Homologs in group_1029

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_12310 EHELCC_12310 100.0 Morganella morganii S2 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
NLDBIP_12650 NLDBIP_12650 100.0 Morganella morganii S4 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
LHKJJB_12510 LHKJJB_12510 100.0 Morganella morganii S3 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
HKOGLL_11125 HKOGLL_11125 100.0 Morganella morganii S5 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
F4V73_RS05735 F4V73_RS05735 93.5 Morganella psychrotolerans - ABC transporter ATP-binding protein
PMI_RS07125 PMI_RS07125 85.1 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1029

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1029

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P04285 0.0 546 83 2 320 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P76027 0.0 535 81 2 320 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
P45052 0.0 509 75 2 323 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P24136 1.97e-110 328 52 1 307 1 oppD Oligopeptide transport ATP-binding protein OppD Bacillus subtilis (strain 168)
A2RI77 7.71e-108 321 51 3 304 1 dppD Dipeptide transport ATP-binding protein DppD Lactococcus lactis subsp. cremoris (strain MG1363)
P42064 1.21e-103 309 46 2 326 3 appD Oligopeptide transport ATP-binding protein AppD Bacillus subtilis (strain 168)
P26905 1.87e-103 309 48 2 319 3 dppD Dipeptide transport ATP-binding protein DppD Bacillus subtilis (strain 168)
Q8YBN6 8.67e-103 308 46 5 330 3 BMEII0863 Putative peptide import ATP-binding protein BMEII0863 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU87 2.63e-102 306 46 5 330 3 BOV_A0348 Putative peptide import ATP-binding protein BOV_A0348 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q2YK63 3.24e-102 306 45 5 330 3 BAB2_0817 Putative peptide import ATP-binding protein BAB2_0817 Brucella abortus (strain 2308)
Q577J5 3.24e-102 306 45 5 330 3 BruAb2_0796 Putative peptide import ATP-binding protein BruAb2_0796 Brucella abortus biovar 1 (strain 9-941)
Q8FWP1 4.64e-102 306 45 5 330 3 BRA0405 Putative peptide import ATP-binding protein BRA0405/BS1330_II0402 Brucella suis biovar 1 (strain 1330)
Q53193 1.08e-99 300 46 1 320 3 NGR_a01410 Probable peptide ABC transporter ATP-binding protein y4tR Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8FUW8 2.65e-99 298 47 3 314 3 BRA1094 Putative peptide import ATP-binding protein BRA1094/BS1330_II1086 Brucella suis biovar 1 (strain 1330)
Q2YJJ9 2.65e-99 298 47 3 314 3 BAB2_1052 Putative peptide import ATP-binding protein BAB2_1052 Brucella abortus (strain 2308)
Q8VQK6 2.65e-99 298 47 3 314 3 BruAb2_1033 Putative peptide import ATP-binding protein BruAb2_1033 Brucella abortus biovar 1 (strain 9-941)
Q8YDH0 6.82e-99 297 47 3 314 3 BMEII0206 Putative peptide import ATP-binding protein BMEII0206 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0AAG2 1.13e-97 294 46 2 314 3 dppD Dipeptide transport ATP-binding protein DppD Shigella flexneri
P0AAG0 1.13e-97 294 46 2 314 1 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli (strain K12)
P0AAG1 1.13e-97 294 46 2 314 3 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli O157:H7
P45095 4.22e-93 283 45 2 312 3 dppD Dipeptide transport ATP-binding protein DppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P63396 7.77e-92 288 45 3 321 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 4.97e-45 165 38 4 251 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 7.77e-92 288 45 3 321 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 4.97e-45 165 38 4 251 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 7.77e-92 288 45 3 321 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 4.97e-45 165 38 4 251 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0H2ZGN6 9.29e-92 279 47 5 318 1 dppD Di/tripeptide transport ATP-binding protein DppD Pseudomonas aeruginosa (strain UCBPP-PA14)
P77268 3.27e-91 278 44 5 327 2 ddpD Probable D,D-dipeptide transport ATP-binding protein DdpD Escherichia coli (strain K12)
P0A2U9 5e-90 276 46 3 293 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U8 5e-90 276 46 3 293 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3Z3V4 2.96e-84 269 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 1.02e-56 196 43 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q323W5 4.63e-84 268 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 1.52e-56 196 43 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q32IB5 6.3e-84 268 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 3.9e-57 197 43 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q8FJL0 6.5e-84 268 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 6.82e-56 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RE96 6.86e-84 268 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 9.31e-56 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q0TJM0 7.16e-84 268 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 5.72e-56 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A967 7.16e-84 268 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 5.66e-56 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
P75796 8.95e-84 268 51 3 264 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 9.82e-57 196 43 5 263 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q8ZQM4 1.07e-83 267 46 4 310 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 6.14e-54 189 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X6W1 1.18e-83 267 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 2.92e-56 195 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q5PGP3 1.33e-83 267 45 4 310 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 3.74e-54 189 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z864 1.99e-83 267 46 4 310 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 6.33e-54 189 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q83LT3 1.81e-82 264 51 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 1.05e-55 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q57RB2 1.86e-82 264 45 4 310 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 6.01e-54 189 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q0T6D3 7.68e-82 263 50 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 1.11e-55 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q6D3A9 1.43e-80 259 49 3 265 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 2.71e-59 203 43 5 266 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9CKL2 7.85e-76 245 48 1 258 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 9.36e-48 171 37 6 270 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
P50980 3.79e-73 232 39 3 299 3 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. cremoris (strain SK11)
Q07733 4.36e-73 232 39 3 299 1 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. lactis (strain IL1403)
P33916 4.64e-73 237 48 2 264 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 3e-53 185 41 6 260 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P45051 6.91e-73 231 39 6 329 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77737 1.72e-72 230 41 6 317 1 oppF Oligopeptide transport ATP-binding protein OppF Escherichia coli (strain K12)
P08007 2.32e-71 227 40 6 316 1 oppF Oligopeptide transport ATP-binding protein OppF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H2ZH52 4.39e-71 226 39 6 331 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8YBN5 2.71e-69 221 36 3 317 3 BMEII0864 Putative peptide import ATP-binding protein BMEII0864 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP2 2.71e-69 221 36 3 317 3 BRA0404 Putative peptide import ATP-binding protein BRA0404/BS1330_II0401 Brucella suis biovar 1 (strain 1330)
Q2YK62 2.71e-69 221 36 3 317 3 BAB2_0818 Putative peptide import ATP-binding protein BAB2_0818 Brucella abortus (strain 2308)
Q577J4 2.71e-69 221 36 3 317 3 BruAb2_0797 Putative peptide import ATP-binding protein BruAb2_0797 Brucella abortus biovar 1 (strain 9-941)
A5VU86 2.71e-69 221 36 3 317 3 BOV_A0347 Putative peptide import ATP-binding protein BOV_A0347 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P45094 1.31e-68 220 38 4 297 3 dppF Dipeptide transport ATP-binding protein DppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P47325 1.44e-68 222 35 4 340 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8RDH4 1.92e-68 219 39 5 306 1 dppD Dipeptide transport ATP-binding protein DppD Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P37313 1.39e-67 218 38 5 320 1 dppF Dipeptide transport ATP-binding protein DppF Escherichia coli (strain K12)
P42065 8.31e-67 215 40 4 306 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
P75552 9.58e-67 218 34 6 342 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P36636 5.06e-66 213 37 4 303 2 sapD Peptide transport system ATP-binding protein SapD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q53194 3.85e-64 209 42 4 304 3 NGR_a01400 Probable peptide ABC transporter ATP-binding protein y4tS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0AAH7 8e-64 207 37 4 303 3 sapD Peptide transport system ATP-binding protein SapD Shigella flexneri
P0AAH4 8e-64 207 37 4 303 1 sapD Putrescine export system ATP-binding protein SapD Escherichia coli (strain K12)
P0AAH5 8e-64 207 37 4 303 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAH6 8e-64 207 37 4 303 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O157:H7
C0SP98 1.07e-63 207 40 10 328 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
Q2YJJ8 2.92e-61 201 37 5 312 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 2.92e-61 201 37 5 312 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
Q8YDH1 2.28e-60 200 37 5 312 3 BMEII0205 Putative peptide import ATP-binding protein BMEII0205 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2FVF0 3.42e-60 196 38 1 258 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JXA3 1.14e-59 195 38 1 258 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain Mu50 / ATCC 700699)
P72479 4.28e-59 195 40 5 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P24137 1.33e-58 193 40 3 257 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
A2RI78 3.28e-58 192 39 6 261 1 dppF Dipeptide transport ATP-binding protein DppF Lactococcus lactis subsp. cremoris (strain MG1363)
P45288 3.02e-56 189 33 3 303 3 sapD Peptide transport system ATP-binding protein SapD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77622 7.24e-56 186 36 8 325 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P0A2V5 3.36e-55 185 33 9 334 3 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. cremoris (strain SK11)
P0A2V4 3.36e-55 185 33 9 334 1 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. lactis (strain IL1403)
P18766 7.05e-54 181 38 3 257 3 amiF Oligopeptide transport ATP-binding protein AmiF Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8P2L5 5.9e-52 176 38 3 257 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0CZ33 1.26e-51 176 38 3 257 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XDU4 1.26e-51 176 38 3 257 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ32 1.26e-51 176 38 3 257 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0A2V6 1.26e-51 176 38 3 257 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M1
Q13VD7 4.61e-41 149 36 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q3KK97 4.95e-41 149 32 8 292 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q2RS21 2.31e-40 145 35 3 243 3 nikD Nickel import ATP-binding protein NikD Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P16678 3.38e-39 141 35 3 254 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q4KKK8 6.8e-39 143 32 6 272 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q32AQ2 1.82e-38 140 34 4 264 3 nikD Nickel import ATP-binding protein NikD Shigella dysenteriae serotype 1 (strain Sd197)
Q9HT70 2.72e-38 141 32 9 294 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 2.72e-38 141 32 9 294 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P0AAI0 3.9e-38 139 34 6 250 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 3.9e-38 139 34 6 250 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 3.9e-38 139 34 6 250 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YW49 4.3e-38 139 36 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella sonnei (strain Ss046)
Q83J78 4.78e-38 139 36 3 241 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri
Q31VE7 5.2e-38 138 36 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella boydii serotype 4 (strain Sb227)
Q1R5D9 5.2e-38 138 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain UTI89 / UPEC)
Q0TBX9 5.2e-38 138 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8X5U1 5.2e-38 138 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O157:H7
Q0SZJ4 5.43e-38 138 36 3 241 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri serotype 5b (strain 8401)
P33593 6.03e-38 138 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain K12)
Q8FCN0 7.86e-38 138 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q832Y6 7.96e-38 140 32 7 274 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q1BY14 8.39e-38 140 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 8.39e-38 140 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q1IGZ0 1.91e-37 139 31 6 272 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q0BH79 2.22e-37 139 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0KDG3 2.32e-37 139 36 6 246 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q39IE7 3.44e-37 139 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P36638 4.21e-37 136 34 5 250 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1LQF6 7.31e-37 138 35 7 257 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q3A9G5 1.21e-36 137 34 7 263 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q49W48 3.65e-36 136 34 8 294 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q88RL5 4.27e-36 135 30 6 271 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48PU6 4.41e-36 135 31 5 265 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q63S19 5.21e-36 135 34 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 5.21e-36 135 34 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 5.21e-36 135 34 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q2SY12 6.28e-36 135 33 6 256 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q46Y69 7.9e-36 135 35 7 250 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5WKL3 8.31e-36 135 32 6 269 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q8Z8R5 1.82e-35 134 34 6 248 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q5PCG9 3.67e-35 133 33 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q04F14 3.91e-35 133 34 5 247 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8ZR89 3.94e-35 133 33 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4ZZR8 4.52e-35 133 30 5 265 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q0BMC9 5.18e-35 133 33 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 5.18e-35 133 33 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q6NJ07 5.22e-35 133 35 4 234 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8CQS7 7.2e-35 132 34 8 243 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 7.2e-35 132 34 8 243 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5FKL2 7.43e-35 133 35 9 268 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q87UN4 7.93e-35 132 30 5 265 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q57S53 8.09e-35 132 32 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
P55662 8.67e-35 130 34 7 257 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q12B04 8.97e-35 132 34 7 256 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5KVK2 9.44e-35 132 33 4 255 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q5XDS8 1.06e-34 132 33 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q48V78 1.14e-34 132 33 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 1.14e-34 132 33 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q73F11 1.35e-34 132 32 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q14H97 1.43e-34 132 33 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
P75551 1.58e-34 137 40 3 159 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75551 1.52e-08 59 30 2 121 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8EPK1 1.61e-34 131 31 4 254 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5NFU5 1.68e-34 132 33 7 249 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q87AL9 1.81e-34 131 32 7 271 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7VV72 1.92e-34 132 32 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 1.92e-34 132 32 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 1.92e-34 132 32 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1JNE0 1.97e-34 132 32 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 1.97e-34 132 32 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q4L4R9 2.84e-34 131 34 6 252 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q8YCN8 2.87e-34 129 35 2 241 3 nikD Nickel import ATP-binding protein NikD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S8 2.87e-34 129 35 2 241 3 nikD Nickel import ATP-binding protein NikD Brucella abortus biovar 1 (strain 9-941)
Q2YL70 2.87e-34 129 35 2 241 3 nikD Nickel import ATP-binding protein NikD Brucella abortus (strain 2308)
Q1J8E4 2.92e-34 131 33 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q6G2E2 3.05e-34 131 33 6 260 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1JII9 3.08e-34 131 33 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q5HIL5 3.16e-34 131 32 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 3.16e-34 131 32 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 3.16e-34 131 32 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q81VM2 3.45e-34 131 32 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q7A7E3 3.47e-34 130 33 6 242 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.47e-34 130 33 6 242 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0CZ31 3.52e-34 131 32 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 3.52e-34 131 32 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8NY21 4.01e-34 130 32 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 4.01e-34 130 32 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q0SFW6 4.01e-34 130 33 6 259 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q8P2K6 6.63e-34 130 32 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8FVM9 7.96e-34 128 35 2 241 2 nikD Nickel import ATP-binding protein NikD Brucella suis biovar 1 (strain 1330)
Q6LN52 8.18e-34 130 34 6 244 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q4QMH4 8.52e-34 130 33 7 245 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q5WDP1 8.73e-34 130 31 4 263 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q73EL7 9.03e-34 129 33 5 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q88HL1 1e-33 127 33 2 233 3 nikD Nickel import ATP-binding protein NikD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8E3S0 1.22e-33 129 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q63H29 1.37e-33 129 33 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q9PF03 1.42e-33 129 32 5 258 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q6D3Q6 1.7e-33 129 32 6 250 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P47326 1.71e-33 134 42 2 140 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47326 7.12e-09 60 32 2 121 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8DY54 1.71e-33 129 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 1.71e-33 129 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q6F9P2 1.81e-33 129 29 4 254 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q38WL5 1.84e-33 129 32 3 242 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q8DRF9 1.93e-33 129 30 8 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q4JTG9 2.3e-33 129 34 5 237 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
O32169 2.32e-33 129 33 3 242 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q6GJL2 2.44e-33 128 32 6 242 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
P44785 2.87e-33 128 33 7 245 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65F80 2.91e-33 128 34 5 247 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q63GR8 3.59e-33 128 33 5 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8ENU2 3.62e-33 128 31 5 274 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q134N9 3.94e-33 129 34 8 261 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q21BU8 4.62e-33 128 34 6 230 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q7VI92 5.68e-33 127 31 7 268 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q81IN8 6.1e-33 127 33 7 278 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9ZJ34 6.49e-33 127 32 5 242 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q8NSN2 7.84e-33 127 37 6 226 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5E715 7.93e-33 127 31 6 264 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q32JQ8 9.97e-33 127 31 5 266 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q2YVT7 1e-32 127 31 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CTB2 1.06e-32 127 32 5 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1WVG9 1.07e-32 127 35 9 256 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q6HP89 1.08e-32 127 33 5 254 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q5HQQ9 1.12e-32 127 32 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q81ZF5 1.22e-32 126 33 5 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q8FRX8 1.43e-32 127 33 7 253 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P30750 2.24e-32 126 31 5 266 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q1CR30 2.26e-32 125 32 5 242 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q88WA5 2.3e-32 126 32 7 254 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6FAN3 2.34e-32 126 32 3 246 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6N9W0 3.01e-32 126 34 6 230 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0TLD2 3.11e-32 125 31 5 266 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z5F8 3.28e-32 125 31 5 266 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 3.28e-32 125 31 5 266 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 3.28e-32 125 31 5 266 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 3.28e-32 125 31 5 266 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q97T09 3.35e-32 125 30 8 274 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3YW48 3.57e-32 124 34 3 223 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q31VE6 3.57e-32 124 34 3 223 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q32AQ1 3.68e-32 124 33 4 242 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q81IZ6 4.01e-32 125 31 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8ELQ6 4.17e-32 125 33 6 256 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q667L9 4.2e-32 125 30 6 264 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8Z990 4.56e-32 125 31 7 267 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
Q8DFC3 5.1e-32 125 30 6 282 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q2KVK2 5.15e-32 125 31 9 291 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q6GIH9 5.63e-32 125 31 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q5PID0 5.85e-32 125 31 7 267 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q325U1 5.91e-32 125 31 5 266 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
P33594 5.96e-32 123 35 3 211 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q1R5D8 6.34e-32 123 33 4 242 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 6.34e-32 123 33 4 242 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 6.34e-32 123 33 4 242 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O26096 7.06e-32 124 33 7 242 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q8X4L6 8.24e-32 122 33 4 236 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q7MN25 8.47e-32 124 30 4 262 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q87RS1 8.55e-32 124 29 3 262 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q83MC5 9.5e-32 124 31 5 266 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 9.5e-32 124 31 5 266 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q8ZRM9 9.6e-32 124 32 7 265 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9K789 1.05e-31 124 30 4 254 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2YWP2 1.13e-31 124 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q57T09 1.34e-31 124 32 7 265 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q93DA2 1.46e-31 124 32 8 259 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8ELA5 2.16e-31 123 31 6 244 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8Y0X3 2.2e-31 123 33 8 258 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q043Y8 2.25e-31 123 34 9 250 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q6D1C4 2.56e-31 123 29 6 283 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8FV85 2.95e-31 123 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.95e-31 123 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.95e-31 123 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.95e-31 123 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q5M1F6 3.71e-31 123 31 8 278 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q8NXH5 3.73e-31 122 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 3.73e-31 122 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 3.73e-31 122 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 3.73e-31 122 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 3.73e-31 122 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q03P57 3.76e-31 123 34 7 247 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7A6M2 3.84e-31 122 30 3 252 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 3.84e-31 122 30 3 252 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5WJP0 4.05e-31 122 32 4 247 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q17VE0 4.94e-31 122 32 7 238 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q2NRN5 5.21e-31 122 31 7 263 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q1CFH7 5.43e-31 122 30 6 264 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 5.43e-31 122 30 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 5.43e-31 122 30 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q5M5Z2 7.25e-31 122 31 7 276 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q03A07 8.15e-31 122 34 9 285 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8PGE8 8.43e-31 121 31 5 247 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q83J77 8.92e-31 120 34 3 217 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q88UV2 9.29e-31 122 34 5 250 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1GAN9 1.01e-30 122 34 8 254 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8YA75 1.01e-30 121 35 8 250 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q0SZJ3 1.15e-30 119 33 3 223 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q04B25 1.15e-30 121 34 8 254 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8G5P8 1.31e-30 122 34 5 228 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q4KK46 1.33e-30 122 32 5 247 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q72Y96 1.44e-30 121 32 5 253 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q815Y7 1.55e-30 121 32 5 253 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6A6X6 1.56e-30 121 32 4 234 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q21XK2 1.6e-30 121 32 7 256 3 metN Methionine import ATP-binding protein MetN Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q81XL3 1.63e-30 121 32 5 253 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q631Y4 1.64e-30 121 32 5 253 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q724C0 1.67e-30 120 35 8 250 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q9KTJ5 1.83e-30 121 30 7 272 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2RWA3 2.18e-30 120 33 6 240 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q04DA7 2.32e-30 120 30 6 263 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q03Z27 2.35e-30 121 29 5 267 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q3BNZ3 2.41e-30 120 31 5 247 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q6HBS0 3.34e-30 120 32 5 253 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q1B677 4.32e-30 119 32 8 270 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q8RFN2 5.73e-30 119 31 5 255 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q07LR5 6.01e-30 120 33 8 259 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q92EZ6 8.16e-30 119 34 7 250 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7CHF8 1.11e-29 118 31 7 244 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 1.11e-29 118 31 7 244 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 1.11e-29 118 31 7 244 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 1.11e-29 118 31 7 244 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q895C4 1.12e-29 118 30 6 244 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q7N8M2 1.15e-29 119 29 7 281 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8P4S7 1.15e-29 118 29 4 248 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 1.15e-29 118 29 4 248 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q2P7S3 1.39e-29 118 30 7 286 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q83F44 2e-29 118 29 5 244 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q74IV9 2.01e-29 118 32 8 244 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q48PN3 2.02e-29 119 31 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q65VG9 3.2e-29 117 31 7 244 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4ZZK0 3.29e-29 118 31 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q5H503 3.33e-29 117 30 7 284 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q8Y4L8 4.24e-29 117 31 5 256 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q831K6 4.35e-29 117 31 3 243 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q87UV4 4.38e-29 117 31 5 248 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KJS6 5.04e-29 117 32 6 248 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q02ME3 5.44e-29 117 31 6 241 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1DDP4 5.75e-29 116 33 6 228 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q928L8 7.45e-29 116 30 4 255 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6AE21 8.78e-29 116 34 6 238 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q6GH27 8.84e-29 114 29 4 251 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MRSA252)
Q7VM95 1.23e-28 116 30 4 243 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q71X09 2.01e-28 115 30 5 256 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
P56344 2.49e-28 112 28 3 236 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q6D5H7 3.16e-28 115 31 7 250 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0SFY5 3.34e-28 114 29 6 251 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q7A5Q8 3.71e-28 112 30 3 238 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain N315)
Q99UA2 3.71e-28 112 30 3 238 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6G9I0 3.91e-28 112 29 4 251 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MSSA476)
Q5HG40 3.91e-28 112 29 4 251 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain COL)
Q2FYQ7 3.91e-28 112 29 4 251 1 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH57 3.91e-28 112 29 4 251 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain USA300)
Q5WVL8 3.94e-28 114 33 7 225 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
O34979 4.03e-28 112 34 7 227 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
P74548 4.05e-28 115 27 5 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5ZUG5 4.36e-28 114 33 7 225 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8NWT5 4.52e-28 112 29 4 251 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MW2)
Q2RS22 5.31e-28 112 32 7 231 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3JHC9 5.33e-28 115 32 6 243 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q62B84 5.43e-28 115 32 6 243 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q2YXY9 5.86e-28 112 30 4 251 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q63NI4 6.07e-28 115 32 6 243 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q9I1C8 6.18e-28 114 31 6 241 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9G4F5 6.28e-28 114 29 7 260 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q89LP2 6.38e-28 114 31 6 239 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P27675 8.04e-28 111 31 5 228 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q4L8L7 8.32e-28 110 32 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q0AU85 9.44e-28 114 28 6 269 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q9CIN4 1.01e-27 114 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q47YG8 1.29e-27 111 34 6 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q2FVF1 1.31e-27 111 31 2 211 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q92LX3 1.4e-27 113 33 6 239 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q9CK97 1.8e-27 112 31 6 244 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q4FL37 1.8e-27 112 30 6 252 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
A0A0H3JT74 2.12e-27 110 32 4 211 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0I5E9 2.7e-27 112 29 4 242 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q82WT5 2.88e-27 112 28 5 260 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q032H4 3.52e-27 110 30 9 257 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 3.52e-27 110 30 9 257 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
P45289 3.55e-27 110 31 4 247 3 sapF Peptide transport system ATP-binding protein SapF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
D8KFN1 3.78e-27 112 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 3.78e-27 112 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q53I83 4.4e-27 112 30 8 250 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q0B6I6 4.48e-27 112 32 6 245 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6LX68 4.51e-27 110 32 8 239 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q39T41 5.17e-27 108 32 6 243 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q5X484 5.26e-27 111 31 5 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
A1VZQ5 5.55e-27 109 32 5 227 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q032A0 5.6e-27 112 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q7WGW1 5.73e-27 111 27 4 259 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9S4Z0 5.96e-27 110 32 4 210 3 metN Methionine import ATP-binding protein MetN Salmonella enteritidis
Q827Y0 6.16e-27 111 30 8 249 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q0P9X7 7.04e-27 108 32 5 227 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q3J1N0 7.19e-27 111 30 3 237 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q4FTM3 7.45e-27 108 30 4 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QCN2 7.69e-27 108 30 4 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6N798 7.8e-27 112 32 7 244 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q65P77 8.02e-27 109 32 8 245 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q97KD5 8.07e-27 110 30 6 244 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9A502 8.17e-27 110 29 5 278 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q65M34 8.75e-27 110 30 6 238 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q13LD8 8.83e-27 112 31 7 252 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
O31339 9.37e-27 111 30 6 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1M8E0 9.41e-27 111 33 6 252 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8F6Z1 1.05e-26 111 28 6 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.05e-26 111 28 6 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9MUN1 1.06e-26 110 29 6 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q7W9U5 1.07e-26 110 27 4 259 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8E8K8 1.15e-26 110 28 4 253 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9V1Q4 1.19e-26 109 29 6 245 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q8R7Y5 1.21e-26 109 30 8 261 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7VZE5 1.3e-26 110 27 6 260 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A0LUE6 1.31e-26 111 26 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q81GU1 1.42e-26 110 30 6 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P57383 1.95e-26 107 35 4 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q98DA2 1.96e-26 110 34 5 246 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9CIS9 2.18e-26 108 29 8 257 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
Q24QI5 2.33e-26 109 27 4 273 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q8NVB5 2.35e-26 108 32 6 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MW2)
Q6G799 2.35e-26 108 32 6 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MSSA476)
Q8DWR3 3.03e-26 108 32 9 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 3.03e-26 108 32 9 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 3.03e-26 108 32 9 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P0A9U0 4.16e-26 106 32 5 233 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 4.16e-26 106 32 5 233 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 4.16e-26 106 32 5 233 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q6HPN0 4.57e-26 107 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 4.57e-26 107 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 4.57e-26 107 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q73L25 4.79e-26 106 31 5 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73F67 5.01e-26 107 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7A470 5.04e-26 107 31 6 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain N315)
Q99S47 5.04e-26 107 31 6 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2K284 5.07e-26 109 33 6 257 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8GEH7 5.5e-26 108 34 6 224 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q0A8P9 5.6e-26 106 33 6 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
P45092 5.84e-26 106 31 10 244 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q50801 7.19e-26 107 32 8 233 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q52666 7.29e-26 107 29 8 241 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q1BR30 7.66e-26 109 29 9 301 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 7.66e-26 109 29 9 301 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q58488 7.72e-26 107 33 8 233 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8CRB0 8.38e-26 105 33 7 229 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P39459 8.43e-26 106 31 6 244 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q9L1C3 9.33e-26 108 29 8 259 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6GEL3 9.73e-26 106 31 6 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q8FVN0 1.04e-25 106 32 6 231 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q18C09 1.07e-25 107 30 6 246 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q5HLN4 1.19e-25 105 33 7 229 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YYM4 1.21e-25 106 31 6 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P73265 1.41e-25 106 32 5 223 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q39AT4 1.48e-25 108 31 6 244 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9K876 1.53e-25 107 29 6 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8YCN7 1.7e-25 105 32 6 231 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 1.7e-25 105 32 6 231 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 1.7e-25 105 32 6 231 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
O31711 1.71e-25 105 32 7 224 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q88RB3 1.84e-25 107 30 8 256 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5YRD1 1.86e-25 107 29 5 239 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q9EYM2 1.97e-25 104 31 4 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9YG51 2e-25 105 30 7 249 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8XNY7 2.05e-25 106 33 8 242 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q2NHA1 2.09e-25 105 32 11 247 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
P63368 2.3e-25 105 30 10 253 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63367 2.3e-25 105 30 10 253 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype III (strain NEM316)
Q3K199 2.3e-25 105 30 10 253 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q63H62 2.67e-25 105 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
P77795 2.8e-25 107 28 5 256 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q3Z300 3.07e-25 104 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 3.07e-25 104 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 3.07e-25 104 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 3.07e-25 104 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q03EE4 3.38e-25 105 31 8 235 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q32EX7 3.77e-25 104 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q1IGN4 3.96e-25 107 30 8 256 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q44613 4.03e-25 103 31 3 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O59479 4.13e-25 105 28 7 253 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8U242 4.15e-25 104 31 5 225 3 pstB Phosphate import ATP-binding protein PstB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q21TG3 4.45e-25 103 33 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P46920 4.67e-25 107 31 4 231 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
P75957 4.69e-25 103 34 4 228 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q93DX8 4.95e-25 104 28 5 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q7UX73 4.95e-25 103 33 5 213 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q67JX3 6.18e-25 105 33 10 252 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q81J16 6.31e-25 104 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9RR46 6.4e-25 107 30 4 241 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q1QVQ7 6.49e-25 105 30 7 245 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q97ZT9 6.73e-25 103 30 8 244 3 pstB Phosphate import ATP-binding protein PstB Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q7NTU0 6.77e-25 103 31 5 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P9WQL3 6.94e-25 106 30 3 220 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 6.94e-25 106 30 3 220 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5YZY9 7.24e-25 105 27 6 261 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q3SJQ8 8.02e-25 103 30 9 247 3 pstB Phosphate import ATP-binding protein PstB Thiobacillus denitrificans (strain ATCC 25259)
Q9KIF7 8.57e-25 106 29 5 241 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q82JY6 8.61e-25 105 30 9 291 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q74AT2 8.84e-25 102 33 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q3IL62 9.07e-25 103 35 5 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q83LR7 9.42e-25 108 34 6 218 3 macB Macrolide export ATP-binding/permease protein MacB Shigella flexneri
Q080S4 9.64e-25 103 32 8 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella frigidimarina (strain NCIMB 400)
Q58206 1.09e-24 103 30 6 228 1 MJ0796 Uncharacterized ABC transporter ATP-binding protein MJ0796 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q88HL0 1.09e-24 103 31 6 238 3 nikE Nickel import ATP-binding protein NikE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8X8E3 1.14e-24 102 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q6D201 1.16e-24 105 27 7 259 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1BHS6 1.17e-24 103 31 6 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q12NL5 1.21e-24 102 32 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q39EV3 1.38e-24 103 31 6 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1WSB8 1.38e-24 103 30 7 245 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q6GE75 1.43e-24 102 30 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
P9WQI3 1.47e-24 105 30 7 246 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 1.47e-24 105 30 7 246 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6GH28 1.49e-24 102 28 4 235 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q9X196 1.56e-24 105 29 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9PDN2 1.6e-24 105 26 2 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
A0KMJ3 1.74e-24 107 32 7 231 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_05280
Feature type CDS
Gene oppD
Product ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
Location 60751 - 61725 (strand: -1)
Length 975 (nucleotides) / 324 (amino acids)
In genomic island -

Contig

Accession contig_5
Length 181448 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1029
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08352 Oligopeptide/dipeptide transporter, C-terminal region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0444 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15583 oligopeptide transport system ATP-binding protein beta-Lactam resistance
ABC transporters
Quorum sensing
-

Protein Sequence

MTQLLQVNDLNVTFKTPDGDVTAVNKLNFSLAAGETLGIVGESGSGKSQTAFALMGLLARNGVVSGSAVFNGREILNLKEKALNKMRAEEISMIFQDPMTSLNPYMKVSKQLTEVLMLHKGLSSHDAFEESVRMLDAVKMPEARKRMNMYPHEFSGGMRQRVMIAMALLCKPKLLIADEPTTALDVTVQAQIMTLLNELKNEFNTAIIMITHDLGVVAGICDKVLVMYAGRTMEYGTARDVFYHPSHPYSIGLLKAVPRLDGQEDSELATIPGNPPNLLRLPAGCPFRPRCQYATDECARHEPPLQAFSQGRLRACFRTAEELA

Flanking regions ( +/- flanking 50bp)

GACGGGCTGCGTGATGCCCTTGACCCGAAAGATCGCTGAGGAGGCCGCCAATGACTCAGTTATTACAGGTTAACGACCTGAACGTGACATTCAAAACGCCGGACGGCGATGTCACCGCCGTAAACAAACTTAATTTTTCGCTGGCGGCGGGTGAGACACTCGGGATTGTCGGTGAATCCGGCTCCGGGAAATCACAGACGGCGTTTGCGCTGATGGGACTGCTGGCCCGCAATGGTGTGGTCAGCGGCTCTGCGGTGTTCAACGGGCGTGAAATTCTCAATCTGAAAGAAAAAGCGCTGAACAAAATGCGGGCGGAAGAGATTTCCATGATCTTCCAGGATCCGATGACCTCGCTCAATCCGTACATGAAAGTCAGCAAACAGCTGACGGAAGTGCTGATGCTGCATAAAGGTCTGAGTTCTCACGATGCGTTTGAGGAATCAGTCCGGATGCTGGACGCGGTGAAAATGCCTGAAGCCCGCAAGCGGATGAATATGTATCCTCACGAGTTCTCCGGCGGGATGCGCCAGCGCGTTATGATTGCGATGGCGCTGCTGTGCAAGCCAAAACTGCTGATCGCCGATGAACCGACCACAGCGCTGGATGTGACGGTGCAGGCGCAAATCATGACGCTGCTCAATGAGCTGAAGAATGAGTTCAATACGGCGATTATTATGATCACCCATGACCTGGGTGTGGTCGCCGGTATCTGCGATAAGGTGTTGGTGATGTATGCCGGACGTACCATGGAATACGGCACGGCCCGTGATGTGTTCTACCATCCGTCGCATCCGTACTCTATCGGGCTGCTTAAAGCGGTTCCGCGCCTTGACGGGCAGGAAGACAGTGAGCTCGCCACGATACCCGGCAACCCGCCGAACCTCCTGCGTCTCCCGGCAGGCTGTCCGTTCCGCCCGCGCTGCCAGTATGCGACAGACGAGTGTGCGCGGCATGAGCCGCCGTTACAGGCATTTTCTCAGGGCCGTTTGCGTGCCTGCTTCAGAACTGCAGAGGAGTTGGCATAATGACACATTCAGAACGTCCGGTTCTGCTGGAAATTGAAGATTTAAAAGTC