890 1.5e-07 57 29 1 109 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KSB1 1.58e-07 58 31 2 116 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P30733 1.6e-07 59 25 8 283 2 PHYA Phytochrome A Solanum tuberosum
Q940D0 1.74e-07 58 33 2 118 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
A3Q5L8 1.77e-07 58 24 6 253 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q4LAJ9 1.81e-07 56 30 1 107 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P9WGM1 1.83e-07 56 35 0 93 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.83e-07 56 35 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.83e-07 56 35 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P39838 1.9e-07 58 20 8 353 1 rcsD Phosphotransferase RcsD Escherichia coli (strain K12)
Q7XN30 1.94e-07 54 30 5 121 3 RR42 Two-component response regulator ORR42 Oryza sativa subsp. japonica
Q93CB8 2.02e-07 56 35 1 101 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9R6X3 2.05e-07 58 26 12 261 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9CCJ2 2.08e-07 56 35 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
A0QBR0 2.11e-07 58 24 11 267 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_00385
Feature type CDS
Gene rcsC
Product two-component system sensor histidine kinase RcsC
Location 51253 - 54099 (strand: -1)
Length 2847 (nucleotides) / 948 (amino acids)
In genomic island -

Contig

Accession contig_1
Length 309072 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_510
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07677 two-component system, NarL family, capsular synthesis sensor histidine kinase RcsC [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MRYFSSFQTSLKISRYLFRIVGVMLWGLGALVTVFYLLNIYNGMRNDIRQQYYSDYDALLAYFRQSTDMTRDIRYMNERFVENKEVRPGEPADRTTDGFFIDYRALNTKGDCAAFRTGSGPYIIAFKDLLTYWQNNIAAPMGLNQVFLVGSKTLCMVSFPIRNLSTSSETLRRMVNDYSQNYFRLKSQGKERTIYWAAPGSNQGMASLFVMMPLYYDGRFLALMGIERNLQLENFNRLRDFPANMVIINEQDDVVLSYPEEINTQKNKDRYLVDDNYFGYDDEFTQLVFKRRLTPSLLSVVYTTPLSSIYEKLKFQILNGAILNLISVIIIGLFTWLLERRIFMPAENSAMRLEEHEQFNHKIVASAPVGICILRTLDGTALLSNELAHNYWRMLSFEDRNRIGLLIKDKRQGMEDMVTRNGGHLQVSFVHSRYQNEEVAICVLVDISARVQLESSLQDAAQAAEQANQSKSMFLATVSHELRTPLYGIIGNLELLQSMAHSRDAQRLLGTMNNSSSLLLKIISDILDFSKIESKQLKIEPREFNFREHIHFVVANYLPLVAKKHLSLYCFIEKDVPELVCNDPVRMQQVIANLFNNAIKYTHVGMVCIHVYVCGEYLHVDIQDTGGGISEDELRQLFDPFYQIMPNTDSPSQGTGLGLPICEKLISLMDGDMMVESQKEVGSLFGIRFPCYTAYPSGHHADIVPLTVPLVFEFRNGVLADYMQRYWQDIAPAAVPLSECPDIACAVVITDVVTPAMKQARLLIELDAGYTDKPVPMGGNHWRHNTHQLDGLFDFVSDRLNNRRQEADDLPPPPLPDSQQAAHVRILIVDDHPINRHLLSDQLHLFGFHTATADDGLDALDFLETHEVDIILSDVNMPNMNGYDLTRALREKGMTLPVIGITANAMAEERERCLASGMNDCLSKPVSMQALRTMIQHYIPQVTPPGAE

Flanking regions ( +/- flanking 50bp)

ACAGTCTGAAACCTCGTGAATATATCAGATTCATTATTGGCGGAGCCCCTTTGAGATACTTTTCATCTTTCCAGACATCACTGAAAATTTCGCGTTACCTGTTCCGGATCGTCGGTGTGATGTTATGGGGGCTGGGGGCGCTGGTGACGGTATTCTATTTACTGAATATCTATAACGGGATGCGCAATGATATCCGCCAGCAATATTATTCCGATTACGATGCCTTATTAGCCTATTTCCGGCAATCCACCGATATGACCCGCGATATCCGTTATATGAATGAACGGTTTGTCGAAAATAAAGAAGTACGGCCGGGAGAGCCCGCAGACCGGACCACCGACGGCTTTTTTATTGATTACCGGGCACTGAATACCAAAGGCGACTGCGCGGCCTTCCGCACCGGCAGCGGCCCGTATATTATTGCATTCAAAGATCTCCTGACGTACTGGCAGAACAATATCGCCGCACCGATGGGGCTGAATCAGGTCTTTCTGGTCGGCTCAAAAACCCTGTGTATGGTGTCATTTCCGATCCGCAACCTTTCCACCAGCAGCGAAACGTTGCGCAGAATGGTCAATGATTACTCTCAGAACTATTTCCGCCTGAAAAGTCAGGGGAAAGAGCGCACCATTTACTGGGCGGCGCCGGGTAGTAATCAGGGAATGGCCAGCCTGTTTGTGATGATGCCGCTGTATTATGACGGGCGTTTTCTGGCACTGATGGGTATTGAGCGTAATCTGCAGCTGGAAAACTTTAACCGCCTGCGCGATTTCCCGGCCAATATGGTGATTATTAATGAGCAGGATGATGTCGTGCTCTCTTATCCGGAAGAAATTAACACACAGAAAAATAAAGACCGTTATCTGGTGGACGATAATTATTTCGGCTATGACGACGAATTCACCCAACTGGTCTTTAAACGCAGACTGACGCCGTCGCTGCTGAGTGTGGTATATACCACGCCGCTGAGCTCAATCTATGAAAAACTGAAATTTCAGATCCTCAACGGGGCGATTCTTAATCTGATCTCTGTCATTATTATCGGGTTGTTTACCTGGCTGCTGGAACGGCGGATATTTATGCCGGCCGAAAACAGCGCCATGCGTCTGGAGGAGCACGAGCAGTTCAACCACAAAATTGTGGCCTCCGCACCGGTCGGGATTTGCATTCTGCGCACACTCGACGGTACGGCACTGCTGAGTAATGAGCTGGCTCATAATTACTGGCGTATGCTTTCGTTTGAGGATCGCAACCGTATCGGCCTGCTGATAAAAGATAAACGGCAGGGGATGGAAGATATGGTGACCCGTAACGGCGGGCACCTTCAGGTCAGTTTTGTGCATTCCCGTTACCAGAACGAGGAAGTGGCGATTTGTGTGCTGGTGGATATCAGCGCCCGTGTGCAGCTGGAAAGCTCGTTACAGGATGCGGCACAGGCGGCAGAGCAGGCTAACCAGTCGAAATCCATGTTCCTTGCCACGGTCAGCCATGAGCTGCGCACGCCGCTGTACGGTATCATCGGTAACCTGGAGCTGTTACAGTCCATGGCGCATTCGCGGGATGCCCAGCGCCTGCTCGGTACGATGAATAACTCCTCGTCATTATTACTGAAAATTATCAGTGATATTCTCGACTTCTCCAAAATTGAATCCAAACAGCTGAAAATTGAGCCGAGAGAGTTTAACTTCCGCGAACATATTCATTTTGTGGTGGCAAACTACCTGCCGCTGGTGGCGAAAAAACACCTTTCTCTGTACTGCTTTATTGAAAAAGATGTGCCGGAGCTGGTCTGTAATGACCCGGTACGGATGCAGCAGGTGATCGCCAACCTGTTTAATAATGCGATTAAATACACGCATGTCGGGATGGTGTGCATTCACGTCTATGTCTGCGGTGAATATCTGCATGTGGATATTCAGGATACCGGCGGCGGTATCAGTGAGGACGAGCTGCGTCAGTTATTCGACCCGTTCTATCAGATTATGCCGAACACGGACAGCCCGTCGCAGGGTACCGGGCTCGGGCTGCCTATCTGTGAAAAACTGATCTCACTGATGGACGGTGACATGATGGTGGAATCGCAGAAAGAGGTCGGCAGCTTGTTCGGGATCCGCTTCCCGTGCTATACCGCCTATCCGTCCGGTCATCATGCGGATATTGTGCCGCTGACCGTACCGCTGGTCTTTGAGTTCCGCAATGGCGTGCTGGCGGATTATATGCAGCGTTACTGGCAGGATATTGCCCCGGCAGCGGTTCCGTTGTCTGAATGCCCTGACATTGCCTGTGCCGTGGTGATCACGGACGTGGTGACCCCGGCGATGAAACAGGCGCGTCTGCTGATTGAACTGGATGCCGGTTATACCGACAAACCGGTGCCGATGGGCGGCAATCACTGGCGGCATAATACCCATCAGCTTGACGGGTTGTTTGATTTTGTCTCTGACCGCCTGAACAACCGCCGTCAGGAAGCCGATGATCTGCCGCCGCCGCCACTGCCGGACAGTCAGCAGGCAGCACATGTCCGGATCCTGATTGTGGATGACCATCCGATTAACCGCCATCTGCTGTCAGATCAGCTGCATCTGTTCGGCTTCCACACCGCAACGGCGGATGACGGGCTGGATGCGCTCGACTTCCTCGAAACCCACGAGGTGGATATTATTCTGTCAGACGTCAACATGCCGAATATGAACGGTTATGACCTGACCCGTGCACTGAGAGAGAAGGGGATGACACTGCCGGTTATCGGGATCACCGCCAATGCGATGGCGGAAGAACGCGAGCGCTGTCTGGCTTCCGGCATGAACGATTGTCTCTCCAAACCGGTCTCTATGCAGGCGCTGCGCACCATGATACAGCATTATATCCCGCAGGTCACACCGCCCGGGGCAGAATAACCGGCACATAAAAAAACCGCCGTTCAGATGAATGGCGGTTTTGTATCAAT