Homologs in group_1074

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05625 FBDBKF_05625 74.1 Morganella morganii S1 sapB putrescine export ABC transporter permease SapB
EHELCC_11965 EHELCC_11965 74.1 Morganella morganii S2 sapB putrescine export ABC transporter permease SapB
NLDBIP_12305 NLDBIP_12305 74.1 Morganella morganii S4 sapB putrescine export ABC transporter permease SapB
LHKJJB_12165 LHKJJB_12165 74.1 Morganella morganii S3 sapB putrescine export ABC transporter permease SapB
HKOGLL_10780 HKOGLL_10780 74.1 Morganella morganii S5 sapB putrescine export ABC transporter permease SapB
F4V73_RS03680 F4V73_RS03680 75.4 Morganella psychrotolerans sapB putrescine export ABC transporter permease SapB

Distribution of the homologs in the orthogroup group_1074

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1074

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGH3 5.18e-163 459 70 0 321 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 5.18e-163 459 70 0 321 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
P0A2J3 6.63e-151 429 70 0 300 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 6.63e-151 429 70 0 300 3 sapB Peptide transport system permease protein SapB Salmonella typhi
A0A0H2ZGW7 1.13e-66 215 34 3 338 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
P45286 6.13e-64 207 34 0 288 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEF8 3.95e-61 201 33 7 343 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 3.95e-61 201 33 7 343 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 3.95e-61 201 33 7 343 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
P45096 1.03e-53 181 31 6 341 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q32IB7 1.65e-50 172 32 4 332 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 1.65e-50 172 32 4 332 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 1.65e-50 172 32 4 332 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 1.65e-50 172 32 4 332 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 1.65e-50 172 32 4 332 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q8X6V7 1.65e-50 172 32 4 332 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q3Z3V2 3.3e-50 172 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q83S26 3.37e-50 172 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q0T6D1 5.87e-50 171 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q8FJK9 1.25e-49 170 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q323W3 2.12e-49 169 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
Q8ZQM2 1.03e-46 162 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PGP5 1.36e-46 162 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z862 1.81e-46 162 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 1.81e-46 162 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
P94311 8.59e-45 158 31 4 335 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q6D3B1 3.09e-43 154 31 4 332 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8YDG7 6.6e-41 147 33 2 262 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK1 6.79e-41 147 33 2 262 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 6.79e-41 147 33 2 262 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q8FUX0 7.79e-41 147 32 2 265 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
P77308 2.51e-40 147 35 6 317 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
P45054 7.08e-39 142 30 4 331 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P33591 1.94e-37 139 29 6 345 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
Q8YBN9 2.21e-36 136 30 5 335 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 2.21e-36 136 30 5 335 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FWN8 2.64e-36 135 30 5 335 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
P08005 5.47e-36 134 28 4 331 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFH5 1.35e-35 134 28 4 331 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 1.35e-35 134 28 4 331 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 1.35e-35 134 28 4 331 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 1.35e-35 134 28 4 331 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
Q53191 6.2e-35 132 28 4 269 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P26903 8.1e-35 131 31 6 294 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
P42062 8.21e-34 129 26 3 333 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
P24138 1.16e-32 126 31 6 342 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
P0A4N8 4.87e-29 116 27 4 327 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 4.87e-29 116 27 4 327 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
Q2YXY7 6.69e-28 113 25 3 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HG38 1.92e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 1.92e-27 112 25 4 331 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 1.92e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q8NWT4 2.04e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 2.04e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
Q7A5Q6 2.24e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 2.24e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GH25 2.46e-27 112 25 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
A2RI75 3.49e-25 105 26 3 273 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
Q2FVE8 4.28e-24 103 28 4 259 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3K104 1.11e-23 102 28 4 259 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P66967 2.41e-23 101 27 4 268 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 2.41e-23 101 27 4 268 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 2.41e-23 101 27 4 268 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A9CKL3 1.15e-18 89 25 4 265 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
P0AFU0 2.22e-18 87 25 5 271 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 2.22e-18 87 25 5 271 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
P47323 9.73e-18 86 24 6 334 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75554 1.92e-13 73 24 4 237 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A4M8 5.59e-06 51 26 2 123 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 5.59e-06 51 26 2 123 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06660
Feature type CDS
Gene sapB
Product putrescine export ABC transporter permease SapB
Location 1457615 - 1458580 (strand: 1)
Length 966 (nucleotides) / 321 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1074
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4168 Defense mechanisms (V) V ABC-type antimicrobial peptide export system, permease component SapB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19227 cationic peptide transport system permease protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters
-

Protein Sequence

MIIYSIRRLLLLIVTLFFLSLVSFSLSYYTPNGPLSGASLFDAYFFYTHNMFHFDFGISSINGEPIKAQLIEAFPATMELCALAFIFALLIGIPAGIIAGVWRNKPADTFISHLALLGFSVPVFGLALLLTLFFSLKLGWLPVSGRIDLLYNLQPITGIAIVDAWLSDSPYRQQMIINVLQHLILPVTTLAIAPTTEVIRLMRNSTEEIMVENYVKAAATRGLSRFTIIRRHILHNALPPIIPKLGLQFSTMLTLTMVTEIVFNWPGLGRWLVTAIRQQDYSAISAGVMVVGSMVIIVNVLSDIVGAMSNPMKHKVGYAFR

Flanking regions ( +/- flanking 50bp)

GAAGCAGAAGTTGATGAGGATAGTCACAACCAAGAGGCTACAACAAACCCATGATTATCTACTCGATACGTCGCTTACTGTTATTAATTGTGACGCTCTTTTTCTTGTCACTGGTGAGCTTTAGTCTCAGCTATTACACACCCAATGGGCCGTTAAGTGGTGCTTCTTTATTTGATGCCTACTTTTTTTATACCCACAATATGTTCCATTTTGATTTTGGAATTTCTTCAATTAATGGCGAACCCATTAAAGCACAACTTATTGAAGCATTTCCTGCCACTATGGAGTTATGTGCACTGGCATTTATCTTTGCCCTGCTTATCGGCATTCCTGCGGGGATCATCGCGGGTGTATGGCGCAATAAACCTGCAGATACTTTTATTAGTCATCTCGCACTTTTGGGCTTTTCAGTTCCGGTCTTTGGTCTTGCATTATTACTGACGCTTTTCTTTTCATTAAAGCTAGGTTGGCTACCTGTTTCAGGCCGTATTGATTTACTGTATAACTTACAGCCTATAACGGGGATCGCAATCGTTGATGCTTGGCTATCGGATTCGCCTTATCGTCAACAGATGATCATAAACGTTTTGCAACATTTAATTCTACCTGTGACTACACTAGCTATTGCTCCTACTACGGAAGTCATTAGGTTAATGCGTAATAGTACAGAAGAGATCATGGTCGAGAATTATGTGAAAGCAGCGGCAACCCGTGGCTTATCACGCTTTACTATTATTCGCCGTCATATTCTACATAATGCATTACCCCCTATTATTCCCAAATTAGGCTTACAGTTTTCTACCATGTTAACACTGACGATGGTGACCGAAATTGTTTTTAACTGGCCAGGATTAGGCCGTTGGCTAGTAACGGCCATTCGCCAACAAGACTATTCGGCTATTTCAGCCGGTGTTATGGTTGTTGGTTCAATGGTTATCATCGTCAATGTGTTATCAGATATTGTCGGTGCGATGAGTAATCCAATGAAACACAAGGTGGGATATGCCTTTAGATAGCCAGTTTTATAAAGAGAAAAAAACACCATCACCGGCTGCGGTGATTTGGC