Homologs in group_1006

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05620 FBDBKF_05620 70.4 Morganella morganii S1 sapA ABC transporter substrate-binding protein SapA
EHELCC_11970 EHELCC_11970 70.4 Morganella morganii S2 sapA ABC transporter substrate-binding protein SapA
NLDBIP_12310 NLDBIP_12310 70.4 Morganella morganii S4 sapA ABC transporter substrate-binding protein SapA
LHKJJB_12170 LHKJJB_12170 70.4 Morganella morganii S3 sapA ABC transporter substrate-binding protein SapA
HKOGLL_10785 HKOGLL_10785 70.4 Morganella morganii S5 sapA ABC transporter substrate-binding protein SapA
F4V73_RS03685 F4V73_RS03685 72.5 Morganella psychrotolerans sapA ABC transporter substrate-binding protein SapA

Distribution of the homologs in the orthogroup group_1006

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1006

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q47622 0.0 781 71 0 512 3 sapA Probable ABC transporter periplasmic-binding protein SapA Escherichia coli (strain K12)
P36634 0.0 777 67 1 543 2 sapA Peptide transport periplasmic protein SapA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45285 2.8e-132 400 36 6 562 3 sapA Peptide transport periplasmic protein SapA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23847 9.92e-132 397 37 4 546 1 dppA Dipeptide-binding protein Escherichia coli (strain K12)
P33950 3.71e-117 360 35 5 524 1 hbpA Heme-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZGV2 1.4e-114 353 34 6 513 1 dppA1 Di/tripeptide-binding protein 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HVS1 3.91e-113 350 34 5 504 1 PA4500 Dipeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGN2 1.12e-112 348 34 5 504 1 dppA3 Di/tripeptide-binding protein 3 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HVS4 7.08e-101 318 34 4 503 1 PA4497 Tripeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZI72 9.16e-101 317 33 1 498 1 dppA5 Probable di/tripeptide-binding protein 5 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGW2 1.14e-99 315 33 4 503 1 dppA2 Di/tripeptide-binding protein 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGV7 6.2e-98 310 33 3 504 1 dppA4 Di/tripeptide-binding protein 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1RE95 2.16e-38 151 27 18 538 3 gsiB Glutathione-binding protein GsiB Escherichia coli (strain UTI89 / UPEC)
Q8CW88 2.16e-38 151 27 18 538 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A968 2.16e-38 151 27 18 538 3 gsiB Glutathione-binding protein GsiB Escherichia coli O1:K1 / APEC
Q32IB6 5.02e-38 150 27 17 501 3 gsiB Glutathione-binding protein GsiB Shigella dysenteriae serotype 1 (strain Sd197)
Q8X6V9 6.87e-38 149 27 18 538 3 gsiB Glutathione-binding protein GsiB Escherichia coli O157:H7
Q3Z3V3 8.69e-38 149 27 18 538 3 gsiB Glutathione-binding protein GsiB Shigella sonnei (strain Ss046)
Q821B3 1.03e-37 149 27 18 538 3 gsiB Glutathione-binding protein GsiB Shigella flexneri
Q323W4 1.22e-37 149 27 19 538 3 gsiB Glutathione-binding protein GsiB Shigella boydii serotype 4 (strain Sb227)
P75797 1.32e-37 149 27 18 538 1 gsiB Glutathione-binding protein GsiB Escherichia coli (strain K12)
Q0T6D2 3.86e-37 147 27 19 539 3 gsiB Glutathione-binding protein GsiB Shigella flexneri serotype 5b (strain 8401)
Q0TJL8 7.37e-37 146 27 17 501 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q57RB1 8.95e-36 143 27 17 501 3 gsiB Glutathione-binding protein GsiB Salmonella choleraesuis (strain SC-B67)
Q8Z863 1.13e-35 143 27 17 501 3 gsiB Glutathione-binding protein GsiB Salmonella typhi
Q8ZQM3 1.75e-35 142 27 17 501 3 gsiB Glutathione-binding protein GsiB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PGP4 2e-35 142 27 17 501 3 gsiB Glutathione-binding protein GsiB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6D3B0 3.54e-33 136 27 16 473 3 gsiB Glutathione-binding protein GsiB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P76128 7.29e-29 123 23 8 465 2 ddpA Probable D,D-dipeptide-binding periplasmic protein DdpA Escherichia coli (strain K12)
P42061 3.21e-28 122 24 19 533 1 appA Oligopeptide-binding protein AppA Bacillus subtilis (strain 168)
P33590 3.14e-24 110 25 16 461 1 nikA Nickel-binding periplasmic protein Escherichia coli (strain K12)
P23843 9.02e-23 105 23 22 545 1 oppA Periplasmic oligopeptide-binding protein OppA Escherichia coli (strain K12)
Q8FWN7 3.92e-20 97 27 13 399 3 BRA0409 Putative ABC transporter peptide-binding protein BRA0409/BS1330_II0406 Brucella suis biovar 1 (strain 1330)
Q2YK66 3.92e-20 97 27 13 399 3 BAB2_0812 Putative ABC transporter peptide-binding protein BAB2_0812 Brucella abortus (strain 2308)
Q577J8 3.92e-20 97 27 13 399 3 BruAb2_0792 Putative ABC transporter peptide-binding protein BruAb2_0792 Brucella abortus biovar 1 (strain 9-941)
A5VU91 3.92e-20 97 27 13 399 3 BOV_A0352 Putative ABC transporter peptide-binding protein BOV_A0352 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBP0 4.52e-20 97 27 13 399 3 BMEII0859 Putative ABC transporter peptide-binding protein BMEII0859 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P24141 4.83e-20 97 22 15 473 1 oppA Oligopeptide-binding protein OppA Bacillus subtilis (strain 168)
P06202 5.15e-20 97 24 18 456 1 oppA Periplasmic oligopeptide-binding protein OppA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q46863 1.22e-19 95 25 23 530 1 ygiS Probable deoxycholate-binding periplasmic protein YgiS Escherichia coli (strain K12)
Q2FVE7 1.18e-18 92 24 13 445 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JTL0 2.5e-18 92 24 13 444 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain Mu50 / ATCC 700699)
P26906 2.95e-18 91 22 15 466 1 dppE Dipeptide-binding protein DppE Bacillus subtilis (strain 168)
P77348 1.74e-17 89 23 27 544 1 mppA Periplasmic murein peptide-binding protein MppA Escherichia coli (strain K12)
P55669 8.27e-17 87 24 23 521 3 NGR_a01440 Probable peptide ABC transporter periplasmic-binding protein y4tO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2G2P5 6.15e-16 84 23 11 346 1 nikA Nickel-binding protein NikA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2YJK2 1.19e-15 83 24 13 431 3 BAB2_1049 Putative peptide-binding periplasmic protein BAB2_1049 Brucella abortus (strain 2308)
Q8VQK3 1.19e-15 83 24 13 431 3 BruAb2_1030 Putative peptide-binding periplasmic protein BruAb2_1030 Brucella abortus biovar 1 (strain 9-941)
Q8YDG6 2.23e-15 82 24 15 433 3 BMEII0210 Putative peptide-binding periplasmic protein BMEII0210 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FUX2 6.28e-15 81 24 15 433 3 BRA1090 Putative peptide-binding periplasmic protein BRA1090/BS1330_II1082 Brucella suis biovar 1 (strain 1330)
O07570 2.07e-14 79 24 19 498 3 yhjP Uncharacterized protein YhjP Bacillus subtilis (strain 168)
P06109 3.88e-14 79 23 16 455 3 xp55 Protein XP55 Streptomyces lividans
P71370 5.33e-11 68 20 22 562 3 oppA Periplasmic oligopeptide-binding protein OppA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8YC41 1.19e-10 67 25 11 258 3 BMEII0691 Putative binding protein BMEII0691 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YKJ5 1.31e-10 67 25 11 258 3 BAB2_0664 Putative binding protein BAB2_0664 Brucella abortus (strain 2308)
Q577X5 1.31e-10 67 25 11 258 3 BruAb2_0648 Putative binding protein BruAb2_0648 Brucella abortus biovar 1 (strain 9-941)
Q8FW84 2.08e-10 67 25 11 258 3 BRA0576 Putative binding protein BRA0576/BS1330_II0571 Brucella suis biovar 1 (strain 1330)
A1JJG7 3.28e-08 60 21 21 497 3 sgrR HTH-type transcriptional regulator SgrR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P55691 1.87e-07 57 21 18 543 3 NGR_a00920 Uncharacterized protein y4wM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P33913 3.52e-07 57 21 18 569 1 yejA Uncharacterized protein YejA Escherichia coli (strain K12)
P66772 1.88e-06 54 22 14 359 3 BQ2027_MB1311C Uncharacterized protein Mb1311c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGU5 1.88e-06 54 22 14 359 1 Rv1280c Uncharacterized protein Rv1280c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGU4 1.88e-06 54 22 14 359 3 MT1317 Uncharacterized protein MT1317 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6D0F8 5.21e-06 53 25 5 158 3 sgrR HTH-type transcriptional regulator SgrR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57TF2 3.75e-05 50 26 5 168 3 sgrR HTH-type transcriptional regulator SgrR Salmonella choleraesuis (strain SC-B67)
P18791 6.7e-05 49 26 10 222 1 amiA Oligopeptide-binding protein AmiA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q07741 9.92e-05 48 23 2 147 1 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis
Q02VA9 0.000106 48 23 2 147 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. cremoris (strain SK11)
Q8Z9I4 0.00015 48 25 5 168 3 sgrR HTH-type transcriptional regulator SgrR Salmonella typhi
Q5PDG5 0.00015 48 25 5 168 3 sgrR HTH-type transcriptional regulator SgrR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q66EM6 0.000254 47 23 5 158 3 sgrR HTH-type transcriptional regulator SgrR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TQA7 0.000254 47 23 5 158 3 sgrR HTH-type transcriptional regulator SgrR Yersinia pestis (strain Pestoides F)
Q1CMQ0 0.000254 47 23 5 158 3 sgrR HTH-type transcriptional regulator SgrR Yersinia pestis bv. Antiqua (strain Nepal516)
Q74Q56 0.000254 47 23 5 158 3 sgrR HTH-type transcriptional regulator SgrR Yersinia pestis
Q1C1Y8 0.000254 47 23 5 158 3 sgrR HTH-type transcriptional regulator SgrR Yersinia pestis bv. Antiqua (strain Antiqua)
P31306 0.000278 47 24 9 218 1 sarA Oligopeptide-binding protein SarA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8ZRV0 0.000557 46 25 5 168 3 sgrR HTH-type transcriptional regulator SgrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06655
Feature type CDS
Gene sapA
Product ABC transporter substrate-binding protein SapA
Location 1455927 - 1457618 (strand: 1)
Length 1692 (nucleotides) / 563 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1006
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00496 Bacterial extracellular solute-binding proteins, family 5 Middle

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0747 Amino acid transport and metabolism (E) E ABC-type transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19226 cationic peptide transport system substrate-binding protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters		 -

Protein Sequence

MRPILLISTMLLASISMTCMAEIATKATELSVAQEPTNIHQNGFVYCVDGSVNTFNPQLSSSGLIIDPLAAQLYDRLLDVDPYTYRLIPEIAARWESLDNGATYRFYLRKNVSFQTTPWFTPTRKLTADDVIFSFERMFSANNPYNQVNGGKYPYFDSLSLADNIKSIKKLGKYTVEFNLKSPDASFLWHLATHYAPILSEEYASNLEKSGNQSQLDWKPVGSGPFYLDEFQPGQFVRLLRNEQYWKGQPKMQQVVIDTGAGGTGRISKLLTGECDVLAYPAASQLKVLRDDPRLRLTLRSGMNIAYLAFNTNKPPFNDLKVRQAIAYAINNERLMGSIYYGTAETAASVLPRASWAYDNRAKITEYNPEKSKQILKELGLEGLKLNLWVPSAPQSYNPSPLKMAELIQADLAQVGIQMNIRPIEGRYQETSLMDRTHDMTLSGWSTDSNDPDSFFRPLFSCAAISSQTNLSHWCSPAFDNVLQQALYSQQLASRIDYYHQAQDILAQELPVLPLANSLRMQAYRYDIKGLVLSTFGNASFAGVYREAEVDEDSHNQEATTNP

Flanking regions ( +/- flanking 50bp)

CCAGTTTTTTAAGTTACAATAGCCAAATCGTTTATCTAAAAGACATAATTATGCGCCCTATTTTACTTATTAGTACTATGCTACTGGCTTCAATAAGTATGACTTGTATGGCAGAGATAGCTACCAAAGCTACAGAGCTATCTGTCGCGCAAGAGCCTACAAACATTCATCAAAATGGCTTTGTCTATTGTGTTGATGGCAGTGTAAATACCTTTAATCCTCAACTTTCGAGCAGTGGATTAATTATTGATCCCCTAGCCGCGCAACTTTACGATCGTCTTTTAGATGTTGACCCTTATACCTATCGTTTGATCCCTGAAATTGCCGCTCGTTGGGAGTCTCTCGATAATGGCGCAACTTATCGCTTTTATTTGCGTAAAAATGTGTCATTCCAGACAACACCTTGGTTTACGCCTACACGTAAACTCACCGCAGACGATGTTATCTTTAGTTTTGAGCGCATGTTTTCTGCCAATAATCCTTATAATCAAGTTAATGGTGGTAAATACCCCTATTTTGATAGTTTAAGTTTGGCGGATAATATCAAATCAATTAAAAAGTTAGGCAAATACACCGTTGAATTTAATCTAAAATCTCCTGATGCTTCATTTTTATGGCATTTAGCAACCCATTATGCGCCTATCCTTTCAGAAGAATATGCCAGTAACCTTGAAAAATCGGGTAATCAATCGCAACTTGATTGGAAACCTGTAGGCTCAGGGCCTTTTTATCTTGATGAATTTCAGCCAGGCCAATTTGTTCGATTACTGAGAAATGAGCAATACTGGAAAGGTCAGCCCAAAATGCAACAAGTGGTTATAGACACGGGTGCAGGCGGTACTGGACGTATATCTAAACTCTTAACGGGAGAGTGTGATGTTTTGGCCTATCCTGCGGCAAGCCAATTAAAGGTCTTACGTGATGATCCTCGTTTACGCCTTACATTACGTTCAGGAATGAATATTGCTTATCTTGCGTTTAATACTAATAAGCCACCGTTTAACGATCTAAAAGTGCGTCAAGCCATCGCTTATGCGATTAATAATGAACGACTAATGGGATCTATTTATTACGGTACGGCTGAAACAGCCGCATCGGTTTTACCTCGTGCCTCTTGGGCTTATGATAATCGCGCTAAAATTACCGAATATAATCCTGAAAAATCGAAGCAAATATTAAAAGAGTTGGGACTTGAAGGACTTAAATTAAACCTTTGGGTCCCCAGTGCTCCGCAATCTTATAATCCCAGCCCGTTAAAAATGGCTGAGTTAATTCAAGCTGATTTAGCCCAAGTAGGTATCCAAATGAATATTCGACCTATAGAAGGTCGCTATCAAGAAACCAGTTTGATGGATAGAACTCATGATATGACTTTATCAGGATGGTCAACGGACAGTAACGACCCCGATAGTTTTTTCCGCCCATTATTTAGTTGTGCGGCTATTAGTTCGCAAACCAATTTAAGTCATTGGTGCTCACCGGCATTTGACAATGTGCTACAACAGGCGCTTTATAGCCAACAACTGGCCTCTCGTATAGACTATTATCACCAAGCACAAGATATTTTAGCGCAAGAGCTACCGGTTTTACCATTAGCTAATTCTTTACGTATGCAGGCTTATCGTTATGATATTAAAGGACTTGTATTAAGTACATTTGGTAACGCTTCTTTTGCCGGTGTGTATCGCGAAGCAGAAGTTGATGAGGATAGTCACAACCAAGAGGCTACAACAAACCCATGATTATCTACTCGATACGTCGCTTACTGTTATTAATTGTGACGCTCTTTTTC