Homologs in group_365

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16475 FBDBKF_16475 89.2 Morganella morganii S1 baeS two-component system sensor histidine kinase BaeS
EHELCC_08340 EHELCC_08340 89.2 Morganella morganii S2 baeS two-component system sensor histidine kinase BaeS
NLDBIP_08665 NLDBIP_08665 89.2 Morganella morganii S4 baeS two-component system sensor histidine kinase BaeS
LHKJJB_05600 LHKJJB_05600 89.2 Morganella morganii S3 baeS two-component system sensor histidine kinase BaeS
HKOGLL_05315 HKOGLL_05315 89.2 Morganella morganii S5 baeS two-component system sensor histidine kinase BaeS
F4V73_RS10185 F4V73_RS10185 25.8 Morganella psychrotolerans - HAMP domain-containing sensor histidine kinase
PMI_RS07745 PMI_RS07745 54.6 Proteus mirabilis HI4320 baeS two-component system sensor histidine kinase BaeS

Distribution of the homologs in the orthogroup group_365

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_365

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30847 1.82e-166 479 54 3 453 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P23545 1.52e-41 159 35 4 254 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q742C0 2.17e-38 149 35 5 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBR0 7.83e-38 147 35 5 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
P35164 2.82e-36 144 34 3 226 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P35164 0.000136 48 25 3 124 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
A1TEL6 3.5e-36 142 33 7 293 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0R3I7 3.41e-35 139 34 7 284 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1KHB8 1.42e-34 138 33 6 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.42e-34 138 33 6 288 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7A5H7 2.26e-34 138 32 1 227 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 2.26e-34 138 32 1 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GGK7 2.54e-34 138 32 1 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q9Z5G7 2.66e-34 137 32 6 303 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q8NWF3 2.91e-34 138 32 1 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 2.91e-34 138 32 1 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 2.91e-34 138 32 1 227 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 2.91e-34 138 32 1 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 3.18e-34 138 32 1 227 1 srrB Sensor protein SrrB Staphylococcus aureus
P9WGL1 5.7e-34 136 33 6 288 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 5.7e-34 136 33 6 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 5.7e-34 136 33 6 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P94414 3.07e-33 134 28 6 300 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
A0PWB3 8.14e-33 133 32 7 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q9CCJ1 1.88e-32 133 30 5 306 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q9RDT3 3.04e-32 130 32 6 271 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q9RDT3 3.58e-05 49 35 0 59 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q1B3X9 3.24e-32 131 33 7 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 3.24e-32 131 33 7 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
P9WGK8 3.81e-32 132 30 4 289 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 3.81e-32 132 30 4 289 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3Q5L8 3.86e-32 131 33 7 278 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
P9WGK9 4.2e-32 132 30 4 289 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49ZT9 5.85e-32 130 30 5 276 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4LAJ8 7.66e-32 131 33 4 227 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q4LAJ8 2.58e-08 60 30 2 109 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q93CB7 7.95e-32 131 30 6 310 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A6QD58 1.72e-31 130 31 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
A6QD58 2.26e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q6GKS6 1.76e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q6GKS6 2.15e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q7A215 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
Q7A215 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
A8YYU2 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q6GD71 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 1.97e-31 130 32 6 271 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A8E0 2.23e-09 63 32 3 110 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A305 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q5HJX6 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YUQ2 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
A5INR0 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 1.97e-31 130 32 6 271 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G2U4 2.23e-09 63 32 3 110 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
Q2FKN7 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A6TXG9 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 1.97e-31 130 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7WWQ7 2.23e-09 63 32 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A159 3.62e-31 129 32 6 271 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A159 3.25e-08 59 34 4 111 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CU87 4.68e-31 129 32 6 264 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CU87 1.6e-08 60 31 3 110 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 4.68e-31 129 32 6 264 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HK19 1.6e-08 60 31 3 110 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A0W5 1e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 1e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 1e-30 126 25 3 290 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 1e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 1e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 1e-30 126 25 3 290 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 1e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 1.03e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 1.04e-30 126 25 3 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
P0AE82 1.45e-30 126 28 6 325 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.45e-30 126 28 6 325 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.45e-30 126 28 6 325 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
A0QTK3 1.61e-30 127 29 5 290 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q45614 1.78e-30 127 31 4 236 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q45614 1.15e-05 51 32 4 116 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
A5A2P0 8.4e-30 123 34 7 230 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
A5A2P0 1.51e-05 50 31 0 60 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q9ZHD4 3.05e-29 123 29 8 301 3 silS Probable sensor kinase SilS Salmonella typhimurium
A0A0H3GPN8 5.49e-29 121 27 6 325 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q8FK37 8.88e-29 121 28 5 291 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q4L6C5 9.75e-29 120 27 5 286 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q8DPL8 2.36e-28 119 33 3 221 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 2.36e-28 119 33 3 221 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8XBY4 2.57e-28 120 27 5 291 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P77485 8.63e-28 118 27 4 282 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
O69729 1.13e-27 118 28 6 300 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5HPC4 1.62e-27 117 25 6 304 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49XM6 2.05e-27 117 26 3 283 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q840P7 2.43e-27 115 26 6 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q5HHW5 2.74e-27 115 26 6 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 2.74e-27 115 26 6 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 2.74e-27 115 26 6 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q8CSL7 2.9e-27 117 26 8 307 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q04943 3.8e-27 117 30 6 291 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4L8M0 3.87e-27 116 25 4 298 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q6GIT7 6.21e-27 114 26 6 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 6.33e-27 114 26 6 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 6.33e-27 114 26 6 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 6.33e-27 114 26 6 299 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 6.33e-27 114 26 6 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 6.33e-27 114 26 6 299 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8ZPP5 2.21e-26 116 26 7 329 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O32193 2.35e-26 114 25 7 295 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P21865 2.4e-26 116 31 8 277 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
O34638 3.52e-26 113 26 7 292 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
A8Z553 6.63e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 6.63e-26 112 29 8 287 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 6.63e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 6.63e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 6.63e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q02541 8.41e-26 113 26 5 295 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q7A3X0 9.62e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 9.62e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 9.62e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 9.62e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 9.62e-26 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE72 1.22e-25 112 29 8 285 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q8NV46 1.42e-25 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.42e-25 112 29 8 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
A0QR01 1.52e-25 110 29 7 275 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q2YZ23 1.93e-25 111 29 8 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3M8A7 2.9e-25 110 28 7 277 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P42245 4.22e-25 108 26 2 244 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P39664 4.23e-25 110 34 7 265 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q07737 4.53e-25 111 27 7 318 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q47457 8.89e-25 109 27 4 279 3 pcoS Probable sensor protein PcoS Escherichia coli
Q55630 9.27e-25 108 27 7 255 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YR50 1.12e-24 108 28 6 258 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B0JK50 1.33e-24 108 29 6 257 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P45608 1.77e-24 108 30 4 233 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q9F8D7 3.67e-24 109 25 9 378 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9RQQ9 4.16e-24 109 30 3 233 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P9WGK5 4.38e-24 107 31 5 251 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 4.38e-24 107 31 5 251 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 4.38e-24 107 31 5 251 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54302 4.93e-24 108 26 3 235 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q8KIY1 5.16e-24 108 31 6 245 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 1.17e-13 77 26 8 253 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P08400 1.39e-23 105 27 4 281 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
B7K3M6 1.48e-23 105 27 5 255 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q54SP4 1.69e-23 107 29 4 253 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 2.19e-09 63 22 8 372 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
B2J946 2.37e-23 104 28 6 258 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P48027 2.87e-23 106 24 9 374 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P45609 3.32e-23 104 27 4 281 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q55932 7.29e-23 103 30 3 220 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1WYT4 7.59e-23 103 27 5 255 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8Z7H3 8.18e-23 104 27 7 296 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 8.33e-23 104 27 7 296 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 8.33e-23 104 27 7 296 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 8.33e-23 104 27 7 296 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 8.33e-23 104 27 7 296 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 8.33e-23 104 27 7 296 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 8.33e-23 104 27 7 296 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q87GU5 9.05e-23 105 25 3 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P54883 1.12e-22 103 31 5 246 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P23621 1.55e-22 103 31 2 221 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5W4E3 3.41e-22 103 31 4 239 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 1.59e-10 67 22 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8CTI3 4.07e-22 100 25 8 306 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 4.07e-22 100 25 8 306 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
E0X9C7 6.02e-22 102 31 4 239 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 1.53e-10 67 22 7 232 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q8DMT2 8.62e-22 100 28 5 255 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P30844 9.81e-22 99 29 7 284 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q8CRA8 1.04e-21 100 29 7 262 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P58356 1.6e-21 101 25 12 360 3 torS Sensor protein TorS Escherichia coli O157:H7
P94608 1.66e-21 101 29 5 231 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P9WGK7 2e-21 99 27 14 359 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 2e-21 99 27 14 359 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 2e-21 99 27 14 359 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5HLN1 3.84e-21 99 29 7 262 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8GP19 4.18e-21 99 27 6 281 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q54RP6 4.88e-21 100 30 8 246 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
B7KFU0 4.88e-21 98 27 5 255 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q8D5Z6 6.2e-21 99 27 4 233 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 6.37e-21 99 26 4 232 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
P39453 7.5e-21 99 25 11 358 1 torS Sensor protein TorS Escherichia coli (strain K12)
P23837 1.05e-20 97 26 7 296 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q83RR1 1.14e-20 97 26 7 296 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 1.15e-20 97 26 7 296 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q47745 1.41e-20 97 22 12 470 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
O34989 1.73e-20 97 24 8 309 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q9KLK7 3.98e-20 97 28 3 230 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P36557 4.1e-20 94 29 8 292 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A4I8 5.24e-20 95 27 6 280 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 5.24e-20 95 27 6 280 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P08401 5.26e-20 95 27 11 323 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q44007 7.01e-20 95 26 6 300 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P96368 8.41e-20 95 30 15 323 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8X739 8.47e-20 95 26 8 297 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
P72292 1.16e-19 95 27 5 292 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P0A4I6 1.18e-19 94 29 5 229 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.18e-19 94 29 5 229 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P37894 1.21e-19 95 24 2 253 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O33071 1.67e-19 94 27 13 354 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
P71380 1.8e-19 93 25 4 222 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34206 1.8e-19 94 27 3 226 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q9M7M1 5.91e-19 93 29 7 245 2 ETR1 Ethylene receptor Prunus persica
P76339 6e-19 92 24 6 291 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P0AEC5 6.07e-19 93 23 8 368 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 6.07e-19 93 23 8 368 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 6.07e-19 93 23 8 368 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q9HV31 6.48e-19 92 32 5 205 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P30855 7.79e-19 93 27 8 260 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q08430 8.95e-19 91 27 8 302 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q44930 1.07e-18 90 23 7 280 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q06240 1.61e-18 90 24 3 238 1 vanS Sensor protein VanS Enterococcus faecium
P18392 1.64e-18 90 24 4 300 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q2T0V9 1.65e-18 91 29 5 225 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P59342 1.67e-18 92 23 8 368 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q9HZ47 1.75e-18 91 29 6 273 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58662 1.86e-18 92 27 6 253 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9P896 2.13e-18 91 26 5 228 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0DMC5 2.15e-18 92 27 7 246 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 2.19e-18 91 27 7 246 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q56128 2.73e-18 91 27 7 256 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
I1WSZ3 3.68e-18 90 22 6 376 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q7BWI3 4.36e-18 89 27 8 252 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q70FG9 4.73e-18 89 27 9 340 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q86CZ2 5.17e-18 90 28 7 236 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9KHI5 5.45e-18 90 27 3 223 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P58402 6.61e-18 90 27 6 226 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q08408 6.66e-18 89 21 3 226 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
T2KMF4 7.41e-18 90 26 4 233 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q8DKG0 9.19e-18 89 26 10 329 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0DMK6 1.24e-17 88 22 6 376 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
P49333 1.39e-17 89 29 6 232 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q53RH0 1.61e-17 89 28 5 242 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 1.61e-17 89 28 5 242 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
P20169 1.64e-17 89 31 6 223 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7U871 1.87e-17 87 28 7 246 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q0IBF4 2.59e-17 87 30 7 246 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
O14002 3.1e-17 88 27 5 220 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3AYV8 3.97e-17 86 28 7 246 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
O81122 5.18e-17 87 28 7 249 2 ETR1 Ethylene receptor Malus domestica
Q5A599 6.53e-17 87 24 8 285 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q7V6P7 7.51e-17 85 27 9 254 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q9XH57 8.31e-17 86 28 8 247 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
A2C884 1.52e-16 84 27 10 254 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q2JWK9 1.6e-16 84 28 6 249 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q2JKD9 1.99e-16 84 28 7 274 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
O49230 3.18e-16 85 28 6 225 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9XH58 4.13e-16 84 29 7 245 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
A0A4P7TSF2 7.43e-16 83 26 7 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 7.43e-16 83 26 7 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 7.43e-16 83 26 7 292 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q8X524 8.47e-16 82 29 10 291 2 qseC Sensor protein QseC Escherichia coli O157:H7
P40719 8.63e-16 82 29 10 291 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q8E3C7 1.05e-15 82 26 5 206 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
P9WGL2 1.18e-15 83 27 6 253 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WGL3 1.19e-15 83 27 6 253 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q55168 1.36e-15 82 24 6 255 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9APE0 1.65e-15 82 29 8 221 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q54YZ9 1.72e-15 83 24 7 293 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q9I0I2 1.86e-15 81 27 6 279 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P08982 3.13e-15 81 24 6 288 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 3.13e-15 81 24 6 288 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P44578 4.82e-15 79 29 7 237 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O82436 4.89e-15 81 27 7 249 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q8DXQ8 6.27e-15 79 26 5 206 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
O49187 7.4e-15 80 25 6 234 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P37461 7.95e-15 80 28 7 221 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 8.77e-15 79 28 7 221 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q54YH4 1.49e-14 80 26 4 222 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P41406 1.97e-14 78 23 6 288 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q9LCC2 1.97e-14 79 25 7 248 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q41342 2.08e-14 79 25 4 239 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q06904 2.25e-14 78 26 9 253 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P51392 2.73e-14 79 28 7 226 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q9ZWL6 2.83e-14 79 27 7 247 2 ETR1 Ethylene receptor Passiflora edulis
Q9R6X3 3.96e-14 78 25 5 240 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P14377 5.38e-14 77 27 6 226 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
A7HD43 5.68e-14 76 27 6 217 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q52969 6.1e-14 77 25 4 224 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q1XD95 6.89e-14 77 29 9 227 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
A9M715 1.03e-13 77 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q06067 1.07e-13 77 27 8 246 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q551X9 1.11e-13 77 25 5 221 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q8FZ86 1.15e-13 77 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q8YIM6 1.15e-13 77 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B0CI82 1.18e-13 77 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q57BR6 1.22e-13 77 23 5 241 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.22e-13 77 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.22e-13 77 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q3S4A7 1.25e-13 77 25 8 263 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q9P7Q7 1.25e-13 77 27 8 225 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8THF6 1.26e-13 77 28 1 175 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9SXL4 1.77e-13 76 24 7 274 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q5AHA0 1.78e-13 76 26 5 209 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9C5U1 2.12e-13 76 24 6 294 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9SSY6 2.13e-13 76 26 7 249 2 ETR1 Ethylene receptor 1 Cucumis sativus
A6X5X4 2.57e-13 76 23 4 239 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P58363 2.68e-13 75 24 5 229 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P0AEC4 2.8e-13 75 24 5 229 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.8e-13 75 24 5 229 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
O48929 3.94e-13 75 25 6 241 2 ETR1 Ethylene receptor Nicotiana tabacum
Q8Z3P2 4.49e-13 74 30 6 237 3 qseC Sensor protein QseC Salmonella typhi
O31661 4.87e-13 75 21 6 242 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q8ZLZ9 4.95e-13 74 30 6 237 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q869S5 5e-13 75 26 5 213 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P45336 5.6e-13 74 27 12 284 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8X614 5.89e-13 73 27 6 226 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q38846 8.63e-13 73 24 4 214 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
E5KK10 1.37e-12 73 25 9 270 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
A5VRX4 1.57e-12 73 23 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P52101 1.79e-12 72 23 5 295 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q54U87 1.91e-12 73 25 6 239 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q95PI2 2.28e-12 73 28 7 230 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
P16497 2.82e-12 72 22 4 215 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P09431 2.88e-12 71 27 10 271 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P74111 2.96e-12 72 25 6 280 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P10047 4.97e-12 71 28 8 227 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q8XA47 5.4e-12 71 23 5 295 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
A2BRQ6 1.11e-11 69 25 8 229 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A3PDI2 1.24e-11 69 25 8 229 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q9KM66 2.02e-11 69 22 6 253 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7V113 2.73e-11 68 24 9 225 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0DKM0 3.21e-11 68 25 7 224 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
B8AY75 3.38e-11 68 25 7 224 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q31AE8 3.88e-11 68 25 8 229 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A8G5E7 3.95e-11 68 25 8 229 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q9HU20 4e-11 68 26 8 238 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39764 4.43e-11 68 22 7 241 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q03228 5.74e-11 68 24 4 227 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P33113 8.58e-11 67 22 10 253 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
A2WYI4 1.08e-10 67 27 3 159 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 1.11e-10 67 27 3 159 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q04804 1.22e-10 67 26 8 279 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C0F6 1.73e-10 67 26 5 225 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 1.76e-10 67 26 5 225 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
O31671 1.98e-10 66 24 5 219 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q8DN03 2.9e-10 65 21 9 293 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 2.9e-10 65 21 9 293 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P26762 4.17e-10 65 23 6 250 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9HWR3 4.23e-10 65 24 3 205 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2FWH7 4.29e-10 65 23 5 217 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P10955 4.95e-10 65 24 7 253 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q4L482 5.5e-10 64 21 3 217 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
P16575 8.6e-10 65 23 6 250 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P40330 9.71e-10 64 22 6 250 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9ZEP3 1.08e-09 63 28 6 214 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P23222 1.79e-09 63 26 7 223 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q82EB2 5.14e-09 62 26 10 301 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q86AT9 5.26e-09 62 27 4 140 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 0.000753 45 34 0 66 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q03069 5.72e-09 61 17 3 219 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q9HUI3 8.07e-09 61 24 4 216 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34971 1.26e-08 61 25 5 229 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q9RZA4 1.29e-08 60 28 6 226 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P13633 1.62e-08 60 25 5 212 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
Q49VK4 3.52e-08 58 20 6 222 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9I4F8 3.75e-08 58 26 7 242 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DMC5 3.96e-08 58 23 6 231 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P45675 4.69e-08 59 25 4 161 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
O74539 7.33e-08 58 23 8 242 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9C5U0 7.68e-08 58 27 5 162 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
A1A698 1.06e-07 58 25 3 159 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 0.000514 46 32 1 90 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
P54444 1.18e-07 57 24 7 233 3 yrkQ Sensor histidine kinase YrkQ Bacillus subtilis (strain 168)
G3XDA3 4.33e-07 55 32 3 112 1 ctpH Methyl-accepting chemotaxis protein CtpH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37739 4.58e-07 55 26 4 151 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q9C5U2 5.36e-07 55 20 6 305 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q04850 6.02e-07 55 23 8 245 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9K620 6.03e-07 54 22 7 226 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5A872 7.03e-07 55 32 0 79 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P37433 7.19e-07 55 24 9 318 1 pgtB Phosphoglycerate transport system sensor protein PgtB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O07777 8.26e-07 52 34 2 87 1 Rv0601c Sensor histidine kinase component HK2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P73276 8.32e-07 54 25 11 259 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7D9K1 8.64e-07 54 28 3 181 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q02482 9.84e-07 55 22 5 174 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q6GJ10 1.09e-06 54 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
P15939 1.33e-06 54 23 7 221 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7A6Z3 2.17e-06 53 19 6 221 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 2.17e-06 53 19 6 221 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 2.17e-06 53 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 2.17e-06 53 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 2.17e-06 53 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P33639 2.43e-06 53 24 10 232 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1RJB3 2.71e-06 53 23 12 294 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q2YSS1 2.86e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CTL4 2.99e-06 52 19 6 293 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 2.99e-06 52 19 6 293 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8Z182 3.1e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 3.1e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 3.1e-06 52 19 6 221 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 3.1e-06 52 19 6 221 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 3.1e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 3.18e-06 52 19 6 221 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 3.18e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
P0C5S6 3.74e-06 53 22 10 284 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
A7MRY4 3.81e-06 53 22 10 284 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
Q54Q69 3.85e-06 53 27 4 165 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P26489 5.08e-06 52 24 6 219 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P29130 5.49e-06 52 26 9 241 2 PHYB Phytochrome B Nicotiana tabacum
Q54W36 6.04e-06 52 24 2 149 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
O24972 8.6e-06 51 21 10 254 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
A1A699 8.68e-06 52 23 3 159 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
O07778 9.99e-06 49 35 2 114 1 Rv0600c Sensor histidine kinase component HK1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A1A697 1.47e-05 51 24 3 143 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
O22267 1.63e-05 51 25 5 163 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q55E44 2.86e-05 50 23 4 158 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P39928 2.94e-05 50 29 0 79 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P42422 4.66e-05 48 18 7 265 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
A2YFR6 0.000159 48 30 0 71 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A3BE68 0.000161 48 30 0 71 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
Q9P4U6 0.000207 47 20 7 291 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P06594 0.000213 47 24 5 167 1 PHYA4 Phytochrome A type 4 Avena sativa
P30663 0.000224 47 21 7 233 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
Q6HNQ4 0.000323 47 24 5 153 3 BT9727_0469 Probable methyl-accepting chemotaxis protein BT9727_0469 Bacillus thuringiensis subsp. konkukian (strain 97-27)
I1MGE5 0.000451 46 25 8 223 1 GLYMA_15G140000 Phytochrome B-2 Glycine max
P14713 0.000473 46 25 5 168 1 PHYB Phytochrome B Arabidopsis thaliana
P45670 0.000595 45 23 6 215 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02990
Feature type CDS
Gene baeS
Product two-component system sensor histidine kinase BaeS
Location 634008 - 635378 (strand: -1)
Length 1371 (nucleotides) / 456 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_365
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07642 two-component system, OmpR family, sensor histidine kinase BaeS [EC:2.7.13.3] Two-component system -

Protein Sequence

MKIGIGQKLFLAIFATCMLVVLTMHLAIRFSFEQGFIGYLQRSAEDRTETIADVVAEQYADYGSWYFLRNNQRGFMQALRALDTDRHMQHMERGWRMRFWLLDTNNKRLFGHGPVPSGELYRKPVKYEDNIVGWVVMPADDKINLAADQSFAHQQARTSWIVSALVLLVTVIVTWLLARGFLRPVKRLAESTHQLAAGNFSSRVPVRGNDEIARLADDFNQLASTLEKNERMRRDYMADVSHELRTPLAVLQGELEALQDGIRQSTPETLASLLAEVQTLTKLVSDLHQLSLSDRGSLSYRKEPCNLSDVISRSLGVFRHRLQEKNLSVSVSLPETLMVFGDDARLGQLFHNLLENSLRYTDSGGEIAVTAQQDDKQICVDWSDSAPGLNDEQFTQIFERFYRSESSRNRASGGSGLGLAICDKITEAHHGQISASASPLGGVTITLVLPRSDTRE

Flanking regions ( +/- flanking 50bp)

AAAGCAGAACAACACCAGGGGCGATCCGTTCTGAGTACGGAGGAAAATCCATGAAAATTGGTATTGGTCAGAAATTATTTCTCGCGATTTTTGCCACCTGCATGCTGGTGGTGCTGACAATGCATCTGGCTATCCGCTTCAGTTTTGAACAGGGATTTATCGGCTACCTGCAACGCTCAGCGGAAGACAGAACAGAAACTATCGCCGATGTGGTTGCCGAACAATATGCCGATTACGGCAGCTGGTATTTTCTGCGCAACAACCAGCGCGGATTTATGCAGGCCTTGCGCGCGCTCGATACTGACAGACACATGCAGCATATGGAGCGCGGCTGGCGTATGCGTTTCTGGCTGCTGGATACCAACAATAAACGTTTGTTCGGACACGGTCCGGTGCCGTCCGGCGAACTTTACCGGAAACCGGTGAAATATGAAGACAATATTGTCGGCTGGGTCGTGATGCCCGCCGATGACAAAATCAATCTGGCGGCGGATCAGAGCTTTGCCCACCAGCAGGCGCGCACCAGCTGGATAGTCTCCGCGCTGGTATTGCTGGTCACCGTGATCGTCACCTGGCTGCTCGCCCGGGGCTTTCTGCGCCCGGTCAAACGACTGGCGGAAAGTACTCACCAGTTAGCCGCCGGTAATTTCAGCAGCCGTGTGCCGGTTCGCGGAAACGATGAAATAGCCCGGCTGGCAGATGATTTTAACCAGCTCGCCTCCACGCTGGAAAAAAATGAACGGATGCGCCGCGATTATATGGCGGATGTTTCCCACGAGCTGCGCACCCCGCTGGCAGTATTGCAGGGGGAGCTGGAAGCCTTACAGGACGGGATCCGCCAATCCACCCCGGAAACACTCGCTTCCCTGCTGGCGGAAGTGCAGACTCTGACAAAACTGGTCAGTGACCTGCATCAGCTCTCATTGTCTGATCGCGGCTCGCTCTCTTACCGCAAAGAGCCGTGTAACCTGTCCGATGTGATAAGCCGCTCGCTGGGCGTGTTCCGCCATCGTTTACAGGAAAAAAATCTCAGCGTATCCGTCTCGCTGCCGGAAACACTTATGGTATTCGGCGATGACGCGCGCCTCGGGCAATTGTTTCATAATCTGCTGGAAAACAGCCTGCGCTATACCGACAGCGGCGGTGAAATAGCCGTGACCGCACAACAGGATGATAAACAGATCTGCGTCGATTGGTCAGACAGCGCACCGGGTCTGAATGATGAGCAATTTACACAGATTTTCGAGCGTTTCTACCGCAGTGAGTCCTCACGCAACCGCGCCAGTGGCGGGTCTGGGCTGGGTCTTGCGATTTGTGATAAAATAACCGAAGCGCATCACGGGCAGATCAGTGCATCTGCATCCCCCCTCGGCGGCGTCACCATCACCCTGGTGCTGCCCCGTTCTGACACCCGGGAGTAACCTGCATGGAAGAGAATGCTGAACGTATCCTGATAGTGGAAGATGAGCCG