Homologs in group_1007

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05625 FBDBKF_05625 90.3 Morganella morganii S1 sapB putrescine export ABC transporter permease SapB
EHELCC_11965 EHELCC_11965 90.3 Morganella morganii S2 sapB putrescine export ABC transporter permease SapB
NLDBIP_12305 NLDBIP_12305 90.3 Morganella morganii S4 sapB putrescine export ABC transporter permease SapB
LHKJJB_12165 LHKJJB_12165 90.3 Morganella morganii S3 sapB putrescine export ABC transporter permease SapB
HKOGLL_10780 HKOGLL_10780 90.3 Morganella morganii S5 sapB putrescine export ABC transporter permease SapB
PMI_RS06660 PMI_RS06660 75.4 Proteus mirabilis HI4320 sapB putrescine export ABC transporter permease SapB

Distribution of the homologs in the orthogroup group_1007

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1007

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGH3 9.49e-158 446 68 0 321 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 9.49e-158 446 68 0 321 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
P0A2J3 4.81e-146 417 70 0 300 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 4.81e-146 417 70 0 300 3 sapB Peptide transport system permease protein SapB Salmonella typhi
A0A0H2ZGW7 1.84e-66 214 36 4 339 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
P45286 1.1e-65 212 35 0 290 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEF8 1.69e-61 202 34 8 344 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 1.69e-61 202 34 8 344 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 1.69e-61 202 34 8 344 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
P45096 1.87e-50 173 30 5 337 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q32IB7 4.48e-48 166 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 4.48e-48 166 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 4.48e-48 166 32 6 337 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 4.48e-48 166 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 4.48e-48 166 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q3Z3V2 4.58e-48 166 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q83S26 7.01e-48 166 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q0T6D1 1.37e-47 165 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q8X6V7 2.13e-47 164 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q8FJK9 3.22e-47 164 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q323W3 7.56e-47 163 32 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
Q8Z862 1.33e-46 162 31 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 1.33e-46 162 31 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q5PGP5 2.03e-46 162 31 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQM2 2.08e-46 162 31 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P94311 2.76e-46 162 30 4 332 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q6D3B1 2.11e-43 154 30 5 337 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8YBN9 5.94e-41 148 32 6 336 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 5.94e-41 148 32 6 336 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FWN8 8.5e-41 147 32 6 336 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
P77308 1.91e-39 144 40 2 239 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
Q53191 2.36e-38 141 27 6 333 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P45054 3e-38 140 31 4 331 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P08005 6.48e-37 137 30 5 331 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42062 1.21e-35 134 28 5 333 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
P0AFH5 2.81e-35 132 29 5 331 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 2.81e-35 132 29 5 331 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 2.81e-35 132 29 5 331 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 2.81e-35 132 29 5 331 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P33591 9.63e-35 131 27 6 345 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
Q8FUX0 4.67e-34 129 30 2 266 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
P26903 2.98e-33 127 30 3 268 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
Q8YDG7 5.36e-33 127 30 2 261 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK1 5.82e-33 127 30 2 261 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 5.82e-33 127 30 2 261 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
P24138 4.74e-31 121 28 4 331 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
Q6GH25 1.54e-29 118 27 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
Q2YXY7 5.03e-29 116 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NWT4 2.6e-28 114 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 2.6e-28 114 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
Q7A5Q6 2.6e-28 114 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 2.6e-28 114 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG38 2.69e-28 114 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 2.69e-28 114 26 4 331 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 2.69e-28 114 26 4 331 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
P66967 1.64e-25 107 28 4 260 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 1.64e-25 107 28 4 260 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 1.64e-25 107 28 4 260 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4N8 5.98e-25 105 26 6 328 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 5.98e-25 105 26 6 328 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
Q2FVE8 7.02e-25 105 25 6 336 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3K104 2.04e-24 103 25 6 336 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
A2RI75 1.04e-23 102 25 3 266 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
P0AFU0 3.54e-18 87 27 5 261 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 3.54e-18 87 27 5 261 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
A9CKL3 5.52e-18 87 25 4 257 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
P47323 2.42e-12 70 21 6 334 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75554 5.83e-12 69 22 6 266 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A4M8 9.96e-07 53 27 2 130 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 9.96e-07 53 27 2 130 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8FUW9 0.000585 44 26 2 127 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)
Q8YDG8 0.000676 44 26 3 146 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 0.000676 44 26 3 146 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 0.000676 44 26 3 146 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03680
Feature type CDS
Gene sapB
Product putrescine export ABC transporter permease SapB
Location 781334 - 782299 (strand: -1)
Length 966 (nucleotides) / 321 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1007
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4168 Defense mechanisms (V) V ABC-type antimicrobial peptide export system, permease component SapB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19227 cationic peptide transport system permease protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters		 -

Protein Sequence

MIIFILRRLLLMLITLFFLSLLSFSLSYFPANAPLSGATLTDALVFYYNGLVSWDFGSSVINGEPVSQQLWSALPPTLELCGLAFLFALVIGIPAGIIAGVWRNKAADVIISTFALVGFSIPVFGLALLLTLLFSLRLDWLPVSGRIDLLYDLTPVTGFAIVDAWLSDSPYRQEMIVNVLSHMVLPVLTLSIAPMTEVIRLMRTSTEDVINENYIKAAAIRGLSRLTIIRRHLLHNALPPVIPKLGLQFSTMLTLAMVTEVVFNWPGIGRWLITAIRQQDFSAISAGVMLVGSMVIIVNMLSDILGAISNPLKHKEWYAFR

Flanking regions ( +/- flanking 50bp)

GCTGAAAAGCCGGTGACCGAAAACAAACCTGTGACGCAGAAGGAAACACCATGATCATCTTTATTCTGCGCCGCCTGTTGCTGATGCTTATTACCCTTTTCTTTCTGTCACTGCTCAGTTTCAGTCTGAGCTATTTTCCGGCGAATGCGCCCCTGAGCGGTGCCACACTGACTGATGCACTGGTGTTTTATTACAACGGATTAGTATCCTGGGATTTCGGCAGTTCGGTGATTAACGGTGAGCCGGTCAGTCAGCAGTTATGGTCCGCCCTGCCGCCGACCCTTGAATTGTGCGGTCTGGCTTTTCTGTTCGCGCTGGTTATCGGTATTCCTGCCGGTATTATTGCCGGTGTCTGGCGCAATAAAGCGGCTGATGTCATCATCAGCACATTTGCGCTGGTCGGGTTTTCAATCCCGGTATTCGGACTGGCGCTGCTGCTCACGCTGCTGTTCTCTCTGCGGCTGGACTGGCTGCCGGTCTCCGGGCGGATTGATTTATTGTATGATTTAACACCGGTTACCGGTTTCGCTATTGTTGATGCCTGGCTGTCTGATTCGCCTTACCGTCAGGAGATGATTGTCAATGTCTTATCCCACATGGTGCTGCCGGTGCTCACGCTTTCTATTGCGCCGATGACCGAAGTTATCCGCCTGATGCGCACCAGTACCGAGGATGTTATCAATGAAAACTATATTAAAGCCGCTGCTATCCGGGGATTATCCCGCCTGACCATTATCCGCCGCCATCTGTTACACAATGCGCTGCCTCCGGTAATCCCGAAACTCGGGCTGCAATTCTCCACTATGCTGACACTGGCGATGGTGACCGAAGTGGTGTTTAACTGGCCGGGTATCGGGCGTTGGCTGATAACGGCTATCCGCCAGCAGGATTTTTCCGCGATTTCAGCCGGGGTGATGCTGGTGGGGTCAATGGTGATTATTGTCAATATGTTATCCGATATCCTGGGCGCCATATCCAACCCGCTGAAACATAAGGAATGGTATGCATTCAGATAAACTCTACCGCGAAGATCAGATGCCGTCGCCGGGACGGGTTATCTGGCAAA