Homologs in group_998

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05580 FBDBKF_05580 61.8 Morganella morganii S1 tyrR transcriptional regulator TyrR
EHELCC_12010 EHELCC_12010 61.8 Morganella morganii S2 tyrR transcriptional regulator TyrR
NLDBIP_12350 NLDBIP_12350 61.8 Morganella morganii S4 tyrR transcriptional regulator TyrR
LHKJJB_12210 LHKJJB_12210 61.8 Morganella morganii S3 tyrR transcriptional regulator TyrR
HKOGLL_10825 HKOGLL_10825 61.8 Morganella morganii S5 tyrR transcriptional regulator TyrR
F4V73_RS03725 F4V73_RS03725 61.8 Morganella psychrotolerans tyrR transcriptional regulator TyrR

Distribution of the homologs in the orthogroup group_998

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_998

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZIB7 0.0 647 60 2 519 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
O54426 0.0 615 60 5 519 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P0A2D7 0.0 609 59 3 520 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 0.0 609 59 3 520 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P07604 0.0 604 60 6 524 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P44694 1.67e-95 295 48 3 317 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P29267 3.46e-70 235 39 4 333 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q06065 1.11e-68 231 38 4 365 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
A8ANR6 4.28e-68 230 40 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P26047 6.41e-68 233 33 11 449 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P12626 5.24e-67 228 39 4 312 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
B5FSZ0 3.63e-66 225 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P09570 4.83e-66 225 43 6 281 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P54930 8.25e-66 224 41 4 321 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
A4WDR5 2.1e-65 223 40 4 317 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
C0PWN2 2.13e-65 223 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5F363 4.72e-65 222 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A9MFX7 1.13e-64 221 39 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z4C6 1.82e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.82e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.82e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.82e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B4TF23 1.92e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
Q5PF20 2e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDG4 2.07e-64 221 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q9APD9 2.51e-64 219 37 1 302 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q8ZMJ8 3.31e-64 220 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 3.31e-64 220 41 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
P37013 4.41e-64 219 40 5 336 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 4.41e-64 219 40 5 336 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 4.41e-64 219 40 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
P56266 7.08e-64 219 39 6 332 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P12627 8.89e-64 219 46 0 230 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
B5Z370 1.18e-63 218 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 1.18e-63 218 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P03027 1.28e-63 219 40 5 320 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P59402 1.38e-63 218 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 1.38e-63 218 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
P09133 1.76e-63 221 44 1 256 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q32CL9 1.83e-63 218 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
B4T3B0 5.17e-63 217 40 4 319 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B7MZ04 7.5e-63 216 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
P0AFB8 1.72e-62 214 44 0 251 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.72e-62 214 44 0 251 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
B5XVA2 1.95e-62 216 39 5 324 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
B6I695 2.41e-62 215 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B7UHC1 2.49e-62 215 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LQ27 3.37e-62 214 39 5 337 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
A7ZQD8 3.37e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0TEH1 3.59e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R7Z1 3.66e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 3.66e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 3.66e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
A6TCX4 4.36e-62 214 45 0 231 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q3YYF5 4.76e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B7NSI9 5.5e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8FEN6 5.62e-62 214 40 4 317 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q31X73 7.37e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B7M9E6 7.85e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
A8A3I6 8.01e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B1IUX0 8.1e-62 214 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P03029 8.34e-62 213 38 4 335 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P41789 9.16e-62 213 38 4 335 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7LW25 1.13e-61 213 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7N6T9 1.29e-61 213 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LEC0 1.66e-61 213 39 5 336 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
Q53206 2.75e-61 214 43 1 265 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q845S7 5.07e-61 207 38 4 287 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P05407 9.77e-61 213 45 2 245 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P27713 1.33e-60 211 42 0 240 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
D5ARW9 2.54e-60 211 43 1 246 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0AFU5 2.66e-60 208 41 1 256 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 2.66e-60 208 41 1 256 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P0CY94 2.67e-60 211 43 1 246 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
P24426 3.36e-60 205 42 2 256 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
Q46802 4.47e-60 211 36 5 327 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P30667 4.97e-60 212 39 2 285 1 nifA Nif-specific regulatory protein Azospirillum brasilense
Q6D8R9 5.32e-60 209 37 2 327 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9I4N3 6.17e-60 208 41 0 243 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P25852 8.58e-60 206 37 2 302 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P54929 1.02e-59 211 43 1 243 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P54931 1.94e-59 209 41 2 267 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P71229 3.21e-59 210 35 1 328 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
Q00934 1.16e-58 204 35 2 311 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P38022 1.25e-58 204 35 7 336 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q3K999 1.56e-58 201 36 2 289 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q8Z333 2.21e-58 203 40 0 244 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P09828 2.29e-58 205 43 1 246 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P0C5S5 2.39e-58 203 41 0 231 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 2.39e-58 203 41 0 231 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
A8GG93 2.6e-58 204 36 2 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
P17899 4.98e-58 202 36 4 322 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7MFY9 7.74e-58 203 37 2 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q8X613 1.07e-57 201 35 1 302 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P14375 1.12e-57 201 35 1 302 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P06519 1.18e-57 204 36 4 325 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q87MX7 2.13e-57 201 41 0 231 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KT84 2.16e-57 201 41 0 233 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q43965 2.92e-57 203 36 6 319 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q8D4F9 7.96e-57 200 37 2 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
Q5E3W8 9.2e-57 200 41 1 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q01265 9.42e-57 194 36 4 297 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P28787 1.38e-56 199 40 1 266 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q7MM78 1.54e-56 198 41 3 240 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1.54e-56 198 41 3 240 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q9HU19 2.89e-56 197 38 4 309 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AQ2 1.06e-55 196 38 3 305 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P54529 1.38e-55 201 38 5 325 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q04848 3.8e-55 195 36 7 341 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P23747 1.28e-54 193 43 0 224 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88RJ6 1.33e-54 193 37 3 305 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A4STH5 1.11e-53 192 42 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
O25408 2.71e-53 187 39 0 227 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
O85057 3.04e-53 191 34 8 318 1 None Limonene hydroxylase Geobacillus stearothermophilus
P36219 6.84e-53 185 40 2 237 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
G3XCV0 7.53e-53 189 43 1 228 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10577 1.07e-52 189 36 4 295 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45671 1.33e-52 188 41 1 230 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P03028 2.18e-52 189 41 3 272 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
A0KEJ0 4.03e-52 188 42 1 241 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P19323 5.63e-51 188 36 2 313 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P10576 8.65e-51 183 40 4 253 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
O31551 9.77e-51 186 33 9 384 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
E1WAA4 9.93e-51 187 34 2 313 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
Q9K4U8 1.01e-50 184 40 3 262 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P37344 1.11e-50 179 40 1 221 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P0CL46 2.31e-50 186 34 2 313 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87455 3.6e-50 183 36 5 327 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P31908 5.81e-50 181 35 6 323 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P13632 1.07e-49 180 35 4 314 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q9KN48 1.48e-49 181 37 5 329 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P37930 1.39e-48 173 42 1 210 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
Q9K4V0 9.68e-48 176 40 2 245 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P37931 2.44e-47 169 39 2 238 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P77743 3.08e-47 175 42 5 245 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P10046 6.46e-46 169 34 4 304 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P26316 2.2e-45 164 40 1 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P74839 1.08e-44 168 40 4 234 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04849 1.21e-44 166 33 3 312 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P28614 5.69e-44 168 42 3 220 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P26408 1.11e-42 162 30 8 334 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P54156 2.55e-37 143 35 7 260 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
Q9ZCY9 3.88e-35 140 32 6 300 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q1RJS1 4.38e-35 140 33 5 299 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q4UL27 1.15e-34 139 31 6 312 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68WH4 1.35e-34 139 31 7 313 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P45512 1.37e-34 141 27 13 451 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P38035 1.13e-32 134 35 5 235 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
Q92HC2 5.59e-28 120 30 6 299 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P76016 8.43e-27 117 23 10 441 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P09432 9.05e-24 107 30 4 225 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P55610 1.07e-22 105 28 9 314 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P23914 1.67e-20 99 30 7 241 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
D0ZLR9 1.21e-14 80 28 10 278 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P06184 4.84e-11 68 26 4 227 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YWB1 1.7e-05 51 25 10 244 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5XCL7 1.82e-05 51 26 7 223 1 clpC Probable ATP-dependent Clp protease ATP-binding subunit Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q6GDQ0 2.3e-05 50 24 10 245 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain MRSA252)
Q5HD02 3.92e-05 50 24 10 245 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain COL)
Q2FV74 3.92e-05 50 24 10 245 2 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDV8 4.02e-05 50 24 10 245 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain USA300)
Q7A3F4 4.27e-05 50 24 10 245 1 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain N315)
Q99R88 4.27e-05 50 24 10 245 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NUR7 4.35e-05 50 24 10 245 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain MW2)
Q6G6C6 4.35e-05 50 24 10 245 3 clpL ATP-dependent Clp protease ATP-binding subunit ClpL Staphylococcus aureus (strain MSSA476)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06610
Feature type CDS
Gene tyrR
Product transcriptional regulator TyrR
Location 1447787 - 1449352 (strand: -1)
Length 1566 (nucleotides) / 521 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_998
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF00989 PAS fold
PF18024 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3283 Transcription (K)
Amino acid transport and metabolism (E)		 KE Transcriptional regulator TyrR of aromatic amino acids metabolism

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03721 transcriptional regulator of aroF, aroG, tyrA and aromatic amino acid transport - -

Protein Sequence

MRLEVTCKDRIGLTRELLDLLVLKNIDLRGIEIFPIGLIYLNFSQIDFNIFQPLMAEIRRIEGVIDVRTVAFMPSEQEHRAMWTLLESVPVPVFSINTKGQIKLLNPATRHLFELDENDKNEKSFNQLIPNFNIHRWLEQKDPHAEIISIKLKKQHFDMEIVPIKLTDDNQFNHCVGALILLKYRGIIHEHPKLIVNDNSGFEQVIAVSTPMKQLVERAKKMAKMDDPLLLVGDTGTGKDLFAKACHLLSPRAREPFLGLNCASMPDDVVESELFGYAAGAYPNAIEGKKGFFEQANRGTVLLDEIGEMSPQMQIKLLRFLNDGTFRRVGEEHEVKVDVRIICATQKNLWELVQKGLFREDLYYRLNVLTLTLPPLRERKADIMPLALHFINQYCLEQKASKPVISPDLSAYLVQYGWPGNVRQLRNTIYQAMAQLVGNTLRPQDIALPEHTADTLFDEDLLEGSLDEMTKRFEASILRRLYRDYPSTRKLAKRLGISHTAIANKLREYDLTSKKADKTEK

Flanking regions ( +/- flanking 50bp)

TATAATATCAGCAATTAGTTCAGGGGCACTCAGTATTAAGAAGGTTTAAAATGCGCTTAGAAGTTACCTGTAAAGATCGCATCGGGTTAACCCGCGAATTACTCGATCTGCTTGTATTAAAAAATATCGATTTGCGTGGAATTGAAATCTTTCCTATTGGTCTTATTTATCTAAATTTTTCGCAAATCGATTTTAATATATTTCAACCTTTAATGGCTGAAATCAGAAGAATTGAGGGGGTTATCGATGTTCGTACTGTGGCTTTTATGCCATCAGAGCAAGAGCATCGAGCTATGTGGACACTATTAGAATCAGTACCTGTCCCTGTCTTTTCTATTAATACCAAAGGTCAAATTAAGTTATTAAACCCAGCTACACGGCATCTGTTTGAATTAGATGAAAATGATAAAAATGAAAAATCTTTTAACCAACTGATACCTAACTTTAATATCCATCGCTGGTTAGAACAAAAAGATCCTCATGCTGAAATTATCTCCATCAAATTAAAAAAACAACATTTTGATATGGAGATTGTGCCAATAAAACTGACTGATGATAATCAGTTTAATCATTGTGTTGGTGCACTCATTTTATTGAAATATCGCGGAATAATTCATGAGCATCCGAAATTAATTGTTAATGATAATTCGGGATTTGAACAAGTTATTGCTGTTAGCACCCCCATGAAACAATTAGTTGAACGCGCTAAGAAAATGGCAAAAATGGATGATCCTTTATTATTAGTGGGGGATACGGGGACGGGCAAAGATCTATTTGCTAAGGCTTGCCACTTATTAAGTCCTCGAGCCAGAGAGCCATTTTTAGGCCTCAATTGTGCCTCTATGCCTGATGATGTGGTTGAAAGTGAGTTATTTGGTTATGCGGCAGGTGCATATCCTAATGCTATCGAAGGTAAAAAAGGCTTTTTTGAACAAGCCAATCGAGGCACTGTTTTGCTGGATGAAATTGGCGAAATGTCGCCACAAATGCAAATTAAACTCCTGCGTTTTTTAAATGATGGTACTTTCCGTCGTGTTGGTGAAGAGCACGAAGTTAAAGTTGATGTTCGAATAATTTGTGCAACACAAAAAAACTTATGGGAATTAGTACAAAAAGGGCTATTTAGGGAAGATCTCTACTATCGACTTAATGTATTGACATTAACTCTACCACCGTTGCGGGAAAGAAAAGCGGATATCATGCCGTTAGCACTGCATTTTATTAATCAATATTGTTTAGAGCAGAAAGCATCAAAACCTGTTATTTCCCCTGATTTATCTGCTTATTTAGTACAATATGGCTGGCCTGGTAATGTTCGTCAATTAAGAAATACAATTTATCAAGCCATGGCTCAGTTAGTAGGCAATACATTGCGACCTCAAGATATCGCCTTGCCTGAGCATACTGCGGATACTTTATTTGATGAAGATTTGCTTGAAGGCTCGTTAGATGAAATGACTAAGCGATTTGAAGCTTCTATTTTAAGGCGTTTATATCGTGATTATCCAAGTACACGTAAACTGGCTAAACGTTTAGGTATTTCTCATACCGCGATCGCAAATAAATTACGTGAATATGATTTAACAAGTAAAAAAGCGGATAAAACAGAGAAATAATATTATATTACAATGTGTTAATGGTTTTTATTTAAATAAACGGGCTATAT