Homologs in group_960

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05280 FBDBKF_05280 85.1 Morganella morganii S1 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
EHELCC_12310 EHELCC_12310 85.1 Morganella morganii S2 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
NLDBIP_12650 NLDBIP_12650 85.1 Morganella morganii S4 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
LHKJJB_12510 LHKJJB_12510 85.1 Morganella morganii S3 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
HKOGLL_11125 HKOGLL_11125 85.1 Morganella morganii S5 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
F4V73_RS05735 F4V73_RS05735 86.1 Morganella psychrotolerans - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_960

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_960

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76027 0.0 548 83 1 320 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
P04285 0.0 544 82 1 320 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45052 0.0 521 77 1 320 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RI77 1.97e-109 325 51 3 316 1 dppD Dipeptide transport ATP-binding protein DppD Lactococcus lactis subsp. cremoris (strain MG1363)
P24136 2.14e-106 318 52 2 304 1 oppD Oligopeptide transport ATP-binding protein OppD Bacillus subtilis (strain 168)
P26905 1.29e-103 310 49 1 315 3 dppD Dipeptide transport ATP-binding protein DppD Bacillus subtilis (strain 168)
P0AAG2 1.18e-102 307 47 1 313 3 dppD Dipeptide transport ATP-binding protein DppD Shigella flexneri
P0AAG0 1.18e-102 307 47 1 313 1 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli (strain K12)
P0AAG1 1.18e-102 307 47 1 313 3 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli O157:H7
Q8FUW8 7.75e-102 305 48 2 314 3 BRA1094 Putative peptide import ATP-binding protein BRA1094/BS1330_II1086 Brucella suis biovar 1 (strain 1330)
Q2YJJ9 7.75e-102 305 48 2 314 3 BAB2_1052 Putative peptide import ATP-binding protein BAB2_1052 Brucella abortus (strain 2308)
Q8VQK6 7.75e-102 305 48 2 314 3 BruAb2_1033 Putative peptide import ATP-binding protein BruAb2_1033 Brucella abortus biovar 1 (strain 9-941)
P42064 1.68e-101 304 46 1 320 3 appD Oligopeptide transport ATP-binding protein AppD Bacillus subtilis (strain 168)
Q8YDH0 2.54e-101 304 48 2 314 3 BMEII0206 Putative peptide import ATP-binding protein BMEII0206 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YBN6 8.47e-99 298 44 3 334 3 BMEII0863 Putative peptide import ATP-binding protein BMEII0863 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU87 1.64e-98 297 44 3 334 3 BOV_A0348 Putative peptide import ATP-binding protein BOV_A0348 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FWP1 3.12e-98 296 44 3 334 3 BRA0405 Putative peptide import ATP-binding protein BRA0405/BS1330_II0402 Brucella suis biovar 1 (strain 1330)
P45095 3.61e-98 296 46 1 311 3 dppD Dipeptide transport ATP-binding protein DppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q53193 3.97e-98 296 45 2 327 3 NGR_a01410 Probable peptide ABC transporter ATP-binding protein y4tR Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2YK63 1.27e-97 295 43 3 334 3 BAB2_0817 Putative peptide import ATP-binding protein BAB2_0817 Brucella abortus (strain 2308)
Q577J5 1.27e-97 295 43 3 334 3 BruAb2_0796 Putative peptide import ATP-binding protein BruAb2_0796 Brucella abortus biovar 1 (strain 9-941)
P77268 1.03e-95 289 43 3 326 2 ddpD Probable D,D-dipeptide transport ATP-binding protein DdpD Escherichia coli (strain K12)
A0A0H2ZGN6 6.83e-93 282 46 3 314 1 dppD Di/tripeptide transport ATP-binding protein DppD Pseudomonas aeruginosa (strain UCBPP-PA14)
P63396 1.25e-91 288 45 4 319 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 1.28e-48 175 40 4 243 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 1.25e-91 288 45 4 319 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 1.28e-48 175 40 4 243 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 1.25e-91 288 45 4 319 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 1.28e-48 175 40 4 243 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A2U9 3.27e-91 279 44 4 315 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U8 3.27e-91 279 44 4 315 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8ZQM4 4.53e-84 268 50 2 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 3.62e-57 198 42 6 273 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0TJM0 5.54e-84 268 51 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 3.06e-58 201 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A967 5.85e-84 268 51 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 3.61e-58 201 41 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
Q1RE96 6.79e-84 268 51 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 6.26e-58 200 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q8FJL0 7.39e-84 268 51 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 1.86e-58 201 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5PGP3 9.24e-84 268 49 2 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 3.27e-57 198 42 6 273 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z864 9.85e-84 268 50 2 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 4.02e-57 197 42 6 273 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q3Z3V4 1.29e-83 267 51 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 2.88e-59 203 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
P75796 1.37e-83 267 51 2 264 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 3.07e-59 203 42 5 270 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q323W5 1.7e-83 267 51 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 4.8e-59 203 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q32IB5 3.98e-83 266 50 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 9.97e-60 204 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q8X6W1 4.33e-83 266 50 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 1.09e-58 202 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q57RB2 7.3e-83 265 49 2 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 3.51e-57 198 42 6 273 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q83LT3 1.03e-81 262 50 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 3.92e-58 200 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q0T6D3 3.37e-81 261 50 2 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 3.65e-58 201 42 5 270 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q6D3A9 4.48e-81 261 50 3 267 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 2.29e-60 206 42 4 267 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A0A0H2ZH52 1.45e-73 233 40 7 327 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
A9CKL2 3.98e-73 238 46 1 266 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 1.85e-46 168 39 4 237 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
P50980 1.9e-72 230 42 1 275 3 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. cremoris (strain SK11)
Q07733 2.28e-72 230 42 1 275 1 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. lactis (strain IL1403)
P45094 9.48e-72 228 39 9 332 3 dppF Dipeptide transport ATP-binding protein DppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P33916 3.42e-71 233 47 1 263 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 1.74e-49 176 41 6 260 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P47325 5.1e-70 226 36 3 328 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P77737 7.29e-70 223 40 10 336 1 oppF Oligopeptide transport ATP-binding protein OppF Escherichia coli (strain K12)
Q8YBN5 1.01e-69 223 36 5 320 3 BMEII0864 Putative peptide import ATP-binding protein BMEII0864 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP2 1.01e-69 223 36 5 320 3 BRA0404 Putative peptide import ATP-binding protein BRA0404/BS1330_II0401 Brucella suis biovar 1 (strain 1330)
Q2YK62 1.01e-69 223 36 5 320 3 BAB2_0818 Putative peptide import ATP-binding protein BAB2_0818 Brucella abortus (strain 2308)
Q577J4 1.01e-69 223 36 5 320 3 BruAb2_0797 Putative peptide import ATP-binding protein BruAb2_0797 Brucella abortus biovar 1 (strain 9-941)
A5VU86 1.01e-69 223 36 5 320 3 BOV_A0347 Putative peptide import ATP-binding protein BOV_A0347 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P45051 1.15e-69 223 39 7 338 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75552 4.01e-69 224 35 1 337 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P37313 4.27e-69 221 38 7 330 1 dppF Dipeptide transport ATP-binding protein DppF Escherichia coli (strain K12)
P36636 4.47e-69 221 38 6 322 2 sapD Peptide transport system ATP-binding protein SapD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P08007 4.97e-69 221 39 9 335 1 oppF Oligopeptide transport ATP-binding protein OppF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAH7 9.31e-67 215 38 6 322 3 sapD Peptide transport system ATP-binding protein SapD Shigella flexneri
P0AAH4 9.31e-67 215 38 6 322 1 sapD Putrescine export system ATP-binding protein SapD Escherichia coli (strain K12)
P0AAH5 9.31e-67 215 38 6 322 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAH6 9.31e-67 215 38 6 322 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O157:H7
P42065 8.6e-66 213 38 5 331 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
Q8RDH4 9.47e-66 213 38 4 315 1 dppD Dipeptide transport ATP-binding protein DppD Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2YJJ8 1.84e-63 207 40 3 282 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 1.84e-63 207 40 3 282 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
Q53194 3.12e-63 207 41 5 297 3 NGR_a01400 Probable peptide ABC transporter ATP-binding protein y4tS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8YDH1 9.42e-63 206 40 3 282 3 BMEII0205 Putative peptide import ATP-binding protein BMEII0205 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0SP98 2.73e-62 204 38 9 327 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
P24137 7.38e-60 197 40 3 281 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
Q2FVF0 7.67e-58 191 38 1 258 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JXA3 2.02e-57 189 37 1 258 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain Mu50 / ATCC 700699)
P72479 4.8e-57 189 40 5 262 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A2RI78 5.37e-57 189 39 6 271 1 dppF Dipeptide transport ATP-binding protein DppF Lactococcus lactis subsp. cremoris (strain MG1363)
P45288 5.17e-56 188 34 3 304 3 sapD Peptide transport system ATP-binding protein SapD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77622 1.13e-55 186 36 10 329 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P18766 2.08e-55 185 39 3 259 3 amiF Oligopeptide transport ATP-binding protein AmiF Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0A2V5 4.1e-52 177 38 7 271 3 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. cremoris (strain SK11)
P0A2V4 4.1e-52 177 38 7 271 1 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. lactis (strain IL1403)
Q8P2L5 6.42e-52 176 38 6 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0CZ33 1.56e-51 175 38 6 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XDU4 1.56e-51 175 38 6 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ32 1.56e-51 175 38 6 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0A2V6 1.56e-51 175 38 6 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M1
P16678 2.13e-44 155 35 3 257 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q13VD7 6.68e-43 154 36 7 253 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q2RS21 3.75e-41 147 35 3 235 3 nikD Nickel import ATP-binding protein NikD Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3YW49 3.02e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Shigella sonnei (strain Ss046)
Q31VE7 3.82e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Shigella boydii serotype 4 (strain Sb227)
Q0SZJ4 5.71e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri serotype 5b (strain 8401)
Q8X5U1 5.71e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O157:H7
Q1R5D9 5.78e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain UTI89 / UPEC)
Q0TBX9 5.78e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83J78 6.49e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri
P33593 6.49e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain K12)
Q32AQ2 6.7e-40 144 37 4 234 3 nikD Nickel import ATP-binding protein NikD Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCN0 1.18e-39 143 37 4 234 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3KK97 1.3e-38 142 31 8 292 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q832Y6 1.36e-38 143 34 8 273 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q63S19 4.23e-38 141 34 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 4.23e-38 141 34 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 4.23e-38 141 34 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q1BY14 4.95e-38 141 35 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 4.95e-38 141 35 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q2SY12 6.11e-38 141 34 7 256 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0BH79 1.18e-37 140 36 10 286 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q4KKK8 1.53e-37 139 31 8 292 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5WDP1 4.69e-37 138 33 5 265 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q39IE7 5.38e-37 138 35 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6G2E2 5.66e-37 138 34 7 263 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q3A9G5 8.15e-37 137 33 8 305 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0BMC9 1.18e-36 137 34 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.18e-36 137 34 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q87AL9 1.22e-36 137 33 8 271 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9HT70 1.37e-36 137 32 8 290 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 1.37e-36 137 32 8 290 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q14H97 3.66e-36 136 34 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q5NFU5 4.28e-36 136 34 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0KDG3 4.57e-36 136 36 6 246 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8ELQ6 5.29e-36 135 35 6 254 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0AAI0 9.78e-36 133 33 5 256 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 9.78e-36 133 33 5 256 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 9.78e-36 133 33 5 256 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q03P57 1.15e-35 135 36 7 250 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q88WA5 1.61e-35 135 32 7 268 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7VV72 2.61e-35 134 31 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 2.61e-35 134 31 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 2.61e-35 134 31 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q04F14 2.82e-35 134 34 6 247 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q1IGZ0 3.35e-35 133 30 8 292 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q12B04 3.65e-35 134 34 9 286 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q46Y69 3.67e-35 133 34 6 249 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q88HL1 4.36e-35 131 34 3 234 3 nikD Nickel import ATP-binding protein NikD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5PCG9 4.48e-35 133 33 6 249 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q88RL5 4.88e-35 133 31 8 283 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8ZR89 4.92e-35 133 33 6 249 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P36638 6.92e-35 131 33 4 249 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1LQF6 8.61e-35 132 34 6 249 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P75551 9.91e-35 137 38 2 167 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75551 8.97e-10 63 31 3 122 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9PF03 1.01e-34 132 34 7 258 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q57S53 1.47e-34 132 32 6 249 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
P47326 1.5e-34 137 43 1 139 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47326 9.13e-11 66 32 3 126 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8FV85 1.7e-34 132 32 6 259 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.7e-34 132 32 6 259 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.7e-34 132 32 6 259 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.7e-34 132 32 6 259 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q48PU6 2.23e-34 131 31 8 283 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4JTG9 2.39e-34 132 34 5 238 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q8FRX8 2.44e-34 132 35 5 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8NSN2 2.51e-34 132 36 5 225 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8Z8R5 2.71e-34 131 34 7 258 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8E3S0 4.33e-34 131 33 7 268 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q73F11 5.02e-34 130 33 6 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8DY54 5.06e-34 130 33 7 268 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 5.06e-34 130 33 7 268 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q043Y8 6.03e-34 130 34 9 260 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5WKL3 6.51e-34 130 33 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q5KVK2 7.48e-34 130 30 5 283 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q6NJ07 9.13e-34 130 33 5 246 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P55662 1.01e-33 127 33 7 254 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q4ZZR8 1.23e-33 129 31 8 283 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q7VI92 1.24e-33 129 32 6 249 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2KVK2 2.06e-33 129 30 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q03Z27 2.47e-33 129 30 8 303 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q5XDS8 2.92e-33 129 32 9 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1JNE0 2.95e-33 129 31 7 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 2.95e-33 129 31 7 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q81VM2 3.42e-33 128 33 7 250 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q6D3Q6 3.67e-33 128 35 6 228 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87UN4 3.72e-33 128 31 8 283 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q134N9 3.74e-33 129 33 7 260 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q48V78 3.9e-33 128 32 9 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 3.9e-33 128 32 9 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q8ELA5 4.04e-33 128 34 7 244 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P0CZ31 6.2e-33 128 31 7 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 6.2e-33 128 31 7 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q0SFW6 7.81e-33 127 31 5 257 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q65F80 7.96e-33 127 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q49W48 8.38e-33 127 34 7 252 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6F9P2 9.02e-33 127 33 7 254 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1J8E4 1.14e-32 127 32 9 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1CR30 1.26e-32 126 35 7 234 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q7CHF8 1.3e-32 126 33 9 248 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 1.3e-32 126 33 9 248 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 1.3e-32 126 33 9 248 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 1.3e-32 126 33 9 248 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q5HQQ9 1.31e-32 127 31 4 262 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q73EL7 1.38e-32 126 33 7 256 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8P2K6 1.43e-32 127 32 9 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q63H29 1.52e-32 126 33 7 250 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q38WL5 1.67e-32 126 30 9 310 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q4L4R9 2.31e-32 126 32 6 248 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q8ZRM9 2.5e-32 126 31 7 273 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O26096 2.53e-32 125 34 7 234 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q8CTB2 2.54e-32 126 31 5 263 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q895C4 2.62e-32 125 32 7 245 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q31VE6 2.62e-32 124 35 3 211 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q32AQ1 3.1e-32 124 35 3 211 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q1JII9 3.37e-32 125 32 9 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8DRF9 3.56e-32 125 32 8 267 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5FKL2 3.6e-32 125 31 12 324 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q57T09 3.71e-32 125 31 7 273 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q8ENU2 3.75e-32 125 31 6 275 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q63GR8 4.64e-32 125 33 7 256 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8YCN8 4.74e-32 123 36 3 233 3 nikD Nickel import ATP-binding protein NikD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S8 4.74e-32 123 36 3 233 3 nikD Nickel import ATP-binding protein NikD Brucella abortus biovar 1 (strain 9-941)
Q2YL70 4.74e-32 123 36 3 233 3 nikD Nickel import ATP-binding protein NikD Brucella abortus (strain 2308)
Q21BU8 5.18e-32 125 31 7 274 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q1WVG9 5.38e-32 125 30 11 342 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q74IV9 5.43e-32 125 32 8 260 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q07LR5 6.28e-32 125 32 7 258 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q3YW48 6.8e-32 123 35 3 211 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q8X4L6 6.94e-32 123 33 4 236 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
P33594 7.01e-32 123 35 3 211 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
O32169 7.83e-32 124 31 5 255 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q1R5D8 7.95e-32 123 35 3 211 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 7.95e-32 123 35 3 211 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 7.95e-32 123 35 3 211 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q6D1C4 9.01e-32 124 31 8 281 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5PID0 1.02e-31 124 32 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q81IN8 1.06e-31 124 33 7 256 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HBS0 1.12e-31 124 34 7 252 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q03A07 1.13e-31 124 34 7 263 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q81IZ6 1.17e-31 124 32 6 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9ZJ34 1.25e-31 124 34 7 234 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q8Y4L8 1.25e-31 124 29 5 280 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6HP89 1.54e-31 124 33 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8FVM9 1.58e-31 122 36 3 233 2 nikD Nickel import ATP-binding protein NikD Brucella suis biovar 1 (strain 1330)
Q81ZF5 1.85e-31 123 33 7 256 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q928L8 1.89e-31 123 29 5 280 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q04DA7 2.11e-31 124 32 9 290 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8EPK1 2.12e-31 123 32 4 237 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88UV2 2.14e-31 123 33 5 250 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q65VG9 2.37e-31 123 30 7 273 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QMH4 2.37e-31 123 31 7 275 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q83MC5 2.53e-31 123 32 9 273 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 2.53e-31 123 32 9 273 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q17VE0 3e-31 122 33 7 230 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q8Y0X3 3.22e-31 123 33 7 257 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P30750 3.31e-31 123 32 9 273 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q8Z990 3.82e-31 122 32 7 256 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q81XL3 3.95e-31 122 31 5 264 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q631Y4 4.08e-31 122 31 5 264 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q6N9W0 4.2e-31 123 32 7 259 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q815Y7 4.21e-31 122 32 6 252 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q32JQ8 4.28e-31 122 32 9 273 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q5M1F6 4.28e-31 123 31 7 277 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q72Y96 4.34e-31 122 32 6 252 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q0TLD2 4.37e-31 122 32 9 273 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83J77 4.41e-31 120 34 3 211 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q97T09 4.62e-31 122 32 8 267 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3Z5F8 4.89e-31 122 32 9 273 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 4.89e-31 122 32 9 273 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 4.89e-31 122 32 9 273 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 4.89e-31 122 32 9 273 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q71X09 5.02e-31 122 28 5 280 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q0SZJ3 6.28e-31 120 34 3 211 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q325U1 7.46e-31 122 33 9 256 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
P44785 8.23e-31 122 31 7 275 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q93DA2 1.03e-30 122 33 8 251 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5M5Z2 1.14e-30 122 31 9 279 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q21XK2 1.22e-30 121 31 7 256 3 metN Methionine import ATP-binding protein MetN Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5WJP0 1.4e-30 121 33 7 247 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q667L9 1.58e-30 121 32 7 243 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q4KK46 1.6e-30 122 31 5 256 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q89LP2 1.97e-30 121 32 5 239 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2FVF1 3.16e-30 118 32 2 211 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q4ZZK0 3.48e-30 120 31 6 257 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q6FAN3 3.84e-30 120 32 6 250 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2RWA3 4.45e-30 120 30 6 256 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8RFN2 4.46e-30 120 33 7 243 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q87UV4 6.16e-30 120 30 7 280 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HIL5 6.43e-30 119 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 6.43e-30 119 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 6.43e-30 119 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q6D5H7 7.29e-30 119 32 7 250 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5E715 7.36e-30 119 34 7 228 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8NY21 7.74e-30 119 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 7.74e-30 119 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q9K789 7.96e-30 119 31 6 252 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5YRD1 8.28e-30 119 30 5 244 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
A0A0H3JT74 8.89e-30 117 32 2 211 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YVT7 1.1e-29 119 32 9 249 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q0AU85 1.26e-29 119 30 7 256 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q6GIH9 1.49e-29 118 31 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q1CFH7 1.59e-29 118 31 7 243 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 1.59e-29 118 31 7 243 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 1.59e-29 118 31 7 243 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q04B25 1.74e-29 118 33 8 252 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q831K6 1.87e-29 118 31 3 243 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q3KJS6 1.91e-29 119 32 5 256 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q1GAN9 1.93e-29 118 32 7 249 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q7A5Q8 2.46e-29 116 29 4 257 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain N315)
Q99UA2 2.46e-29 116 29 4 257 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GH27 2.94e-29 115 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MRSA252)
Q2YWP2 3.15e-29 117 31 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q83F44 3.53e-29 117 29 6 244 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q7A7E3 3.83e-29 117 31 9 249 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.83e-29 117 31 9 249 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0I5E9 4.99e-29 117 28 5 280 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q6LN52 5.66e-29 117 34 6 227 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q0SFY5 5.95e-29 117 28 7 283 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q65M34 5.96e-29 117 34 7 225 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P45289 6.8e-29 115 32 6 255 3 sapF Peptide transport system ATP-binding protein SapF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6GJL2 7.69e-29 116 31 9 249 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q02ME3 9.96e-29 117 32 6 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7A6M2 1.03e-28 116 31 5 245 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 1.03e-28 116 31 5 245 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P77795 1.05e-28 116 31 5 244 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q87RS1 1.07e-28 116 31 7 244 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8NXH5 1.12e-28 116 31 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 1.12e-28 116 31 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 1.12e-28 116 31 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 1.12e-28 116 31 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 1.12e-28 116 31 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q48PN3 1.92e-28 116 30 5 256 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6G9I0 1.93e-28 113 30 3 240 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MSSA476)
Q5HG40 1.93e-28 113 30 3 240 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain COL)
Q2FYQ7 1.93e-28 113 30 3 240 1 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH57 1.93e-28 113 30 3 240 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain USA300)
Q8P4S7 1.95e-28 115 31 7 236 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 1.95e-28 115 31 7 236 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q8NWT5 1.97e-28 113 30 3 240 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MW2)
Q7N8M2 2.06e-28 115 30 8 260 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8CQS7 2.1e-28 115 31 7 244 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 2.1e-28 115 31 7 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YXY9 2.55e-28 113 30 3 240 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2RS22 2.6e-28 114 32 5 237 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7NTU0 2.74e-28 112 37 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P45092 2.76e-28 112 32 8 251 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39459 3.07e-28 113 33 7 244 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q7VM95 3.42e-28 115 31 7 256 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6GE75 3.53e-28 112 32 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
Q9KTJ5 3.71e-28 115 32 7 244 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8G5P8 4.15e-28 115 33 6 229 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q7A3X3 4.58e-28 111 32 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 4.58e-28 111 32 6 235 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q39T41 6.98e-28 111 34 8 238 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q7MN25 7.36e-28 114 32 7 228 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q8DFC3 7.82e-28 114 31 7 244 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q9CK97 8.4e-28 114 28 7 280 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q7WGW1 9.59e-28 114 28 6 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8CRB0 1.07e-27 110 33 6 227 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9I1C8 1.1e-27 114 32 6 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YA75 1.44e-27 113 33 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5HLN4 1.51e-27 110 33 6 227 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0LUE6 1.51e-27 114 27 6 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q8NV47 1.58e-27 110 31 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 1.58e-27 110 31 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 1.58e-27 110 31 6 235 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 1.58e-27 110 31 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 1.58e-27 110 31 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 1.58e-27 110 31 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q2YZ26 1.6e-27 110 31 6 235 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7W9U5 1.73e-27 113 28 6 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q4L8L7 1.87e-27 110 31 7 237 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q7VZE5 1.95e-27 113 28 6 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2P7S3 2.11e-27 112 30 4 241 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5H503 2.58e-27 112 30 4 241 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NRN5 2.75e-27 112 32 6 243 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q8PGE8 2.77e-27 112 30 6 245 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q032A0 3.28e-27 112 32 7 258 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
D8KFN1 4.1e-27 112 32 7 258 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 4.1e-27 112 32 7 258 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q3BNZ3 4.71e-27 111 29 4 244 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1B677 5.1e-27 111 33 7 242 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q6A6X6 5.21e-27 112 32 9 265 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q88RB3 5.41e-27 112 31 5 234 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9MUN1 5.49e-27 112 29 5 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q6N798 5.49e-27 112 33 8 246 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q724C0 5.89e-27 111 32 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q827Y0 5.98e-27 111 29 6 257 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82JY6 6.47e-27 111 30 8 290 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q3IL62 6.87e-27 108 35 6 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q8U7G2 7.47e-27 112 31 8 263 3 metN Methionine import ATP-binding protein MetN Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92EZ6 8.07e-27 111 32 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3JHC9 8.59e-27 112 32 7 243 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q0B6I6 8.9e-27 112 32 7 244 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q63NI4 9.03e-27 112 32 7 243 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q53I83 9.42e-27 111 29 7 251 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
P37774 9.9e-27 108 29 8 254 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q98DA2 9.95e-27 111 32 7 268 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1LPJ9 9.99e-27 108 34 5 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1DDP4 1.01e-26 110 32 7 231 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q62B84 1.04e-26 112 32 7 243 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q5E0B3 1.19e-26 108 34 7 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aliivibrio fischeri (strain ATCC 700601 / ES114)
P56344 1.2e-26 108 27 3 236 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q92LX3 1.29e-26 110 33 9 239 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q3J1N0 1.36e-26 110 32 6 239 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q18C09 1.41e-26 110 32 5 228 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
P46920 1.44e-26 111 31 4 235 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q88HL0 1.62e-26 108 31 3 216 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9A502 1.67e-26 110 32 7 243 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q6LX68 2.06e-26 108 32 10 243 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q7UX73 2.18e-26 107 34 5 213 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q97KD5 2.63e-26 109 31 6 222 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q44613 2.8e-26 107 31 3 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1U0A9 3.09e-26 112 33 6 212 3 macB Macrolide export ATP-binding/permease protein MacB Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q82WT5 3.47e-26 109 27 4 258 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1BR30 3.58e-26 110 30 6 253 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 3.58e-26 110 30 6 253 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q9L1C3 3.67e-26 109 29 6 251 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CIN4 3.7e-26 110 32 7 255 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q74DN5 4.21e-26 107 32 9 239 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8E8K8 4.85e-26 109 30 5 233 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q39AT4 6.79e-26 109 30 7 253 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9S4Z0 6.97e-26 108 32 6 228 3 metN Methionine import ATP-binding protein MetN Salmonella enteritidis
Q5WVL8 9.2e-26 108 32 6 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q9G4F5 9.46e-26 108 27 4 258 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q74AT2 9.48e-26 105 34 7 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A3DJK5 9.52e-26 107 29 7 260 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q1M8E0 1.04e-25 108 32 6 256 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UKE4 1.06e-25 110 32 9 268 3 macB Macrolide export ATP-binding/permease protein MacB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5ZUG5 1.16e-25 108 32 6 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9RR46 1.16e-25 108 30 4 245 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
O59479 1.43e-25 106 27 6 252 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O34979 1.58e-25 105 33 7 227 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q0HVQ0 1.63e-25 105 35 9 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-7)
Q4KBU0 1.72e-25 107 30 7 252 3 metN3 Methionine import ATP-binding protein MetN 3 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0HJG0 1.93e-25 105 35 9 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q4FL37 2.17e-25 107 29 5 243 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q9YG51 2.44e-25 105 31 7 227 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q1IGN4 2.72e-25 107 29 5 234 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q0A8P9 2.97e-25 104 32 7 239 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9V1Q4 3.1e-25 105 27 5 244 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q1WSB9 3.19e-25 105 32 8 246 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q7N3A6 3.21e-25 104 33 6 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1QVQ7 3.26e-25 107 30 7 245 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q67JX3 3.3e-25 105 31 11 278 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q21TG3 3.52e-25 104 32 6 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q6GH28 3.52e-25 104 28 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q7NWX3 3.53e-25 107 30 7 246 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5HG41 3.75e-25 104 29 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 3.75e-25 104 29 5 246 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 3.75e-25 104 29 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q5X484 3.79e-25 106 32 6 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q65P77 4.04e-25 105 30 8 253 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8NWT6 4.2e-25 104 29 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 4.2e-25 104 29 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q9EYM2 4.2e-25 103 31 4 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4FTM3 4.31e-25 103 33 5 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q89UD2 4.76e-25 106 28 7 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2K284 5.18e-25 106 33 5 239 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P74548 5.37e-25 106 27 3 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q58206 5.68e-25 103 30 6 228 1 MJ0796 Uncharacterized ABC transporter ATP-binding protein MJ0796 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7A5Q9 5.84e-25 103 28 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 5.84e-25 103 28 5 246 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8EEV5 6.05e-25 103 35 9 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1QCN2 6.52e-25 103 32 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q03AH0 7.93e-25 106 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q080S4 8.36e-25 103 32 9 237 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella frigidimarina (strain NCIMB 400)
Q2NHA1 8.9e-25 104 30 8 239 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8FVN0 9.66e-25 103 32 5 237 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q97EK9 9.75e-25 104 30 9 260 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3M5J9 9.87e-25 103 31 8 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q312H8 1.04e-24 103 31 6 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q47RE8 1.05e-24 105 31 6 242 3 metN Methionine import ATP-binding protein MetN Thermobifida fusca (strain YX)
Q9PDN2 1.12e-24 105 25 3 258 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q0VQQ0 1.14e-24 102 34 7 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P57383 1.17e-24 102 35 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8GEH7 1.21e-24 105 33 9 249 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
P73265 1.27e-24 103 31 5 223 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q13LD8 1.47e-24 105 30 7 259 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
P57066 1.54e-24 102 33 6 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5HV18 1.56e-24 104 29 7 256 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.56e-24 104 29 7 256 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5X2Z8 1.62e-24 102 31 7 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q47YG8 1.63e-24 103 33 6 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8YCN7 1.66e-24 103 32 6 240 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 1.66e-24 103 32 6 240 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 1.66e-24 103 32 6 240 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q9CM47 2.14e-24 107 30 7 233 3 macB Macrolide export ATP-binding/permease protein MacB Pasteurella multocida (strain Pm70)
Q8EBC3 2.17e-24 105 27 5 246 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5ZT78 2.28e-24 102 31 7 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q24QI5 2.29e-24 104 30 7 245 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q9CIS9 2.4e-24 103 29 8 258 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
Q9I190 2.73e-24 107 31 15 291 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1I7I9 2.83e-24 106 34 7 219 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas entomophila (strain L48)
Q32EX7 2.89e-24 102 34 5 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q9KIF7 3.16e-24 105 29 5 241 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q04BY7 3.27e-24 102 32 8 246 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
P0A9U0 3.27e-24 101 31 5 231 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 3.27e-24 101 31 5 231 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 3.27e-24 101 31 5 231 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q5NZT6 3.31e-24 101 30 5 236 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8R7Y5 3.35e-24 103 30 8 247 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q31GF5 3.35e-24 101 35 4 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q032H4 3.37e-24 102 29 8 258 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 3.37e-24 102 29 8 258 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
A0KMJ3 3.42e-24 106 32 7 234 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8F6Z1 3.45e-24 104 26 6 278 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 3.45e-24 104 26 6 278 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P0CZ35 3.59e-24 104 29 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 3.59e-24 104 29 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 3.59e-24 104 29 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8RFV0 3.66e-24 101 32 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07125
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 1555713 - 1556699 (strand: -1)
Length 987 (nucleotides) / 328 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_960
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08352 Oligopeptide/dipeptide transporter, C-terminal region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0444 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)		 EP ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15583 oligopeptide transport system ATP-binding protein beta-Lactam resistance
ABC transporters
Quorum sensing		 -

Protein Sequence

MTNSTNKPLLSVKDLCVTFGTPDGDVTAVNKLNFELSAGETLGIVGESGSGKSQTAFALMGLLAKNGRTAGSAHFNGREILNLRQSQLNKMRAEEISMIFQDPMTSLNPYMKVGTQLIEVLMLHKGMSKNDAYAESVRMLDAVKMPEAHKRMGMYPHEFSGGMRQRVMIAMALLCKPKLLIADEPTTALDVTVQAQIMTLLNELKKELNTAIIMITHDLGVVAGICDKVLVMYAGRTMEYGNARDIFYQPSHPYSIGLLQAVPRLDGEDERLATIPGNPPNLLRLPKGCPFQPRCQYATEQCLNSEPQLTQFAQGRLRACFKAAEELV

Flanking regions ( +/- flanking 50bp)

TGATGGTTTACGTGACGCGTTAGATCCGAAAGATCGTTAAGGAGAACATGATGACAAATTCAACAAATAAGCCATTGTTAAGTGTAAAAGATCTCTGTGTCACCTTTGGTACTCCAGATGGGGATGTAACCGCAGTAAATAAGCTCAACTTTGAGCTATCTGCAGGGGAAACCTTAGGAATTGTCGGTGAATCTGGCTCTGGGAAATCGCAAACGGCGTTCGCCTTAATGGGATTATTAGCTAAAAACGGTCGTACTGCTGGAAGTGCTCATTTTAATGGTCGTGAAATTTTAAACTTACGCCAAAGTCAATTAAACAAAATGCGTGCTGAAGAAATATCCATGATATTTCAAGATCCGATGACCTCACTTAACCCCTATATGAAAGTCGGCACTCAGTTAATAGAAGTGCTTATGCTTCATAAGGGTATGAGTAAAAATGATGCATATGCGGAATCTGTTCGCATGCTTGATGCAGTAAAAATGCCCGAAGCCCATAAACGTATGGGCATGTATCCCCATGAGTTCTCTGGTGGGATGCGCCAACGGGTAATGATAGCGATGGCACTATTATGTAAGCCAAAACTATTAATTGCTGATGAGCCAACAACGGCACTGGATGTGACTGTTCAGGCACAAATCATGACACTGCTAAACGAGCTAAAAAAAGAGCTTAATACAGCCATTATCATGATCACCCATGACCTCGGTGTGGTTGCGGGTATTTGCGACAAAGTACTGGTAATGTATGCTGGGCGAACCATGGAATATGGTAATGCGCGAGATATTTTCTACCAACCATCACACCCATATTCTATTGGATTGCTGCAAGCAGTACCTCGTTTAGATGGTGAAGATGAACGTTTGGCGACCATTCCGGGTAATCCTCCTAACTTATTGCGTTTACCTAAAGGTTGCCCATTCCAGCCTCGTTGCCAATATGCAACAGAGCAGTGTTTGAATAGTGAACCTCAATTAACACAATTTGCTCAGGGAAGATTACGAGCCTGTTTTAAAGCGGCGGAGGAGTTAGTATGAGCCAAGCCACCTTACAAGATAGAAAAGTGATCCTCGAAGTCAACGATCTA