Homologs in group_365

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16475 FBDBKF_16475 55.2 Morganella morganii S1 baeS two-component system sensor histidine kinase BaeS
EHELCC_08340 EHELCC_08340 55.2 Morganella morganii S2 baeS two-component system sensor histidine kinase BaeS
NLDBIP_08665 NLDBIP_08665 55.2 Morganella morganii S4 baeS two-component system sensor histidine kinase BaeS
LHKJJB_05600 LHKJJB_05600 55.2 Morganella morganii S3 baeS two-component system sensor histidine kinase BaeS
HKOGLL_05315 HKOGLL_05315 55.2 Morganella morganii S5 baeS two-component system sensor histidine kinase BaeS
F4V73_RS02990 F4V73_RS02990 54.6 Morganella psychrotolerans baeS two-component system sensor histidine kinase BaeS
F4V73_RS10185 F4V73_RS10185 28.4 Morganella psychrotolerans - HAMP domain-containing sensor histidine kinase

Distribution of the homologs in the orthogroup group_365

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_365

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30847 2.7e-169 487 53 2 452 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P94414 5.91e-35 139 28 8 345 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q9RDT3 9.82e-35 137 35 4 229 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
A5A2P0 2.59e-34 136 35 7 231 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
A6QD58 1.46e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 1.61e-33 136 35 4 229 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 1.61e-33 136 35 4 229 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 1.61e-33 136 35 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ8 3.24e-33 135 35 5 229 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q8CU87 5.16e-33 135 35 5 229 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 5.16e-33 135 35 5 229 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKS6 5.39e-33 135 34 4 229 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P23545 1.37e-32 133 35 3 229 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q4A159 1.52e-32 133 34 4 229 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P35164 2.56e-32 132 33 3 230 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P35164 0.000142 48 29 0 74 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q7A5H7 1.26e-30 127 32 3 226 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q7A5H7 0.000226 47 31 1 69 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 1.26e-30 127 32 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99TZ9 0.000226 47 31 1 69 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9L523 1.62e-30 127 32 3 226 1 srrB Sensor protein SrrB Staphylococcus aureus
Q9L523 0.000226 47 31 1 69 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 1.66e-30 127 32 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q8NWF3 0.000224 47 31 1 69 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.66e-30 127 32 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q6G973 0.000224 47 31 1 69 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.66e-30 127 32 3 226 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q5HFT1 0.000224 47 31 1 69 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.66e-30 127 32 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FY80 0.000224 47 31 1 69 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GGK7 1.85e-30 127 32 3 226 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q6GGK7 0.000229 47 31 1 69 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q45614 3.69e-30 126 33 4 235 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q45614 1.76e-05 50 23 12 259 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q6GGZ4 2.9e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 3.13e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 3.13e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 3.13e-29 122 27 6 304 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 3.13e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 3.13e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 3.13e-29 122 27 6 304 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 3.13e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 3.26e-29 122 27 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q93CB7 7.64e-29 122 29 6 295 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9ZHD4 1.29e-28 121 28 7 299 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q8XBY4 2.33e-27 117 28 5 294 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
O34638 2.8e-27 117 29 8 262 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q5HPC4 2.97e-27 117 28 6 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8FK37 5.8e-27 116 28 5 294 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8CSL7 6.73e-27 115 28 6 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P77485 7.22e-27 116 28 5 294 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q4L6C5 8.06e-27 115 29 6 284 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q9CCJ1 1.13e-26 116 27 6 302 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P9WGK9 3.92e-26 114 27 5 291 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 4.03e-26 114 27 5 291 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 4.03e-26 114 27 5 291 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45608 6.39e-26 112 28 6 259 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
A0QTK3 6.4e-26 114 26 5 292 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A8Z553 6.41e-26 113 29 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 6.41e-26 113 29 6 296 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 6.41e-26 113 29 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 6.41e-26 113 29 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 6.41e-26 113 29 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q6GE72 7.61e-26 112 28 5 293 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q9Z5G7 1.37e-25 112 29 9 308 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
A0QR01 2.57e-25 110 28 2 229 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7A3X0 2.73e-25 111 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 2.73e-25 111 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 2.73e-25 111 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 2.73e-25 111 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 2.73e-25 111 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YZ23 2.9e-25 111 30 9 298 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8DPL8 4.08e-25 110 30 4 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 4.08e-25 110 30 4 226 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4L8M0 4.71e-25 110 25 5 308 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q04943 5.13e-25 111 30 6 292 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0AE82 9.69e-25 109 27 7 277 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 9.69e-25 109 27 7 277 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 9.69e-25 109 27 7 277 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q8NV46 1.08e-24 109 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.08e-24 109 28 6 296 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q49XM6 1.43e-24 108 28 4 282 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P21865 1.69e-24 110 30 9 285 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
O69729 2.72e-24 108 29 10 316 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O34206 2.99e-24 109 28 3 228 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
A0A0H3GPN8 7.25e-24 107 26 7 277 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q49ZT9 2.23e-23 105 26 4 274 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P08400 3.2e-23 104 26 6 280 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
A0R3I7 3.97e-23 105 28 7 274 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P54302 4.06e-23 106 31 6 235 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P54883 4.88e-23 104 31 4 239 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q8ZPP5 5.81e-23 105 26 5 313 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1TEL6 6.36e-23 104 27 8 309 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A3Q5L8 6.84e-23 104 27 7 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q8CRA8 6.86e-23 104 28 5 260 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1B3X9 7.1e-23 104 27 7 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 7.1e-23 104 27 7 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
P9WGK5 7.52e-23 103 28 3 251 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 7.52e-23 103 28 3 251 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 7.52e-23 103 28 3 251 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8KIY1 1.04e-22 105 29 7 248 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 2.01e-09 63 26 8 237 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q742C0 1.08e-22 104 27 8 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q7A1J2 1.58e-22 101 25 6 280 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.58e-22 101 25 6 280 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.58e-22 101 25 6 280 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.58e-22 101 25 6 280 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.58e-22 101 25 6 280 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5W4E3 1.59e-22 104 28 5 246 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 8.85e-07 55 25 7 235 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1KHB8 1.64e-22 103 27 8 293 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.64e-22 103 27 8 293 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q840P7 1.67e-22 101 25 6 280 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
P45609 1.67e-22 102 26 6 280 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q6GIT7 1.77e-22 101 25 6 280 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
A0PWB3 1.93e-22 103 27 9 291 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q5HHW5 1.95e-22 101 25 6 280 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.95e-22 101 25 6 280 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.95e-22 101 25 6 280 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
E0X9C7 2.73e-22 103 28 5 246 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 9.82e-07 55 25 7 235 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P48027 3.35e-22 103 23 4 351 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q5HLN1 4.01e-22 102 28 5 260 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WGL1 4.35e-22 102 27 8 293 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 4.35e-22 102 27 8 293 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 4.35e-22 102 27 8 293 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A0QBR0 4.85e-22 102 27 8 279 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q47457 6.03e-22 101 26 6 283 3 pcoS Probable sensor protein PcoS Escherichia coli
Q55932 8.19e-22 100 30 5 224 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DMT2 1.84e-21 99 28 6 257 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q87GU5 1.91e-21 101 29 6 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q47745 2.45e-21 99 23 13 453 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
P20169 5.23e-21 99 29 8 264 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q02541 1.32e-20 97 28 6 263 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q07737 2.47e-20 97 24 7 309 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P42245 2.7e-20 94 27 5 243 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
O32193 2.7e-20 96 22 7 294 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q8YR50 2.76e-20 95 27 6 258 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 2.87e-20 95 27 6 258 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q83RR1 2.97e-20 96 22 8 296 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
P23837 3.02e-20 96 22 8 296 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8FIB8 3.44e-20 96 22 8 296 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9SXL4 5.03e-20 97 26 5 253 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9P896 5.43e-20 96 28 6 234 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54SP4 6.56e-20 96 24 3 250 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 8.17e-14 77 25 10 300 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P39664 8.67e-20 94 30 5 255 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9F8D7 1.24e-19 95 22 5 351 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q8D5Z6 1.3e-19 95 28 3 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 1.39e-19 95 28 3 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
B2J946 1.46e-19 94 26 7 275 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P9WGK7 1.79e-19 94 26 12 357 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.79e-19 94 26 12 357 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.79e-19 94 26 12 357 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0DM80 1.99e-19 94 23 8 306 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 1.99e-19 94 23 8 306 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 1.99e-19 94 23 8 306 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 1.99e-19 94 23 8 306 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 1.99e-19 94 23 8 306 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 1.99e-19 94 23 8 306 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 2.01e-19 94 23 8 306 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
Q8GP19 2.42e-19 93 25 6 271 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P0A4I8 2.52e-19 93 24 5 289 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2.52e-19 93 24 5 289 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9RQQ9 3.02e-19 94 27 3 232 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P72292 3.6e-19 93 25 7 312 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q9KHI5 4.42e-19 94 27 2 223 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2JWK9 4.79e-19 92 26 5 251 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q2JKD9 4.84e-19 92 25 7 274 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P0DMC5 6.65e-19 93 25 4 246 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q8X739 7e-19 92 22 8 296 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
P0DMC6 7.21e-19 93 25 4 246 1 rcsC Sensor histidine kinase RcsC Escherichia coli
B0JK50 8.57e-19 91 26 6 254 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q06240 9.07e-19 91 26 5 239 1 vanS Sensor protein VanS Enterococcus faecium
A0A4P7TSF2 1.17e-18 91 28 6 273 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 1.17e-18 91 28 6 273 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 1.17e-18 91 28 6 273 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P76339 1.22e-18 91 25 6 279 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P08982 1.91e-18 90 27 6 273 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.91e-18 90 27 6 273 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P18392 2.21e-18 90 25 4 268 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P58356 2.64e-18 91 24 8 339 3 torS Sensor protein TorS Escherichia coli O157:H7
Q56128 5.64e-18 90 25 4 246 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 6.57e-18 90 25 3 243 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KLK7 7.86e-18 90 27 3 234 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B1WYT4 7.87e-18 88 27 6 254 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P41406 1.19e-17 88 27 6 273 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
P0A4I6 1.3e-17 88 29 6 233 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.3e-17 88 29 6 233 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8CTI3 1.33e-17 87 26 11 303 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.33e-17 87 26 11 303 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P36557 1.4e-17 87 26 6 300 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37461 1.53e-17 88 30 7 223 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 1.6e-17 88 30 7 223 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q44930 1.76e-17 87 24 7 281 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P94608 2.6e-17 88 29 3 219 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P23621 2.79e-17 87 30 3 210 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O14002 2.91e-17 88 28 3 214 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P39453 3.25e-17 88 23 7 336 1 torS Sensor protein TorS Escherichia coli (strain K12)
B7K3M6 5.39e-17 85 27 8 257 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q44007 1.08e-16 85 23 6 310 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P30844 1.42e-16 84 26 7 303 1 basS Sensor protein BasS Escherichia coli (strain K12)
P0AEC5 1.65e-16 85 24 5 341 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.65e-16 85 24 5 341 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.65e-16 85 24 5 341 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q8FZ86 1.92e-16 85 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 1.92e-16 85 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q57BR6 2.06e-16 85 27 4 240 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 2.06e-16 85 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 2.06e-16 85 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
P59342 2.11e-16 85 24 5 341 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q8YIM6 2.13e-16 85 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q08408 3.93e-16 84 24 3 233 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
A9M715 4.34e-16 84 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q06904 5.37e-16 82 25 7 256 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B7KFU0 7.31e-16 82 24 6 254 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q55630 7.74e-16 82 24 6 254 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8X614 8.01e-16 82 28 5 220 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
P30855 1.17e-15 83 27 12 284 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
O33071 1.42e-15 82 25 11 353 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
A6X5X4 2.89e-15 82 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9HZ47 3.05e-15 81 28 8 276 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5VRX4 3.19e-15 82 27 4 240 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A2C884 3.76e-15 80 27 6 221 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q86CZ2 3.89e-15 82 27 3 219 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
P58402 5e-15 81 26 8 245 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P14377 5.08e-15 80 28 5 220 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q7U871 7.29e-15 79 26 7 222 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q1XD95 9.24e-15 80 29 7 227 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q8XA47 1.06e-14 79 24 5 290 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q54YZ9 1.66e-14 80 25 8 290 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q8E3C7 1.92e-14 78 23 7 274 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
P9WGL3 2.15e-14 79 28 8 276 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7BWI3 2.21e-14 78 26 7 253 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7V6P7 2.22e-14 77 26 6 221 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P9WGL2 2.25e-14 79 28 8 276 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P49333 2.3e-14 79 25 2 219 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P0DMK6 2.58e-14 78 24 6 267 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
P52101 3e-14 78 24 5 290 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q54RP6 3.34e-14 79 28 5 222 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q8THF6 4.3e-14 78 30 2 169 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q3AYV8 4.48e-14 77 25 6 218 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q8DXQ8 4.48e-14 77 23 7 274 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DN03 4.76e-14 77 24 10 305 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 4.76e-14 77 24 10 305 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
I1WSZ3 4.87e-14 77 24 5 258 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q9APE0 5.89e-14 77 28 7 221 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q0IBF4 8.46e-14 76 26 6 218 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
O31661 1.04e-13 77 26 6 217 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P37894 1.68e-13 76 22 5 260 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45336 1.97e-13 75 25 9 309 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34989 2.06e-13 75 21 13 374 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q04804 2.15e-13 75 24 9 288 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DKG0 2.39e-13 75 25 4 243 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P51392 2.57e-13 75 27 8 230 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q551X9 3.63e-13 75 29 6 226 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q3S4A7 3.64e-13 75 23 7 268 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P08401 3.66e-13 74 26 8 250 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q9M7M1 3.68e-13 75 23 2 223 2 ETR1 Ethylene receptor Prunus persica
Q9HV31 3.93e-13 74 30 5 204 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q53RH0 4.31e-13 75 23 2 223 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 4.31e-13 75 23 2 223 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q7V113 1.15e-12 72 26 6 237 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
O49230 1.4e-12 73 24 2 228 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q70FG9 3.41e-12 71 26 8 281 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q54U87 3.63e-12 72 24 7 254 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
O82436 3.81e-12 72 23 3 223 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9P7Q7 4.1e-12 72 28 4 209 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2T0V9 4.26e-12 72 25 5 227 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5A599 4.32e-12 72 23 9 291 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8Z3P2 4.84e-12 71 30 7 243 3 qseC Sensor protein QseC Salmonella typhi
Q8ZLZ9 4.97e-12 71 29 6 243 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P71380 5.73e-12 70 26 9 240 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P96368 7.63e-12 70 28 14 315 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A3PDI2 8.9e-12 70 24 7 253 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
A2BRQ6 9.15e-12 70 24 7 253 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
P74111 1.06e-11 70 27 3 229 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q41342 1.18e-11 70 22 2 223 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
T2KMF4 1.19e-11 70 23 7 246 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q31AE8 1.3e-11 69 25 7 253 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q9XH57 1.48e-11 70 23 3 223 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q54YH4 1.51e-11 70 29 7 211 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
O49187 1.61e-11 70 21 3 231 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q06067 1.73e-11 70 26 7 226 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
A3BE68 1.8e-11 70 24 9 308 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
Q9ZWL6 1.88e-11 70 23 2 223 2 ETR1 Ethylene receptor Passiflora edulis
A2YFR6 2.1e-11 70 24 9 308 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
O81122 2.15e-11 69 24 5 234 2 ETR1 Ethylene receptor Malus domestica
Q9LCC2 2.82e-11 69 24 7 272 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q55168 4e-11 68 23 6 243 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9SSY6 4.27e-11 68 23 3 229 2 ETR1 Ethylene receptor 1 Cucumis sativus
A8G5E7 5.46e-11 67 24 7 253 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q08430 7.44e-11 67 25 9 242 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q869S5 7.46e-11 68 27 4 212 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P0C0F6 8.01e-11 68 28 6 215 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9HWR3 9.23e-11 67 25 4 207 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C0F7 9.63e-11 67 28 6 215 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q8X524 1.03e-10 67 28 11 279 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q52969 1.03e-10 67 24 3 224 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
E5KK10 1.19e-10 67 25 8 231 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q03228 1.46e-10 67 26 5 226 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8CTL4 2.6e-10 65 23 12 302 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 2.6e-10 65 23 12 302 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P44578 3.1e-10 65 25 5 213 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40719 3.99e-10 65 28 12 292 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q4UMD4 4.55e-10 65 26 18 326 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9I0I2 4.67e-10 65 23 9 276 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q95PI2 5.01e-10 65 26 5 231 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q5AHA0 5.07e-10 65 26 6 223 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q82EB2 7e-10 64 25 10 293 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q49VK4 7.94e-10 63 24 11 274 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q38846 8.31e-10 64 23 3 221 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P33113 8.37e-10 64 24 9 238 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q9XH58 1.12e-09 64 22 2 223 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
A7HD43 1.13e-09 63 25 6 225 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
P0AEC4 1.65e-09 63 25 7 226 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 1.65e-09 63 25 7 226 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 1.85e-09 63 25 7 226 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P39764 1.86e-09 63 22 5 226 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q9I4F8 2.49e-09 62 22 5 240 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37739 3.25e-09 62 25 7 239 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
P73276 3.91e-09 62 28 12 248 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P26762 4.05e-09 62 23 7 244 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P40330 5.03e-09 62 23 7 244 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
O48929 6.24e-09 62 22 3 223 2 ETR1 Ethylene receptor Nicotiana tabacum
Q92H24 6.77e-09 61 25 16 319 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P16497 8.27e-09 61 25 6 217 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q4L482 1.45e-08 60 23 13 304 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
A1A697 1.46e-08 61 22 4 283 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q9HUI3 1.68e-08 60 27 7 220 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZEP3 2.06e-08 60 27 8 220 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9C5U1 2.93e-08 60 20 7 339 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q02482 2.93e-08 59 25 7 180 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q6GJ10 4.06e-08 58 21 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
P0A2D9 4.19e-08 58 26 9 233 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 4.19e-08 58 26 9 233 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
O34971 4.69e-08 59 26 7 232 3 kdpD Sensor protein KdpD Rathayibacter rathayi
P16575 5.32e-08 59 23 7 244 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q68WC5 6.19e-08 58 24 15 317 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O24972 8.72e-08 57 25 10 251 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
Q9R6X3 1.01e-07 58 26 7 232 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9ZCU7 1.38e-07 57 24 15 322 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
O22267 1.39e-07 57 21 8 292 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q7A6Z3 2.13e-07 56 20 10 276 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 2.13e-07 56 20 10 276 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 2.13e-07 56 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 2.13e-07 56 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 2.13e-07 56 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P0AFB7 2.21e-07 56 25 8 224 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 2.21e-07 56 25 8 224 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 2.21e-07 56 25 8 224 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
O31671 2.51e-07 56 24 7 219 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P39215 2.54e-07 57 24 5 174 1 mcpB Methyl-accepting chemotaxis protein McpB Bacillus subtilis (strain 168)
A8Z182 3.24e-07 55 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 3.24e-07 55 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 3.24e-07 55 20 10 276 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 3.24e-07 55 20 10 276 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 3.24e-07 55 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 3.33e-07 55 20 10 276 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 3.33e-07 55 20 10 276 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
O74539 4.27e-07 56 23 9 259 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2YSS1 4.51e-07 55 22 14 282 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P06218 4.73e-07 55 25 9 233 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
P19906 4.74e-07 55 24 10 257 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q03069 5.28e-07 55 21 6 234 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
A1A696 6.5e-07 55 22 6 291 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A2WYI4 6.61e-07 55 22 6 291 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
Q0DKM0 6.73e-07 55 21 4 232 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
A1A699 7.3e-07 55 21 5 302 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q9HU20 8.36e-07 55 26 8 223 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39928 1.2e-06 55 36 2 75 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B8AY75 1.25e-06 54 21 4 232 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q2FWH7 1.99e-06 54 20 6 249 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
G3XDA3 3.03e-06 53 34 1 87 1 ctpH Methyl-accepting chemotaxis protein CtpH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O07777 3.26e-06 50 35 2 91 1 Rv0601c Sensor histidine kinase component HK2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9KM66 4.03e-06 53 25 8 255 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1RJB3 6.4e-06 52 24 14 299 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q5A872 1.27e-05 51 36 2 69 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q55E44 1.81e-05 51 23 4 193 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P09431 3.12e-05 49 23 7 233 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O31433 3.26e-05 49 24 7 224 3 ybdK Sensor histidine kinase YbdK Bacillus subtilis (strain 168)
P0C5S6 3.84e-05 50 21 6 238 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
A1A698 3.9e-05 50 23 3 175 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A7MRY4 3.94e-05 50 21 6 238 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P07168 4.94e-05 49 24 15 404 3 virA Wide host range VirA protein Rhizobium radiobacter
Q6HNQ4 6.54e-05 49 25 4 153 3 BT9727_0469 Probable methyl-accepting chemotaxis protein BT9727_0469 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P23222 9.55e-05 48 22 7 235 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7D9K1 0.000114 47 27 4 184 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9C5U0 0.000127 48 26 3 162 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q9C5U2 0.000129 48 25 2 156 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
P42707 0.000179 47 21 11 313 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
Q88IY8 0.000265 47 32 4 99 1 mcpP Methyl-accepting chemotaxis protein McpP Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q02929 0.000316 47 27 1 96 3 Cthe_0039 Putative sensory transducer protein Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q54Q69 0.000365 47 28 6 174 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q8ZPP6 0.000382 46 27 5 157 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P18540 0.000394 46 24 10 259 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P26489 0.000395 46 23 9 263 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q86AT9 0.001 45 29 0 77 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07745
Feature type CDS
Gene baeS
Product two-component system sensor histidine kinase BaeS
Location 1695686 - 1697062 (strand: 1)
Length 1377 (nucleotides) / 458 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_365
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07642 two-component system, OmpR family, sensor histidine kinase BaeS [EC:2.7.13.3] Two-component system -

Protein Sequence

MKLRSKLFLVIFATCMIVVFAMHIGIRSSFQQGFIGYIKKNSEQRATLLAEALSDQYQLTGDWRFLNRDDRSIYQILRTIDQISQSGEGPAPRGWRTQFWIVDKQMKRLFGHDNQFPAETFKKPITYHDEIVGWVIVSAADKISNEADISFDKQQLRTSWIIAGLTVLFALLITLILSRSMIRPVKRLVEATHKLAAGDFAVRVTPTNKDEISQLATDFNQLASTLEKNEQIRRDYMADISHELRTPLAILKGELEALQDGVRKPTAETLNSLLFEVTNLTKLVNDLHQLSLSDRGSLTYRKDFIDINEIILLAVASYRHIYQAKEIALQTDLDDNVKLIVQADPDRLIQLFHNLLENSVRYTNSGGQLHISSKREHNNVLIVWEDSAPGLDKAQYEAVFQRFYRAESSRNRSSGGSGLGLAICENIVEAHNGKIMAMPSAIGGVKILIVLPVYSEDN

Flanking regions ( +/- flanking 50bp)

GTTCGCCAACGTTGGCAACAGCGACGCCATAACAAAAAAGAGGCAAATGCATGAAACTAAGAAGTAAGCTATTTTTGGTGATCTTCGCGACTTGCATGATAGTGGTATTTGCTATGCATATCGGTATTCGTAGTAGCTTCCAGCAGGGGTTTATTGGCTATATCAAGAAAAACAGTGAACAGCGGGCAACCTTGTTAGCCGAAGCGTTAAGCGATCAATATCAATTAACCGGAGATTGGCGTTTTCTCAATCGAGACGATCGCTCTATTTATCAGATACTACGAACCATTGACCAAATAAGTCAAAGTGGTGAAGGCCCTGCCCCTCGAGGATGGCGTACTCAGTTTTGGATCGTCGATAAACAGATGAAACGCTTATTTGGCCATGATAATCAATTTCCCGCAGAAACCTTTAAAAAACCTATTACTTATCATGATGAAATTGTCGGCTGGGTGATTGTCAGTGCAGCGGATAAAATCAGCAACGAAGCAGATATTAGCTTTGATAAGCAACAGTTACGCACCAGTTGGATCATTGCCGGCTTAACGGTGCTTTTTGCGCTATTAATTACGTTAATACTGTCACGCAGCATGATCCGCCCAGTAAAGCGATTAGTGGAGGCAACCCATAAATTAGCCGCTGGCGATTTTGCTGTTCGCGTGACCCCAACCAATAAAGATGAAATCAGCCAGCTAGCAACGGATTTTAATCAACTTGCCAGTACACTGGAAAAAAATGAGCAAATTCGCCGTGATTATATGGCAGATATCTCCCATGAGTTACGTACGCCATTGGCTATCTTAAAAGGAGAGCTTGAAGCGTTACAAGATGGTGTAAGAAAGCCAACTGCAGAAACGTTAAATTCATTACTCTTTGAAGTAACAAATTTAACTAAACTGGTAAACGATCTACATCAGTTATCATTATCTGATAGAGGCTCTTTGACCTATCGTAAGGATTTTATTGATATTAATGAAATTATTTTGTTAGCTGTCGCCTCTTATCGGCATATTTATCAAGCCAAAGAGATTGCTTTACAGACTGATTTAGATGATAACGTCAAACTGATTGTTCAAGCTGATCCGGATAGGTTGATCCAACTTTTTCATAATCTATTAGAAAACAGTGTTCGTTATACCAATTCTGGTGGTCAATTGCATATTAGTAGCAAAAGAGAACATAATAATGTGTTGATTGTGTGGGAAGATAGTGCCCCGGGGCTAGATAAAGCACAATATGAAGCGGTATTCCAACGTTTTTATCGGGCTGAAAGCTCTCGTAATCGTTCCAGCGGCGGCTCTGGTTTGGGGCTTGCGATTTGCGAAAATATTGTCGAAGCTCATAATGGTAAAATCATGGCTATGCCATCCGCTATCGGTGGAGTAAAAATACTTATCGTATTACCTGTCTATTCTGAAGATAATTAAATTTTGCTCTATTGATTATACTGAATATTATTGTCCTAATTGATAACTAT