Homologs in group_1074

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05625 FBDBKF_05625 100.0 Morganella morganii S1 sapB putrescine export ABC transporter permease SapB
EHELCC_11965 EHELCC_11965 100.0 Morganella morganii S2 sapB putrescine export ABC transporter permease SapB
NLDBIP_12305 NLDBIP_12305 100.0 Morganella morganii S4 sapB putrescine export ABC transporter permease SapB
LHKJJB_12165 LHKJJB_12165 100.0 Morganella morganii S3 sapB putrescine export ABC transporter permease SapB
F4V73_RS03680 F4V73_RS03680 90.3 Morganella psychrotolerans sapB putrescine export ABC transporter permease SapB
PMI_RS06660 PMI_RS06660 74.1 Proteus mirabilis HI4320 sapB putrescine export ABC transporter permease SapB

Distribution of the homologs in the orthogroup group_1074

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1074

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGH3 9.32e-156 441 68 0 321 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 9.32e-156 441 68 0 321 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
P0A2J3 6.43e-143 409 69 0 300 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 6.43e-143 409 69 0 300 3 sapB Peptide transport system permease protein SapB Salmonella typhi
A0A0H2ZGW7 5.01e-66 213 35 3 339 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
P45286 6.55e-66 213 36 0 290 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEF8 1.58e-60 199 34 8 344 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 1.58e-60 199 34 8 344 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 1.58e-60 199 34 8 344 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
P45096 3.78e-51 175 31 5 337 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94311 3.71e-47 164 31 4 332 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q32IB7 2.98e-42 151 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 2.98e-42 151 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 2.98e-42 151 30 6 337 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 2.98e-42 151 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 2.98e-42 151 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q8Z862 3.28e-42 151 29 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 3.28e-42 151 29 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q83S26 4.51e-42 150 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q8ZQM2 5.23e-42 150 29 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X6V7 5.4e-42 150 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q3Z3V2 8.61e-42 150 29 5 337 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q5PGP5 9.27e-42 150 30 5 337 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0T6D1 9.47e-42 150 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q8FJK9 2.35e-41 149 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q323W3 5.49e-41 147 30 6 337 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
P77308 2.19e-40 147 36 5 298 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
Q8YBN9 8.79e-39 142 31 6 336 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 8.79e-39 142 31 6 336 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FWN8 1.14e-38 142 31 6 336 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
Q6D3B1 1.4e-38 141 29 7 339 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q53191 2.06e-38 141 27 6 326 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P08005 1.87e-37 138 30 5 331 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33591 5.55e-37 137 28 6 345 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
Q8FUX0 2.77e-36 135 30 2 267 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
P45054 1.08e-35 134 30 5 331 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P26903 1.17e-35 134 32 3 268 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
Q2YJK1 5.48e-35 132 30 2 262 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 5.48e-35 132 30 2 262 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q8YDG7 5.96e-35 132 30 2 262 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P42062 6.42e-35 132 27 5 333 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
P0AFH5 9.66e-35 131 29 5 331 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 9.66e-35 131 29 5 331 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 9.66e-35 131 29 5 331 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 9.66e-35 131 29 5 331 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P24138 1.77e-29 117 28 6 331 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
Q2YXY7 1.59e-28 115 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GH25 1.55e-27 112 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
A2RI75 4.05e-27 111 27 3 266 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
Q8NWT4 4.22e-27 111 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 4.22e-27 111 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
Q5HG38 4.49e-27 111 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 4.49e-27 111 28 4 284 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 4.49e-27 111 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q7A5Q6 5.45e-27 111 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 5.45e-27 111 28 4 284 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FVE8 2.09e-25 106 25 6 336 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3K104 6.53e-25 105 25 6 336 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P66967 2.27e-23 101 28 6 261 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 2.27e-23 101 28 6 261 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 2.27e-23 101 28 6 261 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4N8 8.75e-23 99 25 6 328 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 8.75e-23 99 25 6 328 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
P0AFU0 3.05e-17 84 26 5 252 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 3.05e-17 84 26 5 252 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
A9CKL3 1e-16 83 24 4 255 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
P47323 3.93e-14 75 25 7 303 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75554 1.82e-12 70 23 6 246 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A4M8 1.26e-06 53 27 2 123 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 1.26e-06 53 27 2 123 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8FUW9 0.00059 44 27 2 127 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)
Q8YDG8 0.000658 44 27 3 146 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 0.000658 44 27 3 146 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 0.000658 44 27 3 146 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10780
Feature type CDS
Gene sapB
Product putrescine export ABC transporter permease SapB
Location 47869 - 48834 (strand: -1)
Length 966 (nucleotides) / 321 (amino acids)
In genomic island -

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1074
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4168 Defense mechanisms (V) V ABC-type antimicrobial peptide export system, permease component SapB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19227 cationic peptide transport system permease protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters
-

Protein Sequence

MIIFILRRLLLVLITLCFLSVLSFSLSYFPANAPLSGASLTDAVLFYYNSLFSWDFGSSVINGEPVSRQLWAALPATLELCGLAFLLALVIGIPAGIIAGVWRNKMADIAISTFALVGFSIPVFGLALLLTLFFSLRLDWLPVSGRIDLLYDLTPVTGFAVIDAWLSDSPYRQAMILNVLSHMVLPVITLSIAPMTEVIRLMRTSTEEIISQNYIKAAAIRGLSRLTIIRRHVLHNALPPVIPKLGLQFSTMLTLAMVTEVVFNWPGIGRWLITAIRQQDFAAISAGVMLVGTMVIIINMLSDILGAVSSPLKHKEWYAFR

Flanking regions ( +/- flanking 50bp)

GCCGGTGTCTACCGTGATACCGGGGATGACCCGGAGCCGGAGGCTGAACCATGATTATTTTTATTCTGCGCCGTCTGCTGCTGGTGCTGATCACGCTCTGTTTTCTGTCGGTGCTCAGTTTCAGCCTGAGTTACTTCCCGGCAAATGCACCGCTGAGCGGCGCTTCCCTGACGGATGCGGTACTGTTCTACTATAATAGTCTGTTTTCATGGGACTTCGGCAGTTCCGTGATTAACGGTGAGCCGGTCAGCCGGCAATTGTGGGCAGCACTGCCCGCAACTCTGGAGCTGTGCGGCCTGGCGTTTCTGCTGGCGCTGGTGATCGGTATTCCCGCCGGGATTATTGCCGGGGTCTGGCGCAATAAAATGGCGGATATCGCCATCAGCACCTTTGCGCTGGTCGGGTTTTCGATTCCTGTATTCGGACTGGCTCTGCTGCTTACCCTGTTCTTCTCTCTGCGGCTGGACTGGCTGCCGGTCTCCGGACGCATTGACCTGCTGTATGATTTAACACCGGTTACCGGATTTGCGGTGATTGATGCCTGGCTGTCGGATTCACCATACCGTCAGGCGATGATCCTCAATGTGCTGTCTCATATGGTGTTGCCGGTGATCACGCTGTCCATTGCGCCGATGACGGAAGTTATCCGCCTGATGCGCACCAGTACCGAAGAGATTATCAGCCAGAACTATATTAAAGCCGCCGCTATCCGTGGTTTATCCCGGCTGACCATTATCCGCCGTCATGTGCTGCACAATGCGCTGCCGCCGGTGATCCCGAAACTCGGGTTACAGTTTTCCACCATGCTGACGCTGGCGATGGTCACAGAAGTGGTCTTTAACTGGCCGGGTATCGGCCGCTGGCTGATCACAGCTATCCGCCAGCAGGATTTTGCCGCGATTTCCGCCGGTGTCATGCTGGTCGGTACCATGGTGATAATTATCAATATGCTGTCAGATATTCTGGGGGCCGTCAGCAGCCCGCTGAAACATAAGGAATGGTATGCCTTCAGATAATTTCTACCGTGAAGACCGGATGCCGTCACCGGGGCGGGTTATCTGGCAGC