Homologs in group_1029

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05280 FBDBKF_05280 93.5 Morganella morganii S1 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
EHELCC_12310 EHELCC_12310 93.5 Morganella morganii S2 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
NLDBIP_12650 NLDBIP_12650 93.5 Morganella morganii S4 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
LHKJJB_12510 LHKJJB_12510 93.5 Morganella morganii S3 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
HKOGLL_11125 HKOGLL_11125 93.5 Morganella morganii S5 oppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
PMI_RS07125 PMI_RS07125 86.1 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1029

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1029

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P04285 0.0 548 83 2 320 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P76027 0.0 544 83 2 320 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
P45052 0.0 507 76 2 323 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P24136 3.04e-111 330 53 1 307 1 oppD Oligopeptide transport ATP-binding protein OppD Bacillus subtilis (strain 168)
A2RI77 3.29e-109 324 51 3 304 1 dppD Dipeptide transport ATP-binding protein DppD Lactococcus lactis subsp. cremoris (strain MG1363)
P42064 1.69e-104 311 47 2 326 3 appD Oligopeptide transport ATP-binding protein AppD Bacillus subtilis (strain 168)
P26905 2.85e-104 311 50 3 307 3 dppD Dipeptide transport ATP-binding protein DppD Bacillus subtilis (strain 168)
Q8YBN6 2.79e-102 306 46 5 330 3 BMEII0863 Putative peptide import ATP-binding protein BMEII0863 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU87 6.24e-102 305 46 5 330 3 BOV_A0348 Putative peptide import ATP-binding protein BOV_A0348 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FWP1 1.09e-101 305 46 5 330 3 BRA0405 Putative peptide import ATP-binding protein BRA0405/BS1330_II0402 Brucella suis biovar 1 (strain 1330)
Q2YK63 4.15e-101 303 45 5 330 3 BAB2_0817 Putative peptide import ATP-binding protein BAB2_0817 Brucella abortus (strain 2308)
Q577J5 4.15e-101 303 45 5 330 3 BruAb2_0796 Putative peptide import ATP-binding protein BruAb2_0796 Brucella abortus biovar 1 (strain 9-941)
Q53193 4.57e-99 298 46 1 320 3 NGR_a01410 Probable peptide ABC transporter ATP-binding protein y4tR Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8FUW8 1.07e-97 294 47 3 314 3 BRA1094 Putative peptide import ATP-binding protein BRA1094/BS1330_II1086 Brucella suis biovar 1 (strain 1330)
Q2YJJ9 1.07e-97 294 47 3 314 3 BAB2_1052 Putative peptide import ATP-binding protein BAB2_1052 Brucella abortus (strain 2308)
Q8VQK6 1.07e-97 294 47 3 314 3 BruAb2_1033 Putative peptide import ATP-binding protein BruAb2_1033 Brucella abortus biovar 1 (strain 9-941)
P0AAG2 2.51e-97 293 45 2 320 3 dppD Dipeptide transport ATP-binding protein DppD Shigella flexneri
P0AAG0 2.51e-97 293 45 2 320 1 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli (strain K12)
P0AAG1 2.51e-97 293 45 2 320 3 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli O157:H7
Q8YDH0 3.12e-97 293 46 3 314 3 BMEII0206 Putative peptide import ATP-binding protein BMEII0206 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P45095 4.09e-94 285 45 2 312 3 dppD Dipeptide transport ATP-binding protein DppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZGN6 6.61e-94 285 48 5 318 1 dppD Di/tripeptide transport ATP-binding protein DppD Pseudomonas aeruginosa (strain UCBPP-PA14)
P77268 2.87e-92 280 44 5 329 2 ddpD Probable D,D-dipeptide transport ATP-binding protein DdpD Escherichia coli (strain K12)
P0A2U9 5.23e-90 276 45 3 303 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U8 5.23e-90 276 45 3 303 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P63396 7.53e-90 283 45 3 321 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 2.62e-45 166 39 4 251 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 7.53e-90 283 45 3 321 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 2.62e-45 166 39 4 251 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 7.53e-90 283 45 3 321 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 2.62e-45 166 39 4 251 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q323W5 1.26e-85 273 47 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 5.1e-56 194 43 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q3Z3V4 2.37e-85 272 52 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 3.9e-56 195 43 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
A1A967 2.81e-85 271 47 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 2.97e-55 192 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
Q0TJM0 2.84e-85 271 47 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 2.79e-55 192 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RE96 2.96e-85 271 47 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 5.3e-55 192 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q8FJL0 3.44e-85 271 47 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 4.22e-55 192 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32IB5 6.05e-85 271 52 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 2.09e-56 196 43 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
P75796 6.88e-85 271 52 3 264 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 4.02e-56 195 43 5 263 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q8X6W1 9.37e-85 270 52 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 1.31e-55 194 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q83LT3 6.52e-84 268 47 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 5.08e-55 192 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q8ZQM4 2.42e-83 266 50 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 2.86e-54 190 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0T6D3 2.75e-83 266 46 5 310 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 5.19e-55 192 42 5 263 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q5PGP3 3.55e-83 266 50 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 2.21e-54 190 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z864 4.44e-83 266 50 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 2.92e-54 190 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q57RB2 4.67e-82 263 50 3 264 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 3.48e-54 190 43 7 267 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q6D3A9 3.88e-81 261 49 3 265 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 5.5e-59 202 43 5 266 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9CKL2 1.83e-75 244 48 1 262 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 1.31e-46 168 37 6 270 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
P50980 6.95e-74 234 39 4 323 3 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. cremoris (strain SK11)
Q07733 9.2e-74 233 39 4 323 1 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. lactis (strain IL1403)
P33916 2.91e-72 235 47 2 264 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 4.95e-53 185 42 6 260 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
A0A0H2ZH52 3.01e-72 229 40 6 323 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
P77737 3.58e-71 227 39 8 331 1 oppF Oligopeptide transport ATP-binding protein OppF Escherichia coli (strain K12)
P45051 4.28e-71 226 39 6 330 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P08007 5.28e-71 226 40 9 332 1 oppF Oligopeptide transport ATP-binding protein OppF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8RDH4 1.97e-69 222 39 5 306 1 dppD Dipeptide transport ATP-binding protein DppD Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8YBN5 2.91e-68 219 35 3 317 3 BMEII0864 Putative peptide import ATP-binding protein BMEII0864 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP2 2.91e-68 219 35 3 317 3 BRA0404 Putative peptide import ATP-binding protein BRA0404/BS1330_II0401 Brucella suis biovar 1 (strain 1330)
Q2YK62 2.91e-68 219 35 3 317 3 BAB2_0818 Putative peptide import ATP-binding protein BAB2_0818 Brucella abortus (strain 2308)
Q577J4 2.91e-68 219 35 3 317 3 BruAb2_0797 Putative peptide import ATP-binding protein BruAb2_0797 Brucella abortus biovar 1 (strain 9-941)
A5VU86 2.91e-68 219 35 3 317 3 BOV_A0347 Putative peptide import ATP-binding protein BOV_A0347 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P36636 7.72e-68 218 38 5 321 2 sapD Peptide transport system ATP-binding protein SapD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42065 1.96e-67 217 40 4 306 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
P37313 2.1e-67 217 38 5 320 1 dppF Dipeptide transport ATP-binding protein DppF Escherichia coli (strain K12)
P47325 4.86e-67 218 34 3 340 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q53194 2.61e-66 215 42 4 304 3 NGR_a01400 Probable peptide ABC transporter ATP-binding protein y4tS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P75552 2.83e-66 217 34 6 342 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P45094 1.03e-65 213 38 4 297 3 dppF Dipeptide transport ATP-binding protein DppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AAH7 1.99e-65 212 37 5 321 3 sapD Peptide transport system ATP-binding protein SapD Shigella flexneri
P0AAH4 1.99e-65 212 37 5 321 1 sapD Putrescine export system ATP-binding protein SapD Escherichia coli (strain K12)
P0AAH5 1.99e-65 212 37 5 321 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAH6 1.99e-65 212 37 5 321 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O157:H7
Q2YJJ8 7.95e-63 205 38 6 313 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 7.95e-63 205 38 6 313 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
C0SP98 2.95e-62 204 39 9 323 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
Q8YDH1 8.23e-62 204 38 6 313 3 BMEII0205 Putative peptide import ATP-binding protein BMEII0205 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P24137 1.48e-60 198 41 3 257 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
P72479 6.58e-60 197 41 5 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A2RI78 7.28e-59 194 39 6 261 1 dppF Dipeptide transport ATP-binding protein DppF Lactococcus lactis subsp. cremoris (strain MG1363)
P45288 2.63e-57 191 33 3 306 3 sapD Peptide transport system ATP-binding protein SapD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2FVF0 6.64e-57 188 37 1 258 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JXA3 1.91e-56 187 37 1 258 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0A2V5 5.03e-56 187 37 7 272 3 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. cremoris (strain SK11)
P0A2V4 5.03e-56 187 37 7 272 1 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. lactis (strain IL1403)
P18766 5.18e-56 187 38 3 257 3 amiF Oligopeptide transport ATP-binding protein AmiF Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P77622 1.09e-54 183 35 8 327 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q8P2L5 3.3e-54 182 38 4 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0CZ33 7.3e-54 181 38 4 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XDU4 7.3e-54 181 38 4 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ32 7.3e-54 181 38 4 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0A2V6 7.3e-54 181 38 4 261 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M1
Q13VD7 4.33e-42 152 37 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q2RS21 1.9e-40 145 35 3 243 3 nikD Nickel import ATP-binding protein NikD Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q832Y6 1.22e-39 145 32 6 267 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q1BY14 1.54e-38 142 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 1.54e-38 142 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
P0AAI0 1.77e-38 140 34 7 252 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 1.77e-38 140 34 7 252 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 1.77e-38 140 34 7 252 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0BH79 4.27e-38 141 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
P16678 5.17e-38 138 35 2 233 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q32AQ2 6.19e-38 138 34 4 264 3 nikD Nickel import ATP-binding protein NikD Shigella dysenteriae serotype 1 (strain Sd197)
Q3KK97 6.87e-38 140 31 8 292 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q39IE7 8.08e-38 140 35 6 256 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3A9G5 1.53e-37 139 31 7 302 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q83J78 1.55e-37 137 34 4 264 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri
P36638 1.87e-37 137 34 6 252 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0SZJ4 2.07e-37 137 36 3 241 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri serotype 5b (strain 8401)
P33593 2.81e-37 137 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain K12)
Q3YW49 2.9e-37 136 36 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella sonnei (strain Ss046)
Q8X5U1 2.9e-37 136 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O157:H7
Q1R5D9 2.93e-37 136 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain UTI89 / UPEC)
Q0TBX9 2.93e-37 136 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q63S19 3.05e-37 139 35 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 3.05e-37 139 35 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 3.05e-37 139 35 7 257 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q31VE7 3.06e-37 136 36 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella boydii serotype 4 (strain Sb227)
Q0KDG3 3.42e-37 139 36 6 249 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8FCN0 4.43e-37 136 36 3 241 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2SY12 6.9e-37 138 34 7 257 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q12B04 9.18e-37 138 35 10 287 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q1LQF6 1.13e-36 137 35 6 256 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q04F14 1.66e-36 137 34 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q0BMC9 1.98e-36 137 32 8 274 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.98e-36 137 32 8 274 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q46Y69 2.57e-36 136 34 7 276 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q73EL7 2.88e-36 136 34 7 280 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q14H97 6.48e-36 135 32 8 274 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q5NFU5 6.55e-36 135 32 8 274 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
P55662 1.06e-35 132 35 7 257 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q63GR8 1.12e-35 134 33 7 280 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q5WKL3 1.77e-35 134 33 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q73F11 1.9e-35 134 32 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4KKK8 2.5e-35 134 30 6 272 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q81IN8 2.86e-35 134 34 7 270 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6G2E2 3.3e-35 134 33 7 260 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q81ZF5 3.49e-35 133 33 7 280 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q6HP89 3.64e-35 133 33 7 280 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6NJ07 6.12e-35 132 33 4 243 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q49W48 6.45e-35 132 36 6 242 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5PCG9 6.59e-35 132 33 7 265 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8CQS7 7.08e-35 132 34 7 244 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 7.08e-35 132 34 7 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8Z8R5 7.87e-35 132 33 7 265 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8ZR89 8.12e-35 132 33 7 265 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HT70 9.02e-35 132 30 8 293 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 9.02e-35 132 30 8 293 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7VV72 1.09e-34 132 32 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 1.09e-34 132 32 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 1.09e-34 132 32 8 290 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q65F80 1.17e-34 132 35 8 247 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q57S53 1.52e-34 132 33 7 265 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
P75551 2.36e-34 136 46 1 126 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75551 1.66e-09 62 31 2 121 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q38WL5 2.54e-34 131 33 5 245 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
P47326 2.74e-34 136 46 1 126 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47326 1.77e-09 62 33 2 121 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8EPK1 3.04e-34 131 31 4 261 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q81VM2 3.09e-34 131 32 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q5XDS8 3.32e-34 131 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q4JTG9 3.4e-34 131 34 5 240 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q48V78 4.77e-34 130 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 4.77e-34 130 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q1IGZ0 5.08e-34 130 29 5 271 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q7A7E3 5.16e-34 130 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 5.16e-34 130 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5FKL2 5.47e-34 130 34 9 268 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q134N9 5.61e-34 131 34 8 261 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q8NSN2 6.65e-34 130 37 6 226 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q21BU8 6.98e-34 130 33 7 260 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q1JNE0 7.45e-34 130 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 7.45e-34 130 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q0SFW6 1.16e-33 129 32 6 259 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q63H29 1.2e-33 129 32 5 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q03P57 1.28e-33 129 35 7 247 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6D3Q6 1.28e-33 129 33 8 252 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0CZ31 1.4e-33 129 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 1.4e-33 129 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q4L4R9 1.49e-33 129 35 6 242 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q5WDP1 1.6e-33 129 32 5 266 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q9ZJ34 1.69e-33 129 32 5 242 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q6N9W0 1.81e-33 129 33 6 259 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1JII9 2.03e-33 129 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P2K6 2.08e-33 129 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q1J8E4 2.12e-33 129 31 12 312 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5KVK2 2.18e-33 129 31 3 266 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q88WA5 2.32e-33 129 33 6 254 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8FRX8 2.45e-33 129 35 6 231 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5HIL5 2.74e-33 128 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 2.74e-33 128 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 2.74e-33 128 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q87AL9 2.85e-33 128 32 4 258 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q6F9P2 3.01e-33 128 32 6 254 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8NY21 3.63e-33 128 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 3.63e-33 128 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q1CR30 3.79e-33 127 34 7 242 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q8Z990 4.1e-33 128 32 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
O32169 4.61e-33 128 33 3 242 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q6GJL2 5.06e-33 127 31 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q9PF03 5.78e-33 127 32 4 258 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q32AQ1 6.02e-33 125 33 4 242 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q4QMH4 6.19e-33 127 33 6 244 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q88HL1 6.4e-33 125 33 2 233 3 nikD Nickel import ATP-binding protein NikD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q31VE6 6.62e-33 125 35 3 217 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q48PU6 6.74e-33 127 30 5 262 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5PID0 6.74e-33 127 32 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3YW48 7.66e-33 125 35 3 217 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
P30750 7.88e-33 127 31 6 278 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q8Y0X3 8.12e-33 127 33 8 271 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P33594 8.42e-33 125 35 3 211 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q32JQ8 1.05e-32 127 31 5 264 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q1R5D8 1.06e-32 125 33 4 242 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 1.06e-32 125 33 4 242 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 1.06e-32 125 33 4 242 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TLD2 1.06e-32 127 31 6 278 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z5F8 1.16e-32 127 31 6 278 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 1.16e-32 127 31 6 278 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 1.16e-32 127 31 6 278 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 1.16e-32 127 31 6 278 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
O26096 1.24e-32 126 34 7 242 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q88RL5 1.28e-32 126 29 6 271 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8YCN8 1.3e-32 124 34 2 241 3 nikD Nickel import ATP-binding protein NikD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S8 1.3e-32 124 34 2 241 3 nikD Nickel import ATP-binding protein NikD Brucella abortus biovar 1 (strain 9-941)
Q2YL70 1.3e-32 124 34 2 241 3 nikD Nickel import ATP-binding protein NikD Brucella abortus (strain 2308)
Q667L9 1.53e-32 126 30 6 264 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9K789 1.54e-32 126 32 7 265 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q03A07 1.64e-32 126 34 9 285 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8X4L6 1.73e-32 124 33 4 236 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q81IZ6 1.81e-32 126 32 6 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2YVT7 1.92e-32 126 30 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2KVK2 2.17e-32 126 31 9 291 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q6D1C4 2.22e-32 126 30 7 283 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q325U1 2.29e-32 126 31 6 278 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q8CTB2 2.32e-32 126 33 5 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P44785 2.38e-32 126 33 6 244 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1WVG9 2.79e-32 126 34 9 256 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q8ZRM9 3.15e-32 125 31 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FVM9 3.24e-32 124 34 2 241 2 nikD Nickel import ATP-binding protein NikD Brucella suis biovar 1 (strain 1330)
Q83MC5 3.32e-32 125 31 6 278 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 3.32e-32 125 31 6 278 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q5HQQ9 3.58e-32 125 33 5 244 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q57T09 4.39e-32 125 31 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q7VI92 4.5e-32 125 31 5 256 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8ELQ6 4.99e-32 125 32 7 265 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8YA75 5.44e-32 125 34 8 266 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6FAN3 6.25e-32 125 32 4 248 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4ZZR8 6.45e-32 124 29 5 262 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q6LN52 6.97e-32 124 31 6 264 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q04DA7 8.21e-32 125 30 6 263 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q17VE0 8.89e-32 124 33 7 238 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q8FV85 9.86e-32 125 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 9.86e-32 125 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 9.86e-32 125 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 9.86e-32 125 32 6 252 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q724C0 1e-31 124 34 8 266 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q87RS1 1.02e-31 124 29 4 264 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q043Y8 1.05e-31 124 34 9 250 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q87UN4 1.13e-31 124 29 5 262 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6GIH9 1.14e-31 124 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q07LR5 1.14e-31 124 33 8 266 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q21XK2 1.15e-31 124 32 7 256 3 metN Methionine import ATP-binding protein MetN Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5E715 1.18e-31 124 30 6 264 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2RWA3 1.29e-31 124 32 6 257 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q92EZ6 1.39e-31 124 34 8 266 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8ENU2 1.41e-31 124 31 5 274 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q1CFH7 1.56e-31 124 30 6 264 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 1.56e-31 124 30 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 1.56e-31 124 30 6 264 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q8E3S0 1.58e-31 124 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q8DRF9 1.82e-31 124 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q83J77 1.92e-31 122 34 3 217 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q2YWP2 2.07e-31 123 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8DY54 2.11e-31 124 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 2.11e-31 124 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8ELA5 2.12e-31 123 30 6 264 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q03Z27 2.29e-31 124 30 6 271 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q0SZJ3 2.37e-31 121 34 3 217 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q65VG9 3.17e-31 123 30 8 274 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5WJP0 5.14e-31 122 32 7 269 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q8NXH5 5.76e-31 122 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 5.76e-31 122 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 5.76e-31 122 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 5.76e-31 122 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 5.76e-31 122 31 5 255 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q7A6M2 6.58e-31 122 30 5 255 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 6.58e-31 122 30 5 255 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q88UV2 6.76e-31 122 34 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9KTJ5 7.1e-31 122 31 6 264 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5M1F6 8.65e-31 122 30 8 278 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q2NRN5 1.1e-30 121 31 6 261 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q895C4 1.17e-30 120 31 6 244 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q8G5P8 1.22e-30 122 36 7 229 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q6A6X6 1.5e-30 121 31 7 266 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5M5Z2 1.7e-30 121 30 7 276 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q4KK46 1.72e-30 121 33 5 245 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7CHF8 1.87e-30 120 33 7 234 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 1.87e-30 120 33 7 234 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 1.87e-30 120 33 7 234 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 1.87e-30 120 33 7 234 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q97T09 2.36e-30 120 31 7 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04B25 3.23e-30 120 34 8 248 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAN9 3.61e-30 120 34 8 248 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q7N8M2 3.66e-30 120 29 6 291 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D5H7 3.72e-30 120 31 7 264 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8RFN2 4.92e-30 119 33 7 248 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7MN25 8.38e-30 119 29 5 264 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q631Y4 9.08e-30 119 30 6 291 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q8PGE8 9.31e-30 119 29 5 264 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q8DFC3 9.58e-30 119 29 5 264 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q81XL3 1.01e-29 119 30 6 291 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q72Y96 1.02e-29 119 30 6 291 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q815Y7 1.12e-29 119 30 6 291 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q83F44 1.16e-29 119 29 5 244 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q93DA2 1.4e-29 119 30 9 283 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q6GH27 1.6e-29 116 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MRSA252)
Q6HBS0 1.72e-29 118 30 6 291 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q74IV9 2.16e-29 118 32 8 249 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q831K6 2.24e-29 118 31 3 242 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q3BNZ3 3.16e-29 117 29 5 264 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q02ME3 3.73e-29 118 31 6 241 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7A5Q8 4.09e-29 115 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain N315)
Q99UA2 4.09e-29 115 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q0AU85 4.22e-29 117 30 7 256 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8P4S7 4.63e-29 117 29 5 264 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 4.63e-29 117 29 5 264 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q2P7S3 4.82e-29 117 30 6 264 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q48PN3 4.9e-29 117 31 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7VM95 6.06e-29 117 30 4 242 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6AE21 7.46e-29 116 31 6 247 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q1B677 7.93e-29 116 33 8 257 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q4L8L7 7.94e-29 113 32 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q6G9I0 9.31e-29 114 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MSSA476)
Q5HG40 9.31e-29 114 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain COL)
Q2FYQ7 9.31e-29 114 32 3 224 1 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH57 9.31e-29 114 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain USA300)
Q3JHC9 9.38e-29 117 31 10 297 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
A1VZQ5 1.02e-28 114 31 6 242 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q8NWT5 1.18e-28 114 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MW2)
Q0P9X7 1.2e-28 114 31 6 242 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5H503 1.29e-28 115 30 6 264 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q87UV4 1.41e-28 116 31 5 248 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZZK0 1.59e-28 116 30 5 248 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q2YXY9 1.74e-28 114 32 3 224 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q0I5E9 1.77e-28 115 30 5 244 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q0SFY5 1.79e-28 115 28 7 283 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q9CIN4 1.89e-28 116 31 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q62B84 1.94e-28 116 31 10 297 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q67SV5 2.06e-28 115 31 7 244 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3KJS6 2.49e-28 115 31 6 248 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q63NI4 2.53e-28 116 31 10 297 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q2FVF1 2.91e-28 112 29 3 235 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q0B6I6 3.53e-28 115 31 9 298 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9I1C8 3.54e-28 115 31 6 241 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q65M34 4.86e-28 114 30 6 246 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O34979 6.86e-28 111 34 7 227 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
D8KFN1 7.09e-28 114 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 7.09e-28 114 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q47YG8 7.22e-28 112 34 6 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P27675 8.29e-28 111 31 5 227 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q9CK97 8.3e-28 114 28 7 295 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q032A0 9.52e-28 114 30 6 256 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
P56344 1.03e-27 111 27 4 236 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q032H4 1.04e-27 112 30 9 257 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 1.04e-27 112 30 9 257 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
Q6LX68 1.1e-27 112 33 9 239 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q39T41 1.14e-27 110 32 7 243 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A0A0H3JT74 1.15e-27 111 32 4 211 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5WVL8 1.28e-27 113 31 6 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q9G4F5 1.39e-27 113 27 4 258 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q5ZUG5 1.58e-27 113 31 6 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8R7Y5 2.07e-27 111 30 8 265 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P57383 2.24e-27 110 35 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q1DDP4 2.27e-27 112 33 6 227 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q82WT5 2.4e-27 113 28 5 259 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q53I83 2.44e-27 112 29 8 273 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q18C09 2.56e-27 112 29 7 265 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q8Y4L8 2.61e-27 112 30 4 253 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7WGW1 2.67e-27 112 27 4 258 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1M8E0 3.06e-27 112 35 5 227 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9CIS9 3.24e-27 110 29 8 257 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
Q6N798 3.28e-27 112 32 6 244 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q98DA2 3.61e-27 112 34 5 246 3 metN Methionine import ATP-binding protein MetN Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9S4Z0 3.87e-27 111 32 7 244 3 metN Methionine import ATP-binding protein MetN Salmonella enteritidis
P45289 4.1e-27 110 31 4 247 3 sapF Peptide transport system ATP-binding protein SapF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2RS22 4.51e-27 110 32 8 242 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5X484 4.51e-27 112 31 6 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q7W9U5 4.63e-27 112 27 4 258 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q97IE0 4.66e-27 109 30 9 248 3 pstB Phosphate import ATP-binding protein PstB Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0LUE6 5.5e-27 112 27 4 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q928L8 5.67e-27 111 30 3 252 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7VZE5 5.9e-27 111 27 4 258 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q3J1N0 6.24e-27 111 30 4 239 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1BR30 6.77e-27 112 30 9 298 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 6.77e-27 112 30 9 298 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q65P77 6.8e-27 110 31 8 252 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9V1Q4 7.09e-27 110 30 6 234 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q2K284 7.13e-27 111 34 5 239 3 metN Methionine import ATP-binding protein MetN Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q89LP2 7.13e-27 111 30 6 239 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O06980 7.66e-27 109 30 7 249 3 yvcR Uncharacterized ABC transporter ATP-binding protein YvcR Bacillus subtilis (strain 168)
P45092 9.23e-27 108 31 10 244 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q39AT4 9.44e-27 112 30 9 298 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q827Y0 1e-26 110 30 8 249 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q4FTM3 1.25e-26 108 30 4 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P39459 1.27e-26 108 31 6 244 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q71X09 1.37e-26 110 30 4 253 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q2NHA1 1.55e-26 108 33 10 245 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q4FL37 1.63e-26 110 29 6 260 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q24QI5 1.72e-26 110 28 4 273 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
P77795 1.91e-26 110 30 5 244 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q9MUN1 2.09e-26 110 29 5 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q1QCN2 2.24e-26 107 30 4 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q52666 2.55e-26 108 30 8 241 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8E8K8 2.59e-26 110 28 4 253 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8XNY7 2.61e-26 108 32 7 244 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q5YRD1 3.51e-26 109 29 5 239 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q1QVQ7 3.94e-26 109 33 8 247 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q13LD8 3.95e-26 110 32 8 249 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q92LX3 4.13e-26 109 32 6 246 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q1IGN4 4.98e-26 109 31 6 235 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q58488 5.06e-26 107 33 10 240 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q97KD5 5.55e-26 108 31 5 219 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q0A8P9 5.89e-26 106 33 7 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0SWH9 6.24e-26 107 32 7 244 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q44613 6.37e-26 106 31 3 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q6GE75 7.37e-26 105 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
A0KMJ3 7.52e-26 111 32 8 245 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9X196 8.64e-26 108 30 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P74548 9.5e-26 108 28 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q50801 9.67e-26 107 31 8 236 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q03EE4 1.01e-25 107 31 8 244 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
O31711 1.01e-25 105 32 7 224 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q080S4 1.07e-25 105 32 8 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella frigidimarina (strain NCIMB 400)
P73265 1.09e-25 106 32 5 223 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q83LR7 1.18e-25 110 34 6 218 3 macB Macrolide export ATP-binding/permease protein MacB Shigella flexneri
Q9KIF7 1.19e-25 108 29 5 241 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q88RB3 1.32e-25 108 31 6 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1BHS6 1.4e-25 105 32 6 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia orbicola (strain AU 1054)
Q03AH0 1.53e-25 108 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
O67154 1.62e-25 105 30 7 246 3 pstB Phosphate import ATP-binding protein PstB Aquifex aeolicus (strain VF5)
Q9L1C3 1.66e-25 107 28 8 273 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9EYM2 1.67e-25 105 31 4 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7NZI7 1.73e-25 105 31 9 247 3 pstB Phosphate import ATP-binding protein PstB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q39EV3 1.74e-25 105 32 6 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7A3X3 1.82e-25 104 32 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 1.82e-25 104 32 6 230 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9YG51 1.97e-25 105 32 9 250 3 pstB Phosphate import ATP-binding protein PstB Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8GEH7 1.98e-25 107 33 8 248 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q67JX3 2.11e-25 106 34 9 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q0TUN8 2.47e-25 105 32 7 244 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q73L25 2.48e-25 104 31 5 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8FVN0 2.56e-25 105 33 5 237 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q32EX7 2.68e-25 104 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q7UX73 2.92e-25 104 33 5 213 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q89UD2 3.09e-25 107 28 4 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7NTU0 3.31e-25 104 31 5 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q82JY6 3.44e-25 106 30 8 290 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q21TG3 3.5e-25 104 32 6 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2YZ26 3.64e-25 103 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6HPN0 3.66e-25 105 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 3.66e-25 105 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 3.66e-25 105 31 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
O59479 3.76e-25 105 28 7 253 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P63368 3.81e-25 104 31 10 253 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63367 3.81e-25 104 31 10 253 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype III (strain NEM316)
Q3K199 3.81e-25 104 31 10 253 3 pstB1 Phosphate import ATP-binding protein PstB 1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1CGD7 4e-25 109 31 7 233 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q66CL2 4e-25 109 31 7 233 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7CHI2 4e-25 109 31 7 233 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis
Q1CA99 4e-25 109 31 7 233 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q5QU46 4.01e-25 103 33 5 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3J7S3 4.18e-25 103 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q73F67 4.68e-25 105 30 7 244 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8YCN7 4.99e-25 104 33 5 237 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 4.99e-25 104 33 5 237 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 4.99e-25 104 33 5 237 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q8XED0 5.56e-25 108 34 6 222 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O157:H7
Q8UKE4 5.61e-25 108 32 10 267 3 macB Macrolide export ATP-binding/permease protein MacB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q74DN5 5.74e-25 104 32 8 242 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8NV47 6.56e-25 103 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 6.56e-25 103 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 6.56e-25 103 31 6 230 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 6.56e-25 103 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 6.56e-25 103 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 6.56e-25 103 31 6 230 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q8DWR3 6.85e-25 104 32 9 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 6.85e-25 104 32 9 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 6.85e-25 104 32 9 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3IL62 7.14e-25 103 34 5 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
P0A9U0 7.16e-25 103 31 5 233 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 7.16e-25 103 31 5 233 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 7.16e-25 103 31 5 233 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q3Z300 7.22e-25 103 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 7.22e-25 103 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 7.22e-25 103 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 7.22e-25 103 34 4 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O31339 7.34e-25 106 29 6 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8Z7H7 7.34e-25 106 28 7 270 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q7W8Q6 7.45e-25 103 30 8 245 3 pstB Phosphate import ATP-binding protein PstB Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMC3 7.45e-25 103 30 8 245 3 pstB Phosphate import ATP-binding protein PstB Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1RE44 7.52e-25 108 33 6 222 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain UTI89 / UPEC)
A1A9B7 7.52e-25 108 33 6 222 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Escherichia coli O1:K1 / APEC
Q5PMK1 7.57e-25 106 28 7 270 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P75831 8.03e-25 108 33 6 222 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain K12)
Q0TJH0 8.11e-25 108 33 6 222 1 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P40790 8.28e-25 106 28 7 270 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05735
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 1217432 - 1218409 (strand: -1)
Length 978 (nucleotides) / 325 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1029
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08352 Oligopeptide/dipeptide transporter, C-terminal region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0444 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15583 oligopeptide transport system ATP-binding protein beta-Lactam resistance
ABC transporters
Quorum sensing
-

Protein Sequence

MTQLLQVKDLNVAFKTPDGDVTAVNKLNFSLSAGETLGIVGESGSGKSQTAFALMGLLARNGVVSGSAMFNGREILNLKEKALNKMRAEEISMIFQDPMTSLNPYMKVSHQLTEVLMLHKGLSKHDAFEESVRMLDAVKMPEARQRMNMYPHEFSGGMRQRVMIAMALLCKPKLLIADEPTTALDVTVQAQIMTLLNELKHEFNTAIIMITHDLGVVAGICDKVLVMYAGRTMEYGTARDVFYQPVHPYSIGLLKAVPRLDGPEDSVLATIPGNPPNLLRLPAGCPFRPRCQYAMEQCAQQEPPLNAFAQGRLRACFKTVEELAS

Flanking regions ( +/- flanking 50bp)

GATGGGTTGCGTGATGCCCTTGACCCGAAAGATCGCTGAGGAGGCCGCCAATGACTCAGTTATTACAGGTAAAAGACCTGAATGTGGCGTTTAAAACGCCGGACGGTGATGTTACGGCTGTCAATAAACTCAATTTTTCATTATCGGCAGGTGAAACACTCGGCATTGTCGGCGAGTCCGGCTCCGGAAAATCACAAACTGCGTTTGCACTGATGGGGCTATTAGCCCGTAACGGCGTGGTCAGCGGCTCTGCCATGTTTAATGGTCGTGAAATTCTCAATCTGAAAGAGAAAGCCTTAAATAAAATGCGCGCGGAAGAGATTTCCATGATCTTCCAGGACCCGATGACATCGCTTAACCCGTATATGAAAGTGAGCCATCAGCTCACAGAAGTACTGATGCTGCATAAAGGGCTGAGCAAACATGATGCCTTTGAAGAATCAGTGCGGATGCTGGACGCGGTAAAAATGCCGGAAGCCCGTCAGCGTATGAATATGTATCCCCATGAGTTTTCCGGCGGAATGCGCCAGCGCGTGATGATCGCGATGGCACTGTTATGTAAGCCGAAACTGCTTATTGCTGATGAACCGACCACGGCGCTGGATGTGACTGTTCAGGCGCAGATTATGACGCTGCTCAATGAACTGAAACATGAATTCAACACAGCAATTATTATGATCACCCATGATTTGGGGGTTGTCGCGGGAATTTGTGACAAAGTGCTGGTGATGTATGCCGGGCGTACCATGGAATACGGCACCGCGCGCGATGTATTTTATCAGCCGGTGCATCCGTATTCTATCGGGTTGCTTAAAGCGGTTCCGCGTCTTGATGGTCCTGAAGATAGTGTACTTGCCACTATCCCCGGAAATCCGCCTAACCTGCTGCGTCTGCCGGCAGGCTGTCCGTTCCGCCCGCGTTGTCAGTATGCGATGGAGCAGTGTGCTCAGCAGGAGCCGCCATTAAATGCATTTGCTCAGGGCCGTTTGCGTGCCTGCTTTAAAACAGTTGAGGAGCTGGCATCATGACGAATCCTGAACGTCCTGTTCTGCTGGAAATTGAAGATTTAAAAGTCCAT