Homologs in group_365

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16475 FBDBKF_16475 25.8 Morganella morganii S1 baeS two-component system sensor histidine kinase BaeS
EHELCC_08340 EHELCC_08340 25.8 Morganella morganii S2 baeS two-component system sensor histidine kinase BaeS
NLDBIP_08665 NLDBIP_08665 25.8 Morganella morganii S4 baeS two-component system sensor histidine kinase BaeS
LHKJJB_05600 LHKJJB_05600 25.8 Morganella morganii S3 baeS two-component system sensor histidine kinase BaeS
HKOGLL_05315 HKOGLL_05315 25.8 Morganella morganii S5 baeS two-component system sensor histidine kinase BaeS
F4V73_RS02990 F4V73_RS02990 25.8 Morganella psychrotolerans baeS two-component system sensor histidine kinase BaeS
PMI_RS07745 PMI_RS07745 28.4 Proteus mirabilis HI4320 baeS two-component system sensor histidine kinase BaeS

Distribution of the homologs in the orthogroup group_365

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_365

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P23545 5.32e-25 112 31 3 235 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q45614 2.71e-24 110 30 7 244 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P35164 3.79e-24 109 27 6 242 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q8D5Z6 9.79e-23 105 33 10 248 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 1.02e-22 105 33 10 248 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q87GU5 2.18e-21 101 28 7 237 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q56128 5.16e-21 100 29 9 282 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q9RDT3 5.67e-21 98 28 5 225 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
P0DMC5 6.23e-21 100 29 9 282 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 7.38e-21 100 29 9 282 1 rcsC Sensor histidine kinase RcsC Escherichia coli
A6QD58 7.48e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 7.97e-21 99 28 5 225 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 7.97e-21 99 28 5 225 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 7.97e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
P58662 8.58e-21 99 28 8 280 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6GKS6 8.87e-21 99 28 5 225 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q4LAJ8 1.03e-20 99 29 5 225 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9KLK7 1.75e-20 98 30 8 241 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0AEC4 4.94e-20 97 28 10 293 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 4.94e-20 97 28 10 293 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 5.03e-20 97 28 10 293 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q8X614 5.36e-20 95 27 7 259 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q9HWR3 5.95e-20 97 27 4 232 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGK8 6.25e-20 96 29 6 255 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 6.25e-20 96 29 6 255 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGK9 9.98e-20 95 29 6 255 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q4A159 1.34e-19 95 29 5 225 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O34206 1.38e-19 95 29 6 222 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P30847 1.49e-19 94 27 4 222 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P26762 1.68e-19 95 31 9 229 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8DPL8 1.69e-19 94 29 5 222 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 1.69e-19 94 29 5 222 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P14377 1.84e-19 94 27 7 259 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
A0QR01 1.91e-19 93 27 4 227 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8CU87 1.97e-19 95 28 5 225 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.97e-19 95 28 5 225 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A5H7 2.18e-19 94 24 4 237 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 2.18e-19 94 24 4 237 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P94414 2.29e-19 94 28 9 299 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P40330 2.29e-19 95 31 9 229 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P54302 2.44e-19 95 27 7 237 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P16575 3.48e-19 95 31 8 229 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8NWF3 3.5e-19 94 25 3 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 3.5e-19 94 25 3 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 3.5e-19 94 25 3 235 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 3.5e-19 94 25 3 235 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9L523 3.72e-19 94 25 3 235 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6GGK7 4.3e-19 94 24 4 237 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q08408 4.54e-19 93 24 13 363 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P48027 5.71e-19 94 30 8 247 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
O34638 7.75e-19 92 31 4 197 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q9APE0 7.76e-19 92 25 10 264 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q04943 1.01e-18 92 31 11 261 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q93CB7 1.2e-18 92 27 5 252 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0A0H3GPN8 1.26e-18 91 29 6 229 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q06240 1.59e-18 90 26 4 230 1 vanS Sensor protein VanS Enterococcus faecium
Q9F8D7 1.64e-18 92 30 8 247 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9CCJ1 1.72e-18 92 28 6 255 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P0AE82 1.91e-18 91 29 6 229 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.91e-18 91 29 6 229 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.91e-18 91 29 6 229 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
A5A2P0 3.12e-18 90 26 6 239 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q07737 7.66e-18 90 32 12 241 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q47457 1.17e-17 89 29 7 226 3 pcoS Probable sensor protein PcoS Escherichia coli
P58356 1.46e-17 89 29 6 224 3 torS Sensor protein TorS Escherichia coli O157:H7
P42245 2.21e-17 86 26 2 202 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
A0QTK3 2.33e-17 88 26 5 252 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P59342 4.65e-17 88 29 6 218 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0AEC5 4.69e-17 88 29 6 218 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 4.69e-17 88 29 6 218 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 4.69e-17 88 29 6 218 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
Q55932 7.64e-17 86 24 10 373 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2T0V9 9.28e-17 86 28 5 235 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q03228 1.42e-16 86 29 6 231 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8CTI3 1.55e-16 84 26 5 250 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.55e-16 84 26 5 250 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P39453 1.71e-16 86 29 6 224 1 torS Sensor protein TorS Escherichia coli (strain K12)
P44578 1.77e-16 84 31 5 198 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P72292 2.33e-16 85 30 9 237 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P20169 2.81e-16 85 30 7 219 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P51392 5.55e-16 84 29 5 209 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
P0DMK6 6.89e-16 83 27 4 203 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
O69729 7.08e-16 83 26 5 248 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O31671 7.17e-16 83 23 12 351 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q551X9 1.09e-15 84 27 7 226 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q9KHI5 1.18e-15 83 28 5 224 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
I1WSZ3 1.33e-15 82 27 4 203 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q9M7M1 1.81e-15 82 24 8 297 2 ETR1 Ethylene receptor Prunus persica
P23621 2.11e-15 82 29 2 213 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37461 2.18e-15 82 26 7 220 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
T2KMF4 2.64e-15 82 26 11 294 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q54RP6 2.84e-15 82 27 6 211 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q8GP19 2.87e-15 81 28 5 224 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q8Z332 3.44e-15 81 26 7 220 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q9HUI3 4.03e-15 82 28 7 233 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45608 4.34e-15 80 24 5 237 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q41342 4.47e-15 81 23 7 297 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q06067 4.59e-15 81 25 9 300 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q49XM6 7.75e-15 80 25 4 239 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9XH57 7.82e-15 80 23 10 316 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9HZ47 8.76e-15 80 30 9 236 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HPC4 1.28e-14 79 28 6 216 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CSL7 1.47e-14 79 27 6 216 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P16497 1.56e-14 79 25 8 225 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P94608 1.68e-14 80 26 5 260 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O81122 1.84e-14 79 24 9 293 2 ETR1 Ethylene receptor Malus domestica
P33639 1.99e-14 79 28 7 211 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34989 2.02e-14 79 25 6 228 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P30855 2.17e-14 79 29 8 243 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q6GIT7 2.36e-14 77 25 6 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 2.47e-14 77 25 6 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 2.47e-14 77 25 6 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 2.47e-14 77 25 6 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 2.47e-14 77 25 6 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 2.47e-14 77 25 6 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L6C5 2.69e-14 78 27 7 215 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q1XD95 2.96e-14 79 29 8 210 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
P58402 3.42e-14 79 29 8 243 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q8KIY1 3.8e-14 79 28 3 232 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 1.17e-12 74 28 7 232 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q52969 3.99e-14 78 25 5 226 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q9XH58 5.04e-14 78 23 8 313 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
A5VRX4 5.38e-14 78 25 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q840P7 5.52e-14 76 25 6 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q95PI2 6.13e-14 78 25 9 243 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q5HHW5 6.69e-14 76 25 6 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 6.69e-14 76 25 6 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 6.69e-14 76 25 6 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q54SP4 7.31e-14 78 28 8 245 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 2.56e-07 57 26 9 283 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
A6X5X4 7.76e-14 78 25 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P9WGK5 7.8e-14 77 25 4 227 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 7.8e-14 77 25 4 227 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 7.8e-14 77 25 4 227 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O14002 9.54e-14 78 25 6 215 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8XBY4 9.84e-14 77 22 4 239 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P52101 1.09e-13 76 26 5 219 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P08400 1.09e-13 76 25 5 237 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
Q8FK37 1.15e-13 76 22 4 239 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q08430 1.27e-13 76 23 3 213 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P77485 1.29e-13 76 22 4 239 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8XA47 1.29e-13 76 27 6 220 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q8DKG0 1.56e-13 77 27 4 222 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5AHA0 2.04e-13 77 27 7 222 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q06904 2.13e-13 75 25 7 244 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P49333 2.18e-13 76 23 7 293 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q54YH4 2.26e-13 76 27 7 227 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
B7K3M6 2.3e-13 75 26 9 242 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P0A4I6 2.44e-13 75 30 7 229 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 2.44e-13 75 30 7 229 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P10955 2.89e-13 75 25 7 236 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
A0A4P7TSF2 2.91e-13 75 24 9 241 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 2.91e-13 75 24 9 241 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 2.91e-13 75 24 9 241 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q54YZ9 2.93e-13 76 27 6 232 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q9Z5G7 3.24e-13 75 24 6 219 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
P74111 3.35e-13 75 28 9 243 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q04804 3.81e-13 75 26 6 252 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O49230 3.98e-13 75 23 9 299 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q57BR6 5.17e-13 75 25 6 218 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 5.17e-13 75 25 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 5.17e-13 75 25 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
P39764 5.25e-13 74 25 7 236 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
P08401 5.53e-13 74 26 4 208 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q8YIM6 5.55e-13 75 25 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B0JK50 6.41e-13 73 26 7 234 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8FZ86 6.78e-13 75 24 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 7.02e-13 75 24 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
P45609 7.47e-13 73 24 5 237 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
E0X9C7 7.5e-13 74 26 3 238 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 1.14e-12 74 28 7 225 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P37739 8.55e-13 74 28 7 225 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q9ZHD4 9.03e-13 73 24 5 231 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q54U87 9.55e-13 74 27 7 235 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q9P896 9.93e-13 74 23 7 222 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A5W4E3 1.1e-12 74 28 7 225 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 2.92e-12 73 26 3 229 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P54883 1.12e-12 73 25 4 228 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q53RH0 1.23e-12 73 23 9 313 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 1.23e-12 73 23 9 313 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q9R6X3 1.26e-12 73 29 6 219 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P0C0F7 1.28e-12 73 25 11 275 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 1.3e-12 73 25 11 275 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A9M715 1.41e-12 73 24 6 218 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P18392 1.74e-12 72 27 10 230 1 rstB Sensor protein RstB Escherichia coli (strain K12)
O49187 1.98e-12 73 24 8 253 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q9HU20 2.05e-12 73 26 6 214 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2YY04 2.28e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 2.31e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 2.35e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 2.35e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 2.35e-12 72 25 6 228 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 2.35e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 2.35e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 2.35e-12 72 25 6 228 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 2.35e-12 72 25 6 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
O48929 2.74e-12 72 24 8 273 2 ETR1 Ethylene receptor Nicotiana tabacum
Q9HWA7 3.94e-12 72 26 6 229 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P08982 4.68e-12 71 23 8 238 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 4.68e-12 71 23 8 238 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
O33071 5.56e-12 71 29 7 235 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
O82436 5.91e-12 72 24 11 316 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q8ZPP5 6.3e-12 72 30 11 241 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8DMT2 6.94e-12 70 28 8 239 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P41406 7.17e-12 70 23 8 238 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q869S5 7.35e-12 72 26 10 258 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q3S4A7 8.19e-12 71 25 7 247 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q9RQQ9 1.02e-11 71 26 6 220 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8DMC5 1.08e-11 70 25 5 220 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P39664 1.61e-11 69 27 3 219 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P21865 1.77e-11 70 24 12 349 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q9SSY6 1.81e-11 70 25 8 229 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q47745 2.11e-11 69 24 3 232 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
B8AY75 2.73e-11 69 23 6 231 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q5A599 2.79e-11 70 26 10 255 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q92H24 3.03e-11 69 27 9 244 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4L482 3.03e-11 68 23 8 242 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
Q9ZWL6 3.16e-11 69 23 8 297 2 ETR1 Ethylene receptor Passiflora edulis
Q86CZ2 3.17e-11 69 25 11 290 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9ZCU7 3.37e-11 69 28 11 246 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
Q68WC5 3.94e-11 68 28 11 246 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q55630 4.57e-11 68 23 7 234 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1WYT4 4.67e-11 68 26 7 234 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
B7KFU0 5.38e-11 67 27 10 270 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q49ZT9 5.62e-11 68 27 7 217 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4UMD4 6.27e-11 68 27 10 243 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0DKM0 6.54e-11 68 23 6 231 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q1RJB3 7.38e-11 68 26 10 246 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
P9WGK7 9.77e-11 67 27 7 244 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 9.77e-11 67 27 7 244 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 9.77e-11 67 27 7 244 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q02541 1.03e-10 67 26 4 186 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q8DN03 1.07e-10 67 25 7 228 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 1.07e-10 67 25 7 228 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0PWB3 1.27e-10 67 26 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q49VK4 1.31e-10 66 27 5 192 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q742C0 1.87e-10 66 24 7 217 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8E3C7 2.21e-10 66 23 3 218 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
P71380 2.45e-10 66 23 10 355 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2WYI4 2.59e-10 67 23 9 318 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 2.61e-10 67 23 9 318 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A8G5E7 3.82e-10 65 24 5 236 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
O31661 3.88e-10 66 23 6 219 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P15939 4.08e-10 66 23 7 226 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A2BRQ6 4.14e-10 65 24 5 236 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q44007 4.74e-10 65 25 5 223 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A0R3I7 4.95e-10 65 27 7 210 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0QBR0 5.1e-10 65 24 7 217 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
P09431 5.53e-10 64 24 6 237 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
A1KHB8 6.2e-10 65 26 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 6.2e-10 65 26 7 218 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGL2 6.49e-10 65 25 6 225 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A3PDI2 6.54e-10 64 24 5 236 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P9WGL3 6.66e-10 65 25 6 225 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P37894 6.84e-10 65 26 7 227 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45675 7.2e-10 65 26 8 223 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
P33113 8.15e-10 64 27 7 229 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
B2J946 1.25e-09 63 23 10 280 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q9ZEP3 1.27e-09 63 26 6 204 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8DXQ8 1.32e-09 63 22 3 218 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P41503 1.38e-09 63 22 7 241 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
Q9C5U2 1.46e-09 64 23 6 259 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q8X524 1.6e-09 63 28 9 215 2 qseC Sensor protein QseC Escherichia coli O157:H7
A3Q5L8 1.63e-09 63 26 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
P10578 1.64e-09 63 23 8 248 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q03069 1.64e-09 63 21 5 215 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q9HV31 1.69e-09 63 24 5 209 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9C5U1 1.93e-09 63 24 6 252 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q52977 2.05e-09 63 24 8 241 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
Q1B3X9 2.32e-09 63 26 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 2.32e-09 63 26 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
O32193 5e-09 62 23 7 219 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q04850 6.57e-09 62 23 7 216 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2JWK9 6.87e-09 61 24 6 217 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
A7HD43 7.67e-09 61 23 6 218 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
E5KK10 7.98e-09 62 22 9 275 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q8ZLZ9 8.67e-09 61 27 9 232 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 8.67e-09 61 28 9 231 3 qseC Sensor protein QseC Salmonella typhi
Q0IBF4 9.19e-09 60 24 6 225 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q31AE8 1.07e-08 60 24 5 236 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q3AYV8 1.15e-08 60 24 5 220 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q44930 1.42e-08 60 26 5 206 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q9P7Q7 1.44e-08 61 25 8 225 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WGL1 1.77e-08 60 25 7 218 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.77e-08 60 25 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.77e-08 60 25 7 218 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P0A4I8 2e-08 60 25 4 220 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2e-08 60 25 4 220 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7V6P7 2.02e-08 59 25 7 229 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P23222 2.15e-08 60 21 5 224 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q54Q69 2.25e-08 60 25 5 224 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P45670 2.39e-08 59 23 7 231 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
P40719 2.41e-08 60 30 11 220 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q7U871 2.87e-08 59 24 5 220 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q9SXL4 3.76e-08 60 22 9 293 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
P96368 3.82e-08 59 23 8 257 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9RZA4 3.99e-08 59 26 11 246 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P18540 4.01e-08 59 25 11 256 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P10047 4.55e-08 59 22 7 234 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q2FWH7 4.87e-08 59 29 7 205 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P26489 5.28e-08 58 23 8 225 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A1TEL6 5.63e-08 58 25 7 219 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A2C884 6.83e-08 58 25 9 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q82EB2 7.56e-08 58 25 6 204 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q7V113 1.24e-07 57 23 5 226 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A8Z182 1.24e-07 57 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 1.24e-07 57 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 1.24e-07 57 22 6 218 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 1.24e-07 57 22 6 218 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 1.24e-07 57 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q2YSS1 1.27e-07 57 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXR5 1.32e-07 57 22 6 218 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 1.32e-07 57 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
Q4L8M0 1.61e-07 57 25 7 225 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q9K620 1.85e-07 56 28 10 218 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P30844 1.95e-07 56 24 7 214 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q7BWI3 1.99e-07 56 25 6 208 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P42422 2.12e-07 56 25 9 212 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
O34971 2.24e-07 57 22 7 230 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q83RR1 2.29e-07 57 24 6 224 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 2.29e-07 57 24 6 224 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23837 2.48e-07 57 24 6 224 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
P42707 2.48e-07 56 26 10 230 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
Q8X739 3.14e-07 56 24 6 224 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
P07167 3.81e-07 56 25 12 256 3 virA Limited host range VirA protein Rhizobium radiobacter
Q38846 4.26e-07 56 22 6 232 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q6GJ10 4.81e-07 55 23 7 223 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q8CTL4 5.4e-07 55 21 7 222 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 5.4e-07 55 21 7 222 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55168 5.49e-07 56 23 7 221 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7A6Z3 5.75e-07 55 22 6 218 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 5.75e-07 55 22 6 218 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 5.75e-07 55 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 5.75e-07 55 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 5.75e-07 55 22 6 218 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P13633 6.28e-07 55 22 7 229 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
A1A697 6.44e-07 55 30 4 134 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q9I0I2 6.55e-07 55 25 8 220 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2JKD9 1.39e-06 54 23 5 217 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9LCC2 1.46e-06 54 23 6 219 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P36557 1.51e-06 53 23 6 209 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8Z553 1.53e-06 54 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 1.53e-06 54 26 9 244 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 1.53e-06 54 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 1.53e-06 54 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 1.53e-06 54 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q8CRA8 1.55e-06 54 25 8 234 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P45336 1.93e-06 53 25 7 211 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8YR50 2.92e-06 53 20 6 228 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 3.45e-06 53 20 6 228 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8NV46 4.8e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 4.8e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q5A872 5.05e-06 53 37 1 74 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0DOA0 5.17e-06 53 22 8 231 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
A1A698 5.39e-06 53 24 7 234 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q7A3X0 5.77e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 5.77e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 5.77e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 5.77e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 5.77e-06 52 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P10799 7.94e-06 52 23 10 259 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P07168 8.15e-06 52 22 9 256 3 virA Wide host range VirA protein Rhizobium radiobacter
Q8THF6 8.87e-06 52 24 6 216 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9KM66 1.04e-05 52 34 3 106 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2YZ23 1.17e-05 51 26 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P39928 1.41e-05 51 36 1 75 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5HLN1 1.46e-05 51 24 8 234 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GE72 1.75e-05 50 25 9 244 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
P0DM80 2.12e-05 50 23 7 207 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 2.12e-05 50 23 7 207 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 2.12e-05 50 23 7 207 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 2.12e-05 50 23 7 207 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 2.12e-05 50 23 7 207 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 2.12e-05 50 23 7 207 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 2.15e-05 50 23 7 207 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P06218 2.45e-05 50 25 10 235 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q55E44 3e-05 50 27 5 147 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P0AFB7 3.81e-05 49 25 11 235 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 3.81e-05 49 25 11 235 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 3.81e-05 49 25 11 235 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
P19906 3.96e-05 49 24 10 246 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P40758 0.000114 48 27 7 169 1 glnK Sensor histidine kinase GlnK Bacillus subtilis (strain 168)
O74539 0.00012 48 21 7 259 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A3BE68 0.000129 48 28 4 137 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 0.00013 48 28 4 137 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q9C5U0 0.000131 48 26 7 195 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q70FG9 0.000169 47 21 3 232 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
O87939 0.000205 47 27 4 116 3 tdiS Sensor protein TdiS Thauera aromatica
P76339 0.000215 47 22 7 219 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q56310 0.000264 47 26 5 146 1 cheA Chemotaxis protein CheA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P0A2D9 0.000276 47 23 10 236 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 0.000276 47 23 10 236 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
P73276 0.000341 46 22 8 226 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10185
Feature type CDS
Gene -
Product HAMP domain-containing sensor histidine kinase
Location 147590 - 149086 (strand: -1)
Length 1497 (nucleotides) / 498 (amino acids)
In genomic island GI65

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_365
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2205 Signal transduction mechanisms (T) T K+-sensing histidine kinase KdpD

Protein Sequence

MKSKKFLYLFIVITVLITGLIGYFGYRTLSQESTLNEYQTQQLAKTRVAQTQNFILQQLEQKQIRFSAILAYLKPDPLSLNTLIAQDSDIEDLFVLEHNKLVFPDAYNPLNQKESRFIELITPIIQDPAILITGQHPSDDKRPDSGWYVMQEQQQPILIYWHKLDNQIIGFKLSYIKLLSDIISGIDFNYEPDSLVISDNGQVLYQSLTPAYDKTKQPTYDQALPFPLHAWKIDYYAADNSNYSLYYFTIGLLAVVILSVGIIALSLYREFNRATRLAGQQVSFVSQVSHELKTPLTNIMLYAELLKEMEQEEDSRNAHYLEVIISESSRLSRLIQNVLTFTKSPKINLQPVDINQLLAQIHTIFMPAFKVKGIHLVLTVEGQLNTCSDIDRITQIISNLLSNAEKYAAEGREVRLSACSDDKNIYIRVRDYGKGLSEKELKHIFRPFYRVKSEITEGVTGTGIGLTIARQLAQSLSGTLMAENCDSGLEFTLCIPLS

Flanking regions ( +/- flanking 50bp)

AGGTTAGGTAATCTAATCTCAGGTTTATTAATTACATGATTGGATATGGAATGAAATCTAAAAAGTTTCTTTATCTGTTTATTGTCATTACCGTCCTGATTACCGGACTGATTGGCTATTTCGGATACCGTACTCTGTCACAGGAAAGTACCTTAAATGAATACCAGACCCAGCAACTGGCAAAAACCCGGGTGGCACAAACTCAGAATTTTATTTTGCAGCAGTTGGAACAAAAGCAAATTCGCTTCAGCGCTATTCTGGCCTACCTGAAACCGGATCCCCTGTCGCTCAATACACTGATTGCTCAAGACAGTGATATTGAAGATCTGTTTGTACTGGAACATAACAAACTGGTATTTCCCGATGCGTATAATCCACTGAATCAAAAAGAATCCCGTTTTATTGAGCTCATCACACCGATTATTCAGGATCCTGCCATTCTTATCACCGGACAGCATCCGTCTGACGATAAACGACCTGATTCCGGCTGGTACGTGATGCAGGAGCAGCAACAGCCTATACTGATTTACTGGCATAAACTCGACAATCAAATTATTGGCTTTAAGCTGTCCTACATAAAATTGCTGTCAGATATCATTTCCGGCATCGATTTCAACTATGAGCCGGACAGTCTGGTTATCTCAGATAACGGTCAGGTGCTATATCAGTCACTGACCCCTGCCTATGATAAAACCAAACAGCCAACCTATGATCAGGCTCTGCCTTTCCCGCTTCATGCCTGGAAAATTGACTACTACGCCGCTGACAACAGTAACTACTCACTCTATTATTTCACCATTGGTCTGTTAGCTGTTGTGATCCTGTCCGTGGGGATTATTGCATTATCGTTGTATCGTGAATTCAACCGGGCTACCCGTCTGGCCGGTCAACAAGTCAGTTTTGTCAGCCAGGTATCTCATGAGCTTAAAACCCCGCTCACCAATATCATGCTATATGCAGAGCTACTGAAAGAGATGGAGCAGGAAGAGGATAGCCGGAATGCTCATTATCTGGAGGTGATCATCAGTGAAAGCAGTCGCCTGTCGCGTCTGATTCAAAATGTGCTGACGTTTACAAAATCGCCTAAAATCAATCTGCAACCGGTGGATATCAATCAGTTACTGGCGCAGATCCACACTATTTTTATGCCGGCCTTTAAGGTGAAAGGTATTCATTTGGTACTGACAGTTGAGGGACAACTGAATACCTGCAGCGATATCGACCGAATAACTCAAATCATCAGCAATTTGCTCAGTAATGCTGAAAAGTATGCCGCCGAAGGCAGGGAAGTCCGGCTCAGCGCGTGTTCGGATGATAAAAATATTTATATCCGTGTGCGGGATTATGGCAAAGGATTGTCAGAAAAAGAGTTGAAACATATCTTCCGGCCATTCTATCGGGTGAAATCAGAGATTACCGAAGGGGTTACCGGAACCGGTATTGGCCTGACAATAGCGCGTCAGTTAGCTCAAAGTCTGTCCGGCACCCTGATGGCAGAAAACTGCGATAGCGGGCTGGAATTTACTTTGTGTATTCCCCTAAGCTGAAAAAGAACGGACAGCATGATGGTATGGATAAATAACGATGAAAATTTTAA