Homologs in group_365

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16475 FBDBKF_16475 100.0 Morganella morganii S1 baeS two-component system sensor histidine kinase BaeS
EHELCC_08340 EHELCC_08340 100.0 Morganella morganii S2 baeS two-component system sensor histidine kinase BaeS
NLDBIP_08665 NLDBIP_08665 100.0 Morganella morganii S4 baeS two-component system sensor histidine kinase BaeS
HKOGLL_05315 HKOGLL_05315 100.0 Morganella morganii S5 baeS two-component system sensor histidine kinase BaeS
F4V73_RS02990 F4V73_RS02990 89.2 Morganella psychrotolerans baeS two-component system sensor histidine kinase BaeS
F4V73_RS10185 F4V73_RS10185 25.8 Morganella psychrotolerans - HAMP domain-containing sensor histidine kinase
PMI_RS07745 PMI_RS07745 55.2 Proteus mirabilis HI4320 baeS two-component system sensor histidine kinase BaeS

Distribution of the homologs in the orthogroup group_365

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_365

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30847 2.14e-164 474 52 3 455 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P23545 2.48e-39 152 35 4 256 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q7A5H7 5.2e-35 140 33 2 225 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q7A5H7 0.000235 47 30 0 65 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 5.2e-35 140 33 2 225 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99TZ9 0.000235 47 30 0 65 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GGK7 5.52e-35 140 33 2 225 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q6GGK7 0.000237 47 30 0 65 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q8NWF3 6.76e-35 140 33 2 225 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q8NWF3 0.000237 47 30 0 65 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 6.76e-35 140 33 2 225 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q6G973 0.000237 47 30 0 65 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 6.76e-35 140 33 2 225 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q5HFT1 0.000237 47 30 0 65 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 6.76e-35 140 33 2 225 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FY80 0.000237 47 30 0 65 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 6.83e-35 140 33 2 225 1 srrB Sensor protein SrrB Staphylococcus aureus
Q9L523 0.000233 47 30 0 65 1 srrB Sensor protein SrrB Staphylococcus aureus
Q742C0 8.75e-34 136 34 5 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P35164 1.66e-33 136 34 2 223 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P35164 3.43e-05 50 26 0 75 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
A0QBR0 3.55e-33 134 34 5 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
A0R3I7 4.05e-33 134 34 8 284 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P94414 9.46e-33 132 29 6 300 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
A1KHB8 1.53e-32 132 33 7 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.53e-32 132 33 7 288 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9Z5G7 1.81e-32 132 33 8 306 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q9CCJ1 1.9e-32 132 29 5 306 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P9WGL1 2.56e-32 132 33 7 288 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 2.56e-32 132 33 7 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 2.56e-32 132 33 7 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8FK37 4.65e-32 130 28 5 291 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P9WGK9 1.23e-31 130 30 4 289 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 1.29e-31 130 30 4 289 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.29e-31 130 30 4 289 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9RDT3 1.33e-31 128 33 4 224 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q9RDT3 0.000534 45 28 0 59 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q4LAJ8 1.44e-31 130 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q4LAJ8 3.58e-08 59 28 2 109 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
A1TEL6 2.12e-31 129 31 6 291 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q93CB7 2.8e-31 129 30 6 310 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0PWB3 4.43e-31 128 32 9 293 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q8XBY4 4.44e-31 128 27 5 291 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q8DPL8 5.61e-31 127 33 3 221 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 5.61e-31 127 33 3 221 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4A159 6.06e-31 129 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A159 3.32e-08 59 31 4 111 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49ZT9 6.33e-31 127 30 3 275 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CU87 6.35e-31 129 33 4 224 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CU87 4.89e-07 55 27 3 110 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 6.35e-31 129 33 4 224 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HK19 4.89e-07 55 27 3 110 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A5A2P0 7.84e-31 126 35 6 226 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
A5A2P0 5.26e-05 48 30 0 60 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
A6QD58 7.96e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
A6QD58 6.11e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A0W5 8.04e-31 127 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 8.04e-31 127 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 8.04e-31 127 28 6 293 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 8.04e-31 127 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 8.04e-31 127 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 8.04e-31 127 28 6 293 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 8.04e-31 127 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
P77485 8.11e-31 127 28 4 282 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q7A215 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
Q7A215 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
A8YYU2 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q6GD71 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q6GKS6 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q6GKS6 5.95e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q7A8E0 8.35e-31 128 33 4 224 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A8E0 6e-08 58 28 3 110 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A305 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q5HJX6 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YUQ2 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
A5INR0 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 8.35e-31 128 33 4 224 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G2U4 6e-08 58 28 3 110 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
Q2FKN7 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A6TXG9 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 8.35e-31 128 33 4 224 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7WWQ7 6e-08 58 28 3 110 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YY04 8.62e-31 126 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 8.79e-31 126 28 6 293 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q45614 1.03e-30 128 32 6 259 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q45614 7.1e-06 52 30 3 113 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q9ZHD4 1.11e-30 127 30 7 302 3 silS Probable sensor kinase SilS Salmonella typhimurium
A3Q5L8 1.46e-30 127 32 6 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q1B3X9 1.74e-30 126 32 6 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 1.74e-30 126 32 6 276 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A0A0H3GPN8 1.82e-29 123 30 5 270 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
A0QTK3 2.47e-29 124 29 4 286 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0AE82 3.42e-29 122 29 5 270 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 3.42e-29 122 29 5 270 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 3.42e-29 122 29 5 270 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q4L8M0 4.57e-28 119 27 8 336 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q5HHW5 6.61e-28 117 28 7 304 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 6.61e-28 117 28 7 304 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 6.61e-28 117 28 7 304 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q840P7 6.95e-28 116 28 7 304 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
O69729 1.28e-27 118 29 7 301 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q02541 2.06e-27 117 28 5 274 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q6GIT7 4.64e-27 114 27 7 304 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 4.82e-27 114 27 7 304 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 4.82e-27 114 27 7 304 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 4.82e-27 114 27 7 304 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 4.82e-27 114 27 7 304 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 4.82e-27 114 27 7 304 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P08400 5.54e-27 115 28 5 282 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P45609 1.4e-26 114 27 4 281 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q04943 1.49e-26 115 32 7 294 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0QR01 1.58e-26 113 33 6 232 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGK5 4.94e-26 112 32 7 283 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 4.94e-26 112 32 7 283 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 4.94e-26 112 32 7 283 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8KIY1 5.5e-26 115 34 5 240 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 2.05e-12 73 25 6 229 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q4L6C5 5.69e-26 113 27 6 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
O34638 6.83e-26 112 25 7 290 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
A8Z553 4.53e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 4.53e-25 110 30 7 288 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 4.53e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 4.53e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 4.53e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
P42245 4.97e-25 107 30 5 238 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q7A3X0 5.43e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 5.43e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 5.43e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 5.43e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 5.43e-25 110 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE72 5.64e-25 110 30 6 279 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q2YZ23 5.64e-25 110 30 7 287 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NV46 8.49e-25 109 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 8.49e-25 109 30 7 288 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q8ZPP5 9.94e-25 111 27 7 319 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P54883 1.02e-24 109 33 5 230 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q49XM6 1.12e-24 109 27 5 286 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q47457 1.18e-24 109 26 4 279 3 pcoS Probable sensor protein PcoS Escherichia coli
Q3M8A7 3.09e-24 107 28 7 277 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8CSL7 3.15e-24 108 26 10 309 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPC4 3.15e-24 108 26 8 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8YR50 4.21e-24 107 29 6 254 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9RQQ9 4.76e-24 108 30 3 231 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P21865 1.6e-23 107 30 7 272 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q07737 3.21e-23 105 27 9 317 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P45608 3.82e-23 104 27 5 282 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
B0JK50 4.25e-23 103 28 5 251 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B7K3M6 5.75e-23 103 28 5 251 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
A5W4E3 5.8e-23 105 32 5 240 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 2.88e-09 63 31 4 125 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q54RP6 6.82e-23 105 30 6 242 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P54302 8.42e-23 105 28 4 235 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P9WGK7 9.03e-23 103 28 11 358 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 9.03e-23 103 28 11 358 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 9.03e-23 103 28 11 358 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
E0X9C7 1.04e-22 105 32 5 240 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 2.5e-09 63 31 4 125 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P72292 1.05e-22 104 28 8 296 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q8DMT2 1.14e-22 102 28 5 253 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P48027 1.9e-22 104 25 13 389 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q9F8D7 1.96e-22 104 25 14 492 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
O32193 3.78e-22 102 24 7 295 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P0DM80 4.05e-22 102 26 7 296 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 4.05e-22 102 26 7 296 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 4.05e-22 102 26 7 296 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 4.05e-22 102 26 7 296 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 4.05e-22 102 26 7 296 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 4.05e-22 102 26 7 296 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 4.2e-22 102 26 7 296 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
Q55932 4.49e-22 101 30 3 220 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2J946 6.81e-22 100 28 6 254 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B1WYT4 1.36e-21 99 27 5 251 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q55630 1.55e-21 99 27 7 251 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P39664 1.74e-21 99 32 5 261 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8CRA8 2.06e-21 99 30 5 263 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CTI3 2.45e-21 98 26 8 310 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.45e-21 98 26 8 310 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P37894 2.96e-21 100 24 2 251 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q54SP4 3.6e-21 100 27 3 251 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.36e-08 61 25 9 298 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P23621 4.66e-21 98 30 2 221 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HLN1 4.94e-21 98 30 5 263 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7MD16 5.29e-21 99 27 5 270 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 7.59e-21 99 27 5 271 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
P0AEC5 8.04e-21 99 24 9 379 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 8.04e-21 99 24 9 379 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 8.04e-21 99 24 9 379 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q8GP19 8.53e-21 98 28 7 288 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q87GU5 1.32e-20 98 25 3 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7KFU0 1.82e-20 96 26 6 271 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P71380 1.82e-20 96 25 5 223 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P59342 2.37e-20 97 23 9 379 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P36557 3.89e-20 94 29 10 297 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P30844 3.99e-20 94 29 10 297 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q9P896 8.12e-20 95 27 5 227 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O34206 8.35e-20 95 29 3 226 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P08401 1.6e-19 94 27 13 318 1 creC Sensor protein CreC Escherichia coli (strain K12)
P58356 2.31e-19 94 30 7 251 3 torS Sensor protein TorS Escherichia coli O157:H7
Q70FG9 2.83e-19 92 29 8 314 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
P23837 2.9e-19 93 26 8 296 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8FIB8 3.17e-19 93 26 8 296 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O33071 3.22e-19 93 27 11 358 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q83RR1 3.29e-19 93 26 8 296 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
O34989 4.27e-19 93 23 6 304 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q9KLK7 5.24e-19 93 29 5 239 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P20169 6.64e-19 93 31 6 223 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q86CZ2 9.08e-19 93 29 6 234 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
P76339 1.03e-18 91 27 8 298 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P0A4I6 1.04e-18 91 30 6 227 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.04e-18 91 30 6 227 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0DMC5 1.51e-18 92 27 6 245 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 1.55e-18 92 27 6 245 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q08408 1.66e-18 91 24 3 226 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P58402 1.75e-18 92 26 5 226 3 evgS Sensor protein EvgS Escherichia coli O157:H7
O14002 2e-18 92 26 5 214 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P39453 2.26e-18 91 27 5 245 1 torS Sensor protein TorS Escherichia coli (strain K12)
P58662 2.26e-18 91 28 5 242 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P30855 2.6e-18 91 26 7 241 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q56128 4.12e-18 90 28 6 245 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P94608 4.39e-18 90 25 5 231 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q54YZ9 5.1e-18 90 23 6 292 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q7BWI3 5.1e-18 89 27 8 264 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P96368 6.41e-18 89 28 14 328 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8X739 6.68e-18 89 25 8 296 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q44007 1.13e-17 88 26 5 299 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q06240 1.27e-17 87 22 6 289 1 vanS Sensor protein VanS Enterococcus faecium
Q551X9 1.41e-17 89 28 5 220 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P0A4I8 1.41e-17 87 28 7 274 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 1.41e-17 87 28 7 274 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
I1WSZ3 2.19e-17 87 23 3 272 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q08430 2.66e-17 87 27 8 302 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q8DKG0 4.69e-17 87 27 4 237 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q47745 4.71e-17 86 21 11 464 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q9KHI5 5.73e-17 87 27 3 223 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0DMK6 6.7e-17 86 23 3 272 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q0IBF4 6.97e-17 85 30 7 246 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
A2C884 1.65e-16 84 29 9 224 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q9HZ47 2.01e-16 84 28 6 272 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A4P7TSF2 2.01e-16 84 26 7 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 2.01e-16 84 26 7 292 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 2.01e-16 84 26 7 292 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
T2KMF4 2.45e-16 85 26 4 240 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P40719 2.47e-16 84 29 10 291 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q9M7M1 3.19e-16 84 27 6 242 2 ETR1 Ethylene receptor Prunus persica
Q53RH0 4.26e-16 84 26 5 240 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 4.26e-16 84 26 5 240 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q7U871 4.37e-16 83 29 6 215 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q8X524 5.1e-16 83 30 12 296 2 qseC Sensor protein QseC Escherichia coli O157:H7
P18392 5.45e-16 83 25 6 280 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q8E3C7 5.67e-16 82 23 7 272 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q9SXL4 6.33e-16 84 24 13 375 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
P9WGL3 6.35e-16 84 29 7 248 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9APE0 6.4e-16 83 30 8 219 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q54YH4 6.4e-16 84 27 6 223 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P9WGL2 6.7e-16 84 29 7 248 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9HV31 7.69e-16 83 31 5 205 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I0I2 7.8e-16 82 28 8 280 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DXQ8 1.16e-15 82 23 7 272 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3AYV8 1.67e-15 81 28 7 223 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q44930 1.98e-15 80 24 7 281 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P52101 2.11e-15 81 26 6 279 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P49333 2.17e-15 82 26 5 229 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q7V6P7 2.42e-15 80 26 8 224 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q1XD95 2.52e-15 82 29 9 227 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
P0AEC4 2.6e-15 82 26 5 233 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 2.6e-15 82 26 5 233 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 2.63e-15 82 26 5 233 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P08982 2.78e-15 81 24 6 289 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 2.78e-15 81 24 6 289 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
Q2T0V9 2.97e-15 81 27 5 224 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
O81122 3.1e-15 81 26 6 242 2 ETR1 Ethylene receptor Malus domestica
Q9R6X3 3.27e-15 81 27 7 246 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8XA47 3.44e-15 81 26 6 279 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
O82436 3.45e-15 81 27 7 242 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q9LCC2 4.28e-15 81 27 9 250 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2JWK9 5.03e-15 79 29 5 221 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
A9M715 7.91e-15 80 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8FZ86 8.72e-15 80 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q8YIM6 9.12e-15 80 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B0CI82 9.2e-15 80 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q57BR6 1.01e-14 80 24 5 242 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.01e-14 80 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.01e-14 80 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q55168 1.03e-14 80 23 5 244 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2JKD9 1.06e-14 79 25 6 274 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q52969 1.18e-14 79 26 4 224 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
P41406 1.21e-14 79 23 6 289 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q9XH57 1.73e-14 79 25 7 244 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q06904 2.52e-14 77 26 9 254 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8THF6 2.76e-14 79 29 1 175 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A6X5X4 3.46e-14 79 24 7 249 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q06067 4.02e-14 78 29 7 222 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q8DN03 4.19e-14 77 22 8 281 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 4.19e-14 77 22 8 281 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q41342 4.73e-14 78 25 5 242 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q9SSY6 5.02e-14 78 27 7 242 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q869S5 7.02e-14 77 26 4 219 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P0C0F7 8.29e-14 77 27 6 227 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 8.9e-14 77 27 6 227 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P16497 9.49e-14 77 25 5 219 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
O49230 9.88e-14 77 26 5 222 2 ETR1 Ethylene receptor 1 Brassica oleracea
P51392 1.05e-13 77 27 8 226 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
A5VRX4 1.05e-13 77 24 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q9XH58 1.09e-13 77 24 6 242 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q5A599 1.9e-13 76 24 6 274 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8Z332 2.36e-13 75 28 7 219 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q8ZLZ9 2.49e-13 75 30 7 249 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 2.65e-13 75 30 7 249 3 qseC Sensor protein QseC Salmonella typhi
Q9C5U1 3.06e-13 75 24 6 299 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
P37461 3.75e-13 74 28 7 219 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O31661 5.85e-13 74 23 5 215 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P44578 6.21e-13 73 27 6 227 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P14377 6.77e-13 73 27 7 237 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
A7HD43 9.76e-13 73 27 6 217 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q9ZWL6 1.15e-12 73 25 7 244 2 ETR1 Ethylene receptor Passiflora edulis
Q95PI2 1.33e-12 73 27 7 232 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
O49187 1.63e-12 73 23 4 223 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P45336 2.03e-12 72 26 11 281 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3S4A7 2.14e-12 73 26 13 289 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P16575 2.4e-12 73 24 6 256 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P26762 2.69e-12 72 23 5 248 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9P7Q7 2.82e-12 72 26 9 239 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P74111 5.16e-12 71 25 5 239 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P40330 5.62e-12 72 22 5 248 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q5AHA0 6.21e-12 72 24 3 208 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q03228 6.4e-12 71 23 3 223 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P10047 6.42e-12 71 28 6 213 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q8X614 8.2e-12 70 26 7 237 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q9KM66 1.54e-11 70 24 6 242 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1A696 2.1e-11 70 24 8 305 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q4L482 7.22e-11 67 22 5 218 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
O48929 7.4e-11 68 23 6 235 2 ETR1 Ethylene receptor Nicotiana tabacum
Q04804 1.02e-10 67 28 11 286 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54U87 1.49e-10 67 25 7 244 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
E5KK10 1.89e-10 67 25 8 242 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q7V113 2.13e-10 65 25 8 207 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P39764 4.97e-10 64 23 6 225 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q9ZEP3 6.16e-10 64 30 8 216 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A2BRQ6 6.86e-10 64 25 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q31AE8 7.78e-10 63 25 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A3PDI2 7.99e-10 63 25 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q49VK4 9.41e-10 63 22 6 222 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P09431 1.33e-09 63 26 6 218 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9HU20 1.74e-09 63 25 6 219 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DMC5 2.28e-09 62 25 6 231 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q82EB2 2.44e-09 62 27 13 305 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A8G5E7 2.83e-09 62 24 8 230 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
A2WYI4 3.13e-09 63 28 5 169 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
O74539 3.29e-09 63 25 9 237 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q38846 3.33e-09 62 21 4 241 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P33113 4.39e-09 62 21 9 233 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q03069 5.7e-09 61 18 4 226 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
A1A697 8.11e-09 62 20 6 284 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
O31671 9.87e-09 60 25 8 220 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q8CTL4 1.02e-08 60 21 6 293 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 1.02e-08 60 21 6 293 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P10955 1.53e-08 60 23 8 253 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q2FWH7 1.77e-08 60 22 6 223 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5A872 2.1e-08 60 36 0 75 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1RJB3 2.14e-08 60 23 8 294 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q9HUI3 2.26e-08 60 26 6 208 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8AY75 2.85e-08 59 22 4 223 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q9RZA4 3.49e-08 59 27 6 240 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q4UMD4 3.52e-08 59 23 9 292 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0DKM0 3.73e-08 59 22 4 223 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q9I4F8 5.96e-08 58 23 8 269 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34971 9.19e-08 58 27 6 181 3 kdpD Sensor protein KdpD Rathayibacter rathayi
P37739 1.05e-07 58 23 7 233 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
G3XDA3 1.72e-07 57 33 3 112 1 ctpH Methyl-accepting chemotaxis protein CtpH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02482 1.76e-07 57 26 6 175 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
P13633 1.82e-07 57 24 5 209 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
Q9HWR3 2.31e-07 57 26 4 203 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q55E44 2.48e-07 57 26 5 152 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
O06979 3.49e-07 55 18 6 303 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
A1A698 3.51e-07 56 25 4 161 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
P0AFB7 3.95e-07 55 26 12 240 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 3.95e-07 55 26 12 240 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 3.95e-07 55 26 12 240 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q86AT9 4.48e-07 56 27 5 147 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q86AT9 8.53e-05 48 34 0 72 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
P54444 5.51e-07 55 24 7 234 3 yrkQ Sensor histidine kinase YrkQ Bacillus subtilis (strain 168)
Q9P4U6 5.59e-07 55 21 9 325 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54W36 5.7e-07 55 25 2 158 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q9K620 5.75e-07 55 23 8 232 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O07777 5.92e-07 52 35 2 87 1 Rv0601c Sensor histidine kinase component HK2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A2D9 6.51e-07 54 25 11 245 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 6.51e-07 54 25 11 245 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
P15939 8.29e-07 55 23 7 221 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7D9K1 1.06e-06 54 27 4 196 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A7N6S2 1.23e-06 54 25 8 220 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q9C5U2 1.64e-06 54 19 9 351 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q6GJ10 2.15e-06 53 19 7 267 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
P23222 2.54e-06 53 23 6 222 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7A6Z3 3.32e-06 52 19 6 221 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 3.32e-06 52 19 6 221 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 3.32e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 3.32e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 3.32e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P37433 3.4e-06 53 22 9 315 1 pgtB Phosphoglycerate transport system sensor protein PgtB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8Z182 5.13e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 5.13e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 5.13e-06 52 19 6 221 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 5.13e-06 52 19 6 221 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 5.13e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q2YSS1 5.42e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXR5 5.51e-06 52 19 6 221 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 5.51e-06 52 19 6 221 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
P06218 6.54e-06 51 25 11 245 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
O22267 8.55e-06 52 24 4 170 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
P73276 9.07e-06 51 30 6 126 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54Q69 9.48e-06 52 25 3 166 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
A2YFR6 1.15e-05 51 31 0 73 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A3BE68 1.21e-05 51 31 0 73 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
P45675 1.8e-05 50 23 4 159 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
Q6HNQ4 1.96e-05 50 23 9 214 3 BT9727_0469 Probable methyl-accepting chemotaxis protein BT9727_0469 Bacillus thuringiensis subsp. konkukian (strain 97-27)
A1A699 3e-05 50 23 3 164 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A699 0.000221 47 33 0 74 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
O24972 3.01e-05 49 21 9 254 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P33639 4.2e-05 49 24 10 232 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P19906 4.38e-05 49 24 12 268 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q04850 4.79e-05 49 21 7 239 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9C5U0 5.87e-05 49 23 4 160 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
O07778 0.000145 45 28 2 132 1 Rv0600c Sensor histidine kinase component HK1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P06594 0.000145 48 21 5 227 1 PHYA4 Phytochrome A type 4 Avena sativa
P29130 0.00015 48 26 7 209 2 PHYB Phytochrome B Nicotiana tabacum
P26489 0.000195 47 23 7 219 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P34094 0.000222 47 24 7 219 3 PHYB Phytochrome B Solanum tuberosum
Q39557 0.000233 47 23 6 223 3 PHY2 Phytochrome 2 Ceratodon purpureus
P39928 0.000234 47 31 0 73 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ZS62 0.000347 47 24 7 219 2 PHYB1 Phytochrome B1 Solanum lycopersicum
O25917 0.000355 46 22 8 218 3 crdS Sensor histidine kinase CrdS Helicobacter pylori (strain ATCC 700392 / 26695)
P39215 0.000384 46 23 1 76 1 mcpB Methyl-accepting chemotaxis protein McpB Bacillus subtilis (strain 168)
P36505 0.000394 47 23 6 223 2 PHY1 Phytochrome 1 Physcomitrium patens
P42497 0.000414 46 22 7 220 1 PHYD Phytochrome D Arabidopsis thaliana
P19862 0.000623 46 24 5 167 3 PHYA1 Phytochrome A Zea mays
Q10DU0 0.000842 45 21 5 223 2 PHYA Phytochrome A Oryza sativa subsp. japonica
A2XLG5 0.000842 45 21 5 223 3 PHYA Phytochrome A Oryza sativa subsp. indica
P93526 0.000857 45 24 5 167 2 PHYA Phytochrome a Sorghum bicolor
P42707 0.000865 45 21 8 228 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_05600
Feature type CDS
Gene baeS
Product two-component system sensor histidine kinase BaeS
Location 120716 - 122077 (strand: 1)
Length 1362 (nucleotides) / 453 (amino acids)
In genomic island -

Contig

Accession ZDB_362
Length 257361 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_365
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07642 two-component system, OmpR family, sensor histidine kinase BaeS [EC:2.7.13.3] Two-component system -

Protein Sequence

MKTGIGHKLFLAIFATCMLVVLTMHLAIRFSFEQGFLGYLQRSAEDRTEMIADVVAEQYADYGSWYFLRNNQRGFMQALRALDTDRHMEHMERGWKMRFWLLDEDDRRLFGHGPVPPGELYRKPVKYNDNIVGWVVMPADDNINRAADQSFSHQQARTSWIVSALVLLVTLVVTWLLTRGFLRPVKRLAEGTHQLAAGNFSSRVPVHGKDEIAQLANDFNQLASALEKNELMRRDYMADVSHELRTPLAVLQGELEALQDGIRQPTPETLASLLAEVQTLTKLVSDLHQLSLSDRGSLSYRKELCNLTDVISRSIGVFRHRLQEKGLSVTTELPDTLMIFGDDARLGQLFHNLLENSLRYTDSGGQIVVRGQQDETQIRIDWSDSAPGLTEEQFSQIFERFYRSESSRNRASGGSGLGLAICDKIAEAHHGQISASASPLGGVTITLILPRPD

Flanking regions ( +/- flanking 50bp)

AAAACAGGGCAATCCGCCGGGCAATCCGTTATCAGTACGGAGGGAAATGCATGAAAACCGGAATAGGTCACAAACTGTTTCTCGCCATTTTTGCCACCTGTATGCTGGTGGTGCTGACCATGCATCTGGCTATCCGTTTCAGTTTTGAGCAGGGCTTTCTCGGCTATCTTCAGCGCTCCGCCGAAGACCGGACGGAGATGATCGCCGATGTTGTCGCTGAACAATATGCCGATTACGGCAGCTGGTATTTTCTGCGCAATAATCAGCGCGGTTTTATGCAGGCACTGCGGGCGCTGGATACCGACCGCCATATGGAGCATATGGAGCGCGGCTGGAAAATGCGTTTCTGGCTGCTGGATGAGGATGACCGCCGCCTGTTCGGGCACGGCCCGGTCCCCCCCGGCGAACTCTACCGCAAACCGGTAAAATACAATGATAATATCGTCGGCTGGGTGGTGATGCCGGCGGATGACAATATCAACCGTGCCGCCGACCAGAGCTTTTCACATCAGCAGGCACGCACCAGCTGGATAGTCTCGGCGCTGGTGCTGCTGGTGACTCTGGTAGTCACCTGGCTGCTGACGCGCGGCTTCCTGCGTCCGGTCAAACGGCTGGCAGAAGGCACACATCAGCTGGCGGCAGGTAATTTCAGCAGCCGCGTGCCGGTTCACGGCAAAGATGAAATCGCGCAGCTGGCCAATGACTTTAATCAGCTCGCTTCCGCGCTGGAGAAAAATGAGCTGATGCGCCGCGACTATATGGCGGATGTCTCACACGAACTGCGTACTCCGCTGGCGGTGTTACAGGGTGAACTGGAAGCCCTTCAGGACGGGATCCGCCAGCCGACACCGGAAACTCTCGCGTCTCTGCTGGCGGAAGTGCAGACCCTGACAAAACTGGTCAGCGATCTGCATCAGCTGTCATTATCCGATCGCGGCTCACTCTCTTACCGCAAAGAGTTATGCAATCTGACCGATGTGATCAGCCGGTCTATCGGCGTATTCCGCCACCGGTTGCAGGAAAAAGGTCTCTCCGTCACAACGGAGCTGCCGGATACCCTGATGATTTTCGGGGATGATGCGCGGCTCGGCCAGCTGTTCCATAATCTTCTGGAAAACAGCCTGCGTTACACCGACAGCGGCGGACAGATTGTGGTACGCGGTCAGCAGGATGAAACACAGATCCGTATCGACTGGTCAGACAGTGCACCGGGGCTGACTGAAGAGCAATTTTCACAGATTTTTGAGCGTTTCTACCGCAGCGAATCCTCCCGCAACCGGGCCAGCGGCGGATCCGGACTCGGCCTTGCGATTTGTGATAAAATCGCGGAAGCGCATCACGGGCAGATAAGTGCATCCGCGTCCCCGCTCGGCGGCGTGACCATCACTCTGATCCTGCCCCGCCCTGACTGACAGGAGTTGACTGCATGGAACAAAATGCTGAACTGATTCTTATTGTGGAA