Homologs in group_510

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00385 FBDBKF_00385 85.9 Morganella morganii S1 rcsC two-component system sensor histidine kinase RcsC
EHELCC_01160 EHELCC_01160 85.9 Morganella morganii S2 rcsC two-component system sensor histidine kinase RcsC
NLDBIP_02300 NLDBIP_02300 85.9 Morganella morganii S4 rcsC two-component system sensor histidine kinase RcsC
LHKJJB_03815 LHKJJB_03815 85.9 Morganella morganii S3 rcsC two-component system sensor histidine kinase RcsC
HKOGLL_03230 HKOGLL_03230 85.9 Morganella morganii S5 rcsC two-component system sensor histidine kinase RcsC
PMI_RS08495 PMI_RS08495 52.6 Proteus mirabilis HI4320 rcsC two-component system sensor histidine kinase RcsC

Distribution of the homologs in the orthogroup group_510

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_510

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DMC5 0.0 811 44 8 950 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 0.0 811 44 8 950 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P58662 0.0 780 43 10 956 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 0.0 780 43 10 956 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q5A599 7.89e-45 179 29 11 539 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q54YH4 1.38e-38 160 34 4 276 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q54YH4 2.25e-10 68 30 1 126 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P58356 3.19e-37 154 38 4 234 3 torS Sensor protein TorS Escherichia coli O157:H7
Q9F8D7 1.34e-36 152 38 1 233 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9F8D7 1.08e-15 85 38 1 120 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q54U87 1.41e-36 154 36 5 283 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q54U87 9.58e-07 57 24 3 150 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q87GU5 2.38e-36 152 33 1 257 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87GU5 1.57e-07 59 30 1 109 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P48027 2.78e-36 152 36 2 252 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P48027 9.55e-14 79 35 1 120 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P54302 4.15e-36 151 33 1 257 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P54302 2.49e-06 55 29 2 123 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P39453 4.27e-36 151 38 4 234 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8ZPP5 6.09e-36 150 31 5 321 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZPP5 1.22e-06 56 27 1 112 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P16575 8.2e-36 150 36 5 260 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P16575 1.13e-16 89 40 2 123 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P26762 1.5e-35 150 35 4 259 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P26762 4.38e-17 90 41 2 121 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q54YZ9 2.24e-35 150 37 2 237 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q54YZ9 1.62e-16 89 37 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P40330 2.75e-35 149 35 4 259 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P40330 4.03e-17 90 41 2 121 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q551X9 4.71e-35 148 37 4 254 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q551X9 2.98e-10 68 28 1 121 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q3S4A7 4.87e-35 147 33 4 283 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q3S4A7 8.86e-13 76 30 2 149 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q9KLK7 5.21e-34 144 32 2 250 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLK7 9.4e-09 63 26 2 141 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5AHA0 3.31e-33 143 26 17 507 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8D5Z6 5.89e-33 141 31 5 273 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q8D5Z6 1.2e-08 62 29 2 133 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 7.26e-33 140 31 5 273 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q7MD16 1.2e-08 62 29 2 133 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P0AEC5 8.9e-33 140 40 1 227 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC5 6.73e-11 70 33 2 118 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 8.9e-33 140 40 1 227 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC6 6.73e-11 70 33 2 118 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 8.9e-33 140 40 1 227 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P0AEC7 6.73e-11 70 33 2 118 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P59342 9.21e-33 140 40 1 227 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P59342 7.08e-11 70 33 2 118 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0C0F6 1.97e-32 139 33 2 242 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F6 4.58e-07 57 28 2 123 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 2.01e-32 139 33 2 242 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F7 4.95e-07 57 28 2 118 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P58363 6.48e-32 137 35 5 231 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P58363 1.37e-12 75 32 4 146 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P0AEC4 7.14e-32 137 35 5 231 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC4 1.41e-12 75 32 4 146 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 7.14e-32 137 35 5 231 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P0AEC3 1.41e-12 75 32 4 146 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P30855 1.82e-30 134 33 7 282 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P30855 6.03e-23 109 46 1 126 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q41342 2.59e-30 132 32 6 286 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q41342 0.000499 47 25 5 130 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q54RP6 4.91e-30 132 30 7 318 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q54RP6 9.04e-13 76 35 3 122 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
O49230 5.3e-30 131 26 12 445 2 ETR1 Ethylene receptor 1 Brassica oleracea
O49230 9.07e-05 50 20 3 163 2 ETR1 Ethylene receptor 1 Brassica oleracea
O14002 5.4e-30 132 31 3 260 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14002 4.98e-09 64 29 2 122 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q53RH0 7.29e-30 130 32 4 282 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 7.29e-30 130 32 4 282 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q9P7Q7 7.69e-30 132 34 2 250 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7Q7 0.000266 48 27 2 114 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9M7M1 2.13e-29 129 27 12 406 2 ETR1 Ethylene receptor Prunus persica
P58402 2.21e-29 130 35 5 260 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P58402 5.15e-22 106 46 1 126 3 evgS Sensor protein EvgS Escherichia coli O157:H7
O81122 2.31e-29 129 31 6 286 2 ETR1 Ethylene receptor Malus domestica
O81122 0.000255 48 25 5 132 2 ETR1 Ethylene receptor Malus domestica
Q9XH57 2.35e-29 129 30 3 282 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9XH57 6.04e-05 50 24 4 140 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P44578 2.69e-29 123 32 3 225 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2WYI4 2.9e-29 129 29 3 306 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A2WYI4 5.41e-07 57 25 3 136 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 3.05e-29 129 29 3 306 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A1A696 5.75e-07 57 25 3 136 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q9C5U1 3.29e-29 129 29 2 279 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9C5U1 9.5e-12 73 27 3 158 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9XH58 5.28e-29 128 29 3 282 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q9XH58 6.63e-05 50 23 4 146 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q9SSY6 5.42e-29 128 31 4 282 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9SSY6 3.78e-05 51 25 2 120 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9P896 7.65e-29 127 31 3 240 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P896 8.38e-13 76 36 2 116 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q95PI2 7.76e-29 128 33 5 246 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q95PI2 7.35e-09 63 30 3 142 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
P49333 1e-28 127 29 4 292 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P49333 3.74e-05 51 21 2 128 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
O82436 1.81e-28 126 31 4 282 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
O82436 3.68e-05 51 25 2 120 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q869S5 3.29e-28 126 32 3 235 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q869S5 1.17e-11 72 32 3 132 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q86CZ2 1.39e-27 124 32 4 243 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q86CZ2 2.74e-10 68 30 2 122 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9ZWL6 1.45e-27 123 31 3 282 2 ETR1 Ethylene receptor Passiflora edulis
O49187 6.1e-27 121 30 2 235 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
O49187 6.17e-06 53 28 5 129 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P37894 7.78e-27 121 34 6 239 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q52969 1.53e-26 118 31 6 279 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q38846 5.16e-26 117 30 1 243 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
T2KMF4 1.43e-25 118 29 9 264 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P23545 1.51e-25 116 32 3 227 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
A9M715 1.84e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8FZ86 2.55e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 2.55e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q57BR6 2.55e-25 117 30 7 264 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 2.55e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 2.55e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
A5VRX4 2.69e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YIM6 2.74e-25 117 30 7 264 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A6X5X4 3.31e-25 116 29 6 264 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
O48929 3.65e-25 115 29 9 339 2 ETR1 Ethylene receptor Nicotiana tabacum
O48929 2.34e-06 55 27 5 147 2 ETR1 Ethylene receptor Nicotiana tabacum
Q9HUI3 5.43e-25 115 30 1 249 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI3 1.15e-07 59 30 1 126 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8AY75 9.07e-25 114 30 6 295 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q0DKM0 9.9e-25 114 30 6 295 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q03228 7.79e-24 110 28 5 266 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P35164 1.13e-23 110 26 10 357 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q2T0V9 1.32e-23 110 28 8 323 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9SXL4 1.7e-23 111 26 6 304 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9SXL4 8.9e-09 63 28 4 140 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q55E44 1.87e-23 111 33 2 186 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 5.25e-10 67 29 3 133 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q55E44 1.74e-05 52 44 2 70 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q9C5U2 2.98e-23 110 28 8 311 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9C5U2 4.51e-08 61 27 3 137 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9KHI5 5.42e-23 108 34 5 230 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1A699 1.22e-22 108 36 0 155 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 1.08e-08 63 28 5 156 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
E0X9C7 1.37e-22 108 27 8 294 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 2.38e-10 68 26 8 282 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 9.75e-08 60 31 2 122 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
A5W4E3 1.52e-22 108 27 8 294 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 2.55e-10 68 26 8 282 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 1.24e-07 59 31 2 122 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q54SP4 2.59e-22 107 25 7 320 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 7.45e-13 77 26 6 272 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 4.64e-08 61 31 4 146 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 0.00015 49 29 2 108 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
A7N6S2 3.73e-22 106 25 22 520 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
A1A697 9.81e-22 105 32 0 159 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A697 8.77e-08 60 27 3 137 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
B1WYT4 1.24e-21 101 30 5 231 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q06904 1.97e-21 101 30 5 229 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55932 2.79e-21 101 28 3 223 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9C5U0 7.49e-21 102 35 0 157 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U0 9.57e-12 73 29 5 158 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
A1A698 1.05e-20 102 31 0 157 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 1.82e-10 68 29 3 137 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q8KIY1 1.06e-20 102 26 6 252 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 8.88e-13 76 25 9 288 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 5.57e-06 54 29 2 122 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
A3BE68 2.45e-20 100 32 3 204 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 2.7e-15 84 30 1 153 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A3BE68 1.5e-06 56 34 0 86 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
Q55630 2.62e-20 97 31 7 236 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A2YFR6 2.69e-20 100 32 3 204 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 2.75e-15 84 30 1 153 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A2YFR6 1.6e-06 55 34 0 86 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
P20169 7.5e-20 98 28 8 253 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DPL8 9.44e-20 97 29 5 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 9.44e-20 97 29 5 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q45614 9.61e-20 98 30 9 239 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P74111 1.44e-19 98 29 4 242 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O34206 1.71e-19 97 28 5 226 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
B7K3M6 2.83e-19 94 28 4 230 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P42245 3.15e-19 93 25 3 239 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P94414 3.64e-19 95 26 3 241 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q2JWK9 3.66e-19 94 30 6 242 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
A5A2P0 4.06e-19 94 28 7 259 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q8DKG0 4.58e-19 96 31 4 240 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P21865 5.61e-19 96 27 8 255 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
P33529 8.42e-19 95 29 7 269 2 PHY Phytochrome Mougeotia scalaris
Q8DMT2 1.82e-18 92 28 9 294 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9RDT3 2.74e-18 92 27 9 271 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
B0JK50 3.09e-18 91 27 4 231 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q1XD95 3.99e-18 93 29 6 237 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q2JKD9 4.59e-18 90 29 5 241 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P52101 4.79e-18 92 27 6 226 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P77485 5.86e-18 91 26 4 241 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8XA47 7.48e-18 91 27 6 226 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q8FK37 9.47e-18 90 26 5 241 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A6QD58 1.47e-17 91 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q4LAJ8 1.54e-17 91 28 10 274 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9P4U6 1.69e-17 91 24 7 332 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9P4U6 1.85e-08 62 29 7 193 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7A215 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 1.71e-17 90 27 9 271 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 1.71e-17 90 27 9 271 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 1.71e-17 90 27 9 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8XBY4 1.95e-17 90 26 5 241 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q4A159 2.5e-17 90 28 9 261 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CU87 2.98e-17 90 27 10 272 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 2.98e-17 90 27 10 272 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9RQQ9 3.6e-17 90 26 5 267 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q54Q69 4.12e-17 90 33 4 203 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 2.1e-12 75 35 2 122 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q54Q69 8.13e-05 50 39 1 69 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q40762 4.58e-17 90 27 16 347 2 None Phytochrome Picea abies
P30847 4.69e-17 89 25 3 241 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q6GKS6 5.59e-17 89 27 10 276 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q6GGK7 6.76e-17 89 28 5 239 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q7A5H7 7.31e-17 89 28 5 239 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 7.31e-17 89 28 5 239 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NWF3 9.41e-17 88 28 5 239 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 9.41e-17 88 28 5 239 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 9.41e-17 88 28 5 239 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 9.41e-17 88 28 5 239 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 9.92e-17 88 28 5 239 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8GP19 1.16e-16 87 23 7 299 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
I1WSZ3 1.81e-16 87 24 3 225 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q8YR50 3.43e-16 85 28 7 252 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 3.66e-16 85 28 7 252 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q01549 4.38e-16 87 27 9 299 3 PHY1 Phytochrome 1 Selaginella martensii
Q1B3X8 5.8e-16 81 35 1 129 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 5.8e-16 81 35 1 129 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 5.8e-16 81 35 1 129 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P51392 6.9e-16 85 29 8 247 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
B7KFU0 7.55e-16 84 27 6 244 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q86AT9 8.08e-16 86 32 1 162 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 9.2e-11 70 32 4 132 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 0.00022 49 38 0 68 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P0DMK6 1.07e-15 84 23 3 225 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
P39764 1.46e-15 84 24 9 294 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
O74539 2.14e-15 85 24 6 258 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74539 1.88e-07 59 30 3 123 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08408 2.35e-15 84 25 3 233 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q8D0P1 2.49e-15 77 36 2 117 3 cheY Chemotaxis protein CheY Yersinia pestis
P9WGM9 2.7e-15 79 36 1 122 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 2.7e-15 79 36 1 122 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 2.7e-15 79 36 1 122 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A0QTK3 3.01e-15 83 26 4 251 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9ZHD4 3.1e-15 83 24 3 229 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q93P00 3.24e-15 76 36 2 117 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
A0A0H3GPN8 3.36e-15 82 27 5 240 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q51455 4.17e-15 75 36 2 122 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1TEL7 4.38e-15 79 36 0 121 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P51586 4.4e-15 76 38 1 121 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P18392 5.07e-15 82 24 3 223 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P14377 5.79e-15 82 26 7 222 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
B2J946 7.16e-15 81 25 6 241 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q44007 1.52e-14 80 25 6 257 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A0QR01 1.65e-14 80 27 4 223 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q93CB7 1.83e-14 81 26 6 251 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A1KHB7 2.01e-14 77 36 1 122 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 2.01e-14 77 36 1 122 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q39557 2.03e-14 81 27 6 237 3 PHY2 Phytochrome 2 Ceratodon purpureus
Q2FWH7 2.48e-14 81 25 8 258 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q742C1 5.04e-14 75 35 1 122 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 5.04e-14 75 35 1 122 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P36505 5.55e-14 80 25 8 270 2 PHY1 Phytochrome 1 Physcomitrium patens
O34989 5.63e-14 79 23 5 244 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
O31661 6.41e-14 79 25 11 280 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q9KQD5 8.15e-14 72 36 2 117 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 8.15e-14 72 36 2 117 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q0IBF4 8.28e-14 77 24 8 276 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
A0R3I8 8.56e-14 75 37 0 113 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8X614 8.89e-14 78 25 7 222 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
O22267 9.17e-14 79 23 8 297 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
O22267 1.33e-05 53 30 6 140 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
P94608 9.92e-14 79 26 5 246 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q49XM6 1.13e-13 78 29 9 237 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGK8 1.18e-13 78 25 7 268 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.18e-13 78 25 7 268 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4I6 1.19e-13 77 24 6 235 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.19e-13 77 24 6 235 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0PWB4 1.22e-13 75 37 0 113 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P0AE82 1.48e-13 77 27 5 240 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.48e-13 77 27 5 240 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.48e-13 77 27 5 240 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q04804 1.51e-13 77 25 7 237 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7BWI3 1.53e-13 77 27 9 247 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9CCJ1 1.64e-13 78 25 6 251 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P72292 2.03e-13 77 25 4 247 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P9WGK9 2.28e-13 77 25 7 268 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9APE0 3.06e-13 76 25 7 222 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q8FGP6 3.5e-13 70 34 2 117 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A6X580 3.88e-13 70 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P08401 6e-13 75 23 6 242 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q07737 6.85e-13 76 24 4 258 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8FW53 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis biovar 1 (strain 1330)
A9WYT1 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VUU3 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YC73 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9MBQ2 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BBW0 8.03e-13 69 30 1 116 1 divK Polar-differentiation response regulator DivK Brucella abortus biovar 1 (strain 9-941)
Q2YKN1 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain 2308)
B2SB45 8.03e-13 69 30 1 116 3 divK Polar-differentiation response regulator DivK Brucella abortus (strain S19)
Q9CD68 8.13e-13 72 34 1 122 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q7V6P7 8.33e-13 74 25 9 264 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q06067 9.23e-13 75 25 8 269 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P0AE69 9.49e-13 69 33 2 117 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 9.49e-13 69 33 2 117 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 9.49e-13 69 33 2 117 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
A2C884 1.4e-12 73 25 8 262 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
P37461 1.48e-12 74 25 7 222 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8CSL7 1.58e-12 74 28 8 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q41046 1.6e-12 75 26 8 258 2 None Phytochrome Pinus sylvestris
Q5HPC4 1.64e-12 74 28 8 242 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P32040 1.7e-12 72 32 1 122 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P08400 1.79e-12 74 24 9 282 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q06240 1.85e-12 73 23 7 264 1 vanS Sensor protein VanS Enterococcus faecium
P26489 1.93e-12 74 28 9 263 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P9WGL3 2.66e-12 74 24 5 221 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 2.75e-12 74 24 5 221 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4L8M0 3.35e-12 73 25 6 240 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
P38889 3.41e-12 73 32 2 145 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7A0W5 3.52e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 3.52e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 3.52e-12 73 25 7 244 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 3.52e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 3.52e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 3.52e-12 73 25 7 244 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 3.52e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
P0A2D5 3.72e-12 67 33 2 117 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 3.72e-12 67 33 2 117 3 cheY Chemotaxis protein CheY Salmonella typhi
O69730 3.75e-12 70 33 0 108 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6GGZ4 3.84e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q2YY04 4.08e-12 73 25 7 244 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9ZHD3 5.21e-12 70 33 1 118 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P45609 5.22e-12 72 26 7 241 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q8Z332 5.97e-12 72 25 7 222 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q0DWC7 7.1e-12 73 23 5 249 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. japonica
Q55168 7.35e-12 73 26 5 240 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q83RR0 7.37e-12 69 31 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 7.37e-12 69 31 0 113 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q54W36 7.64e-12 73 33 2 148 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 4.31e-08 61 31 4 120 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
P23836 7.88e-12 69 31 0 113 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
P93528 9.03e-12 73 27 10 270 2 PHYC Phytochrome C Sorghum bicolor
Q75KW7 9.59e-12 66 29 2 127 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
Q9M8Y4 9.66e-12 67 37 2 107 2 ARR22 Two-component response regulator ARR22 Arabidopsis thaliana
Q8THF6 1.12e-11 72 25 5 248 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8GVV6 1.16e-11 66 32 3 117 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 1.16e-11 66 32 3 117 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
Q3AYV8 1.18e-11 71 26 7 260 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P0DM78 1.77e-11 68 30 0 113 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 1.77e-11 68 30 0 113 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 1.77e-11 68 30 0 113 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 1.77e-11 68 30 0 113 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 1.77e-11 68 30 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
E5KK10 1.78e-11 72 25 7 251 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q8Z7H2 1.93e-11 68 30 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q6T5K2 2.74e-11 71 23 5 249 2 ETR3 Ethylene receptor 3 Oryza sativa subsp. indica
Q9LCC2 2.74e-11 71 26 6 249 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9FAD7 2.76e-11 65 31 2 117 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P0ACZ8 4.19e-11 67 32 1 118 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 4.19e-11 67 32 1 118 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 4.19e-11 67 32 1 118 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
I1MGE5 4.34e-11 70 27 13 287 1 GLYMA_15G140000 Phytochrome B-2 Glycine max
Q9TLQ4 4.35e-11 67 32 1 122 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P39663 5.02e-11 67 31 2 141 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2HWG1 5.09e-11 64 33 2 109 2 RR12 Two-component response regulator ORR12 Oryza sativa subsp. japonica
Q4L6C5 5.43e-11 69 27 6 236 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
P29130 5.81e-11 70 26 10 283 2 PHYB Phytochrome B Nicotiana tabacum
P37739 6.38e-11 70 24 7 229 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q57QC3 9.74e-11 66 29 0 113 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q2HWG0 9.84e-11 63 33 2 106 2 RR13 Two-component response regulator ORR13 Oryza sativa subsp. japonica
P0AEV3 1.02e-10 67 35 1 112 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.02e-10 67 35 1 112 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.02e-10 67 35 1 112 3 rssB Regulator of RpoS Escherichia coli O157:H7
O78428 1.16e-10 66 33 1 112 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
O69729 1.18e-10 68 26 8 250 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9HZ47 1.39e-10 68 24 6 243 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
F4JZT3 1.4e-10 63 30 2 130 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
Q8X738 1.46e-10 65 30 0 113 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P14714 1.47e-10 69 27 7 232 1 PHYC Phytochrome C Arabidopsis thaliana
Q9HWR3 1.62e-10 68 26 6 233 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31671 1.76e-10 68 24 7 264 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P34094 1.99e-10 68 25 9 281 3 PHYB Phytochrome B Solanum tuberosum
P48259 2.09e-10 65 32 1 117 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P45608 2.18e-10 67 25 5 238 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P18540 3.17e-10 68 25 8 267 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P36557 3.53e-10 66 24 6 237 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7U871 3.67e-10 66 24 6 254 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
P10955 4.53e-10 67 25 12 304 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
L7N689 4.62e-10 64 28 1 131 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49ZT8 4.69e-10 64 31 2 116 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O34971 4.71e-10 67 25 8 244 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q4GZL0 4.81e-10 64 29 3 122 2 RR1 Two-component response regulator ORR1 Oryza sativa subsp. indica
Q47745 4.96e-10 66 25 6 236 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q2HWG4 5.53e-10 64 29 3 122 2 RR1 Two-component response regulator ORR1 Oryza sativa subsp. japonica
Q06065 6.12e-10 66 34 0 113 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P33530 6.94e-10 67 25 9 295 3 PHYA1 Phytochrome A1 Nicotiana tabacum
A2XM23 7.91e-10 67 26 10 270 3 PHYC Phytochrome C Oryza sativa subsp. indica
Q10CQ8 8.39e-10 66 26 10 270 2 PHYC Phytochrome C Oryza sativa subsp. japonica
Q9HU20 8.74e-10 66 23 10 302 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23621 9.51e-10 65 26 3 227 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0CL17 9.57e-10 63 29 1 127 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 9.57e-10 63 29 1 127 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P23222 9.62e-10 65 24 7 265 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9KM66 9.89e-10 66 28 1 139 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KM66 6.26e-06 53 23 7 234 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P43501 1.07e-09 60 31 1 109 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P33113 1.09e-09 65 22 7 250 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q47457 1.14e-09 65 25 6 230 3 pcoS Probable sensor protein PcoS Escherichia coli
P06594 1.15e-09 66 24 10 280 1 PHYA4 Phytochrome A type 4 Avena sativa
A7MRY4 1.28e-09 65 26 2 145 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P0C5S6 1.36e-09 65 26 2 145 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
Q9ZTP3 1.38e-09 65 25 6 243 1 EIN4 Protein EIN4 Arabidopsis thaliana
Q9ZTP3 3e-08 61 30 3 118 1 EIN4 Protein EIN4 Arabidopsis thaliana
Q08430 1.45e-09 65 25 8 252 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P42499 1.57e-09 65 26 9 280 3 PHYB Phytochrome B Glycine max
P15939 1.61e-09 65 23 8 264 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P39838 1.64e-09 65 20 7 352 1 rcsD Phosphotransferase RcsD Escherichia coli (strain K12)
Q9WY30 1.66e-09 64 32 1 107 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P13792 1.78e-09 62 33 0 103 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q49ZT9 2e-09 64 26 5 228 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGK5 2.01e-09 64 25 6 227 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.01e-09 64 25 6 227 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.01e-09 64 25 6 227 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZM64 2.14e-09 59 29 3 117 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P71403 2.25e-09 59 29 3 117 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P28835 2.45e-09 62 29 1 118 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q4L8L9 2.66e-09 62 32 1 108 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
A1W0A5 2.76e-09 59 30 3 117 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 2.76e-09 59 30 3 117 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 2.76e-09 59 30 3 117 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q04943 2.86e-09 64 25 10 260 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A3PDI2 2.88e-09 63 25 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q9ZS62 3.26e-09 64 24 10 281 2 PHYB1 Phytochrome B1 Solanum lycopersicum
P9WGN1 3.31e-09 61 28 1 114 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 3.31e-09 61 28 1 114 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q44006 3.48e-09 61 29 1 120 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P46384 3.59e-09 59 26 1 129 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I4F9 3.64e-09 61 30 0 112 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5A872 3.65e-09 64 29 3 174 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 1.57e-07 59 28 4 125 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A872 2.26e-05 52 35 0 74 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A2BRQ6 3.76e-09 63 24 7 254 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q2KCH7 3.82e-09 59 30 2 119 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O32193 4.16e-09 63 23 9 242 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P39928 4.23e-09 64 29 3 134 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 3.71e-07 58 36 2 98 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39928 5.74e-06 54 31 3 151 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P07168 4.77e-09 64 25 10 269 3 virA Wide host range VirA protein Rhizobium radiobacter
A8G5E7 5.41e-09 62 24 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
A6WZ81 6.04e-09 61 31 0 102 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8FZ93 6.95e-09 60 31 0 102 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 6.95e-09 60 31 0 102 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 6.95e-09 60 31 0 102 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 6.95e-09 60 31 0 102 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 6.95e-09 60 31 0 102 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 6.95e-09 60 31 0 102 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 6.95e-09 60 31 0 102 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 6.95e-09 60 31 0 102 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P16497 8.75e-09 63 26 7 250 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q31AE8 1.02e-08 62 25 8 258 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A0QTK2 1.12e-08 60 37 1 101 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O25153 1.14e-08 62 29 3 126 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
P87323 1.15e-08 62 27 2 143 4 mcs4 Response regulator mcs4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54883 1.18e-08 62 23 3 219 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P71380 1.2e-08 62 25 7 226 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P10799 1.34e-08 62 26 7 230 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P51358 1.44e-08 60 32 1 112 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
P30733 1.58e-08 62 25 9 299 2 PHYA Phytochrome A Solanum tuberosum
P31079 1.63e-08 59 36 2 125 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
A6QJK3 1.64e-08 59 29 2 119 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.64e-08 59 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q6YVX7 1.65e-08 60 25 3 152 2 RR2 Two-component response regulator ORR2 Oryza sativa subsp. japonica
Q4GZK9 1.65e-08 60 25 3 152 2 RR2 Two-component response regulator ORR2 Oryza sativa subsp. indica
P28257 1.67e-08 60 32 1 112 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P33639 1.77e-08 62 26 8 225 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A2X1N2 1.87e-08 62 33 2 118 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
Q02540 1.91e-08 59 27 1 118 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q7D9K0 1.94e-08 60 31 0 108 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 1.94e-08 60 31 0 108 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5HLN2 1.97e-08 59 31 1 108 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9HV32 2.01e-08 59 29 0 120 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6H805 2.04e-08 62 33 2 118 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
Q1XDC9 2.14e-08 59 32 1 112 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q7A1J1 2.19e-08 59 28 2 120 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 2.19e-08 59 28 2 120 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 2.19e-08 59 28 2 120 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 2.19e-08 59 28 2 120 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 2.19e-08 59 28 2 120 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 2.19e-08 59 28 2 120 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 2.19e-08 59 28 2 120 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 2.19e-08 59 28 2 120 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 2.19e-08 59 28 2 120 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 2.19e-08 59 28 2 120 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
P18769 2.26e-08 62 33 1 106 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q8CN92 2.27e-08 59 31 1 108 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B8B3I4 2.74e-08 61 31 2 118 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q5SML5 2.81e-08 61 31 2 118 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
P42498 2.98e-08 61 22 7 266 1 PHYE Phytochrome E Arabidopsis thaliana
Q6GE73 3.65e-08 58 30 4 124 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
P42497 3.7e-08 61 25 6 231 1 PHYD Phytochrome D Arabidopsis thaliana
Q7V113 3.73e-08 60 24 8 231 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q6H468 3.78e-08 57 27 2 118 2 RR11 Two-component response regulator ORR11 Oryza sativa subsp. japonica
B8AFR8 3.78e-08 57 27 2 118 3 RR11 Two-component response regulator ORR11 Oryza sativa subsp. indica
Q5A4X5 3.81e-08 60 29 0 115 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
B8H358 3.88e-08 58 27 0 102 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 3.88e-08 58 27 0 102 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7A039 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 3.94e-08 58 29 2 119 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
A3Q5L8 3.95e-08 60 24 5 233 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
P96368 4.15e-08 60 25 7 233 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q1B3X9 4.19e-08 60 24 5 233 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 4.19e-08 60 24 5 233 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
P19862 4.39e-08 61 25 8 227 3 PHYA1 Phytochrome A Zea mays
Q2HWH1 4.41e-08 56 30 2 104 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. japonica
Q4GZK6 4.41e-08 56 30 2 104 2 RR5 Two-component response regulator ORR5 Oryza sativa subsp. indica
P44918 5.63e-08 58 27 2 120 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5SML4 5.88e-08 60 22 9 303 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
Q5SML4 3.91e-06 54 25 4 151 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 5.88e-08 60 22 9 303 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YA15 3.91e-06 54 25 4 151 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
P06592 6.11e-08 60 25 9 299 2 PHYA Phytochrome A Cucurbita pepo
Q9CCJ2 6.13e-08 57 36 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q93CB8 6.43e-08 57 36 1 101 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P93527 6.56e-08 60 25 11 283 1 PHYB Phytochrome B Sorghum bicolor
P9WGM7 7.01e-08 57 36 1 101 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 7.01e-08 57 36 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 7.01e-08 57 36 1 101 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGM1 7.36e-08 57 35 0 93 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 7.36e-08 57 35 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 7.36e-08 57 35 0 93 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8CTI3 7.44e-08 59 22 4 223 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 7.44e-08 59 22 4 223 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1XDE4 7.64e-08 57 37 1 81 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P39664 8e-08 59 28 6 196 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P38684 9.44e-08 57 32 1 106 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P58357 1.02e-07 57 32 1 106 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q6K8X6 1.03e-07 59 30 2 137 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
P14712 1.06e-07 60 25 9 273 1 PHYA Phytochrome A Arabidopsis thaliana
Q2RAP3 1.09e-07 56 26 2 127 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. japonica
Q4GZK2 1.09e-07 56 26 2 127 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. indica
Q02541 1.11e-07 59 26 5 200 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q2QXY3 1.2e-07 56 26 2 127 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. japonica
B8BLZ4 1.2e-07 56 26 2 127 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. indica
P9WGK7 1.22e-07 58 22 5 230 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.22e-07 58 22 5 230 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.22e-07 58 22 5 230 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B8AEH1 1.23e-07 59 30 2 137 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q9ZWS9 1.44e-07 57 25 3 139 1 ARR3 Two-component response regulator ARR3 Arabidopsis thaliana
Q02482 1.59e-07 58 29 2 119 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q9FXD6 1.7e-07 58 30 2 115 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P06593 1.72e-07 59 23 11 293 1 PHYA3 Phytochrome A type 3 Avena sativa
P37478 2.04e-07 56 32 1 107 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P09431 2.11e-07 57 25 9 271 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P9WGM3 2.23e-07 55 32 2 108 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 2.23e-07 55 32 2 108 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ZEP3 2.29e-07 58 21 6 228 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P45605 2.47e-07 56 28 1 123 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
O05251 2.55e-07 56 30 3 120 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q03069 2.61e-07 57 21 6 230 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
P73276 2.74e-07 57 25 9 249 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45607 2.82e-07 56 28 1 123 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P30844 2.93e-07 57 24 5 270 1 basS Sensor protein BasS Escherichia coli (strain K12)
P0AFJ5 3.06e-07 55 28 1 123 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 3.06e-07 55 28 1 123 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
P14713 3.2e-07 58 25 9 258 1 PHYB Phytochrome B Arabidopsis thaliana
B8GZM2 3.21e-07 57 37 1 104 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 3.21e-07 57 37 1 104 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45606 3.24e-07 55 28 1 123 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P06628 3.33e-07 53 27 0 116 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P39486 3.47e-07 55 24 3 118 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q5N6V8 3.67e-07 57 32 2 115 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q10DU0 3.73e-07 58 23 10 292 2 PHYA Phytochrome A Oryza sativa subsp. japonica

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS06365
Feature type CDS
Gene rcsC
Product two-component system sensor histidine kinase RcsC
Location 1323441 - 1326290 (strand: -1)
Length 2850 (nucleotides) / 949 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_510
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07677 two-component system, NarL family, capsular synthesis sensor histidine kinase RcsC [EC:2.7.13.3] Two-component system
Biofilm formation - Escherichia coli
-

Protein Sequence

MRYFSSFQTSLKISRYLFRIVGVMLWGLGALVTVFYLLNIYNGMRNDIRQQYLSDYDALLAYFRQSADITRDIQYMNERFVEGKNEQGLIPTLKRTTDGSFIGYQPLNAKADCGVFRTTTGSYIIAFKDLLTYWQDNISAPQGLNQVFLIGSKTFCMVSFPIKNLSTDPETLRRMVNDYSQYYFKLKSQGKERTIYWIAPGSNQGTGSLFIMMPIYYDGQFLALMGIERNLQLENYNRLRQFPVNLLIMNEQNERVLSYPNEVNTQKNKDSYQVEDNYFGYDAEFTQLMLKRKLTPSSFNVIYTTPLSAIYEKLKFQLLNGAILNLISAIFIGLFTWILERRIFMPAENNAVRLEEHEQFNHKIVASAPVGICILRTQDGTALLSNELAHNYWRMLSFEDRNRIGLLIKEKRQGMEDMVTRNGGHLQVSFVHSRYQNEEVAICVLVDISARVQLESSLQEVAQAAEQANQSKSMFLATVSHELRTPLYGIIGNLELLQSMAHSQDAQRLLGTMNNSSSLLLKIISDILDFSKIESKQLKIETREFNFREHIHFVVANYLPLVAKKHLSLYCFIEKDVPELVCNDPVRMQQVIANLFNNAIKYTQVGMVCIHVYVHGDYLHVDIQDTGGGISDDELRQLFDPFYQIIPNRDSPSQGTGLGLPICEKLISLMDGDMIVESQKEVGSLFGIRFPLYTAYRSGNCTDIEPLTFPLVFEFNNRVLADYMQCAWSGIAPALLSVDECTDLSQAVVITDMVTPAMKQARLLIELNAGYTDKPVPQGGNHWLHNTHQLDGLYEFIADRLDNRKEEPDDMPPPALPDNQQANYVRILIVDDHPINRHLLSDQLHLFGFHTATADDGLDALNFLETHEVDIILSDVNMPNMNGYDLTRALRGKGVVLPIIGITANAMAEERERCLAAGMNDCLSKPVSMQSLRTMMQKYVPEVTPVKPA

Flanking regions ( +/- flanking 50bp)

AGAGTCTGAAACCTTATGAATATATAAGGTTCATTATTGGCGGAGCCCCTTTGAGATACTTTTCATCATTCCAGACATCACTAAAAATTTCGCGTTATCTGTTCCGGATCGTCGGTGTGATGTTATGGGGATTGGGCGCACTGGTTACCGTATTCTATTTGCTGAATATCTATAACGGGATGCGTAATGATATCCGCCAGCAATATCTTTCAGATTATGATGCGTTATTAGCGTATTTCCGGCAATCCGCAGATATTACGCGTGATATTCAGTATATGAATGAGCGGTTTGTCGAGGGTAAAAATGAGCAGGGACTGATCCCGACACTCAAACGCACGACAGACGGGTCTTTTATTGGTTATCAGCCGTTGAATGCCAAAGCGGATTGTGGTGTATTCCGCACCACCACCGGCTCTTATATTATCGCATTTAAAGATCTTCTTACTTATTGGCAGGATAATATTTCTGCACCCCAGGGACTGAACCAGGTTTTTCTGATCGGTTCTAAAACATTTTGCATGGTATCGTTCCCGATAAAAAACCTCTCCACCGACCCGGAAACGCTGCGCAGAATGGTCAATGATTATTCACAGTATTATTTCAAACTGAAAAGTCAGGGAAAAGAGCGGACTATTTACTGGATTGCGCCGGGGAGCAATCAGGGGACGGGCAGTCTGTTTATTATGATGCCAATCTATTATGACGGGCAGTTTCTTGCGCTGATGGGAATTGAACGTAACCTGCAATTGGAAAATTATAATCGTCTGCGTCAGTTCCCGGTCAATCTTCTGATTATGAATGAGCAGAATGAGAGAGTATTGTCGTATCCGAATGAAGTTAATACGCAGAAGAATAAAGACAGCTATCAGGTTGAAGATAATTATTTCGGTTATGATGCAGAATTTACCCAGTTGATGCTCAAACGCAAACTGACACCTTCCTCTTTTAATGTGATTTATACCACGCCGCTGAGTGCCATTTATGAAAAACTGAAATTTCAGTTGCTCAATGGTGCAATACTGAACCTGATCTCCGCCATTTTTATCGGGCTGTTTACCTGGATTCTGGAACGGCGGATTTTTATGCCAGCCGAGAATAATGCCGTGCGTCTGGAAGAGCATGAGCAGTTCAATCATAAAATTGTAGCCTCTGCACCTGTCGGTATCTGTATTTTGCGGACTCAGGACGGAACCGCACTGCTGAGTAATGAGCTGGCACATAATTACTGGCGTATGCTCTCTTTTGAGGATCGCAACCGTATCGGGCTTCTGATTAAAGAAAAGCGCCAGGGAATGGAAGATATGGTGACCCGTAACGGAGGACACCTTCAGGTCAGTTTTGTGCATTCGCGCTATCAGAATGAGGAAGTGGCTATCTGTGTGCTGGTGGATATCAGCGCCCGTGTACAACTGGAAAGCTCGTTACAGGAAGTGGCACAGGCGGCAGAGCAGGCGAACCAGTCCAAGTCCATGTTCCTCGCAACCGTCAGCCATGAGCTGCGTACCCCGTTGTACGGCATTATCGGTAACCTGGAACTGCTGCAGTCAATGGCGCACTCCCAGGATGCACAGCGCCTGCTGGGCACCATGAATAACTCCTCATCTCTGTTACTGAAAATTATCAGCGATATTCTCGATTTCTCTAAAATTGAGTCCAAACAGCTGAAAATTGAGACGAGAGAGTTTAATTTCCGCGAACATATCCATTTTGTTGTGGCGAACTATTTGCCGCTGGTGGCAAAAAAACACCTTTCGCTGTACTGCTTTATTGAAAAAGATGTGCCGGAGCTGGTGTGTAATGACCCGGTACGTATGCAGCAGGTGATCGCCAATCTGTTTAATAATGCGATTAAATATACGCAGGTTGGTATGGTATGCATTCATGTTTATGTACACGGTGACTATCTGCATGTGGATATTCAGGATACCGGCGGCGGCATAAGCGATGATGAATTGCGCCAGTTGTTTGATCCCTTCTATCAGATTATACCGAACAGGGACAGCCCGTCTCAGGGCACCGGGCTGGGGCTGCCTATCTGTGAGAAACTGATCTCACTGATGGACGGTGACATGATTGTGGAGTCACAGAAAGAAGTCGGCAGCCTGTTCGGGATACGTTTTCCGCTTTATACCGCGTACCGGTCCGGCAATTGTACTGATATTGAGCCGCTGACATTCCCTCTGGTGTTTGAATTCAATAACCGTGTGCTGGCCGATTATATGCAGTGTGCGTGGTCAGGGATCGCCCCGGCACTGCTCAGTGTGGATGAGTGCACGGATTTATCGCAGGCGGTGGTGATAACGGATATGGTTACACCGGCGATGAAGCAGGCGCGGCTGCTGATTGAACTTAATGCAGGTTATACCGATAAGCCCGTGCCGCAGGGTGGAAACCACTGGCTTCATAATACCCATCAGCTTGATGGTCTGTATGAATTTATCGCTGACCGGCTGGATAATCGCAAAGAAGAGCCGGATGATATGCCGCCACCGGCACTGCCGGATAATCAGCAGGCGAATTATGTCCGTATCCTGATTGTGGATGACCATCCGATCAACCGCCATCTGCTTTCAGATCAATTGCATCTGTTTGGTTTCCATACGGCGACGGCGGATGACGGACTGGATGCCCTGAATTTTCTGGAAACCCATGAAGTGGATATCATTTTGTCGGATGTTAATATGCCGAATATGAACGGCTATGATTTGACACGGGCATTGCGCGGGAAGGGCGTGGTGCTGCCGATTATCGGTATCACCGCAAATGCGATGGCAGAAGAGCGTGAGCGCTGTCTGGCCGCCGGTATGAATGATTGCCTCTCCAAACCGGTATCAATGCAGTCACTGCGCACCATGATGCAGAAATATGTACCGGAGGTTACCCCGGTAAAACCGGCGTAACCGGGTGTGGTAACAGGATAAAAAAACCGCCGTTCACTGAACGGCGGTTT