Homologs in group_998

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05580 FBDBKF_05580 100.0 Morganella morganii S1 tyrR transcriptional regulator TyrR
EHELCC_12010 EHELCC_12010 100.0 Morganella morganii S2 tyrR transcriptional regulator TyrR
NLDBIP_12350 NLDBIP_12350 100.0 Morganella morganii S4 tyrR transcriptional regulator TyrR
HKOGLL_10825 HKOGLL_10825 100.0 Morganella morganii S5 tyrR transcriptional regulator TyrR
F4V73_RS03725 F4V73_RS03725 92.2 Morganella psychrotolerans tyrR transcriptional regulator TyrR
PMI_RS06610 PMI_RS06610 61.8 Proteus mirabilis HI4320 tyrR transcriptional regulator TyrR

Distribution of the homologs in the orthogroup group_998

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_998

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZIB7 0.0 655 60 2 519 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P0A2D7 0.0 627 59 3 519 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 0.0 627 59 3 519 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
O54426 0.0 619 59 3 518 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P07604 0.0 617 59 3 518 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P44694 7.63e-91 283 46 1 312 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P12626 2.88e-67 229 37 3 317 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q06065 1.59e-66 225 36 3 319 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P12627 6.62e-65 223 39 4 315 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P24426 9.04e-65 217 44 1 244 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P29267 1.72e-64 220 37 4 326 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0AFB8 4.43e-64 219 36 6 374 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 4.43e-64 219 36 6 374 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P09570 1.02e-63 219 43 5 258 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P03029 1.88e-63 217 37 8 374 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P41789 2.47e-63 217 36 6 374 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9I4N3 6.69e-63 216 37 5 349 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54529 7.7e-63 221 39 4 324 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P30667 1.33e-62 219 42 3 280 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P09133 2.1e-62 218 41 1 267 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P54929 2.21e-62 218 43 1 248 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P54930 3.73e-62 215 43 2 256 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
Q00934 3.86e-62 213 36 4 315 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P26047 7.77e-62 217 34 5 355 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q9APD9 1.82e-61 211 36 2 307 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P03027 3.14e-61 213 41 4 275 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 3.9e-61 213 41 4 275 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P17899 5.24e-61 210 35 4 319 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q87MX7 5.32e-61 210 42 0 229 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
D5ARW9 5.73e-61 213 42 1 241 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 5.73e-61 213 42 1 241 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
Q7MM78 8.69e-61 210 42 0 231 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 8.69e-61 210 42 0 231 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q9KT84 9.02e-61 210 41 0 238 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0C5S5 9.25e-61 209 41 0 229 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 9.25e-61 209 41 0 229 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q9HU19 9.6e-61 210 38 4 322 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10577 1.8e-60 210 41 3 263 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P28787 2.09e-60 209 42 0 246 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P27713 2.68e-60 211 40 1 254 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q53206 2.83e-60 212 45 1 244 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q845S7 6.23e-60 205 39 1 263 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P38022 7.04e-60 207 34 5 327 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q7MFY9 1.84e-59 207 43 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q3K999 3.47e-59 203 39 0 246 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q43965 3.78e-59 208 44 0 227 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P23747 5.1e-59 205 37 4 318 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06519 5.12e-59 208 44 0 224 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q8D4F9 5.13e-59 206 43 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P05407 5.22e-59 208 46 2 239 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P25852 5.53e-59 204 38 0 244 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14375 1.4e-58 203 38 1 259 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q46802 2.03e-58 207 29 10 471 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
Q8Z333 3.4e-58 202 34 1 302 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q8X613 6.03e-58 202 33 1 302 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q04848 6.05e-58 203 41 3 252 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q01265 6.3e-58 197 44 2 227 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q88RJ6 8.23e-58 202 37 4 314 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P09828 1.52e-57 203 44 2 230 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
Q88AQ2 1.87e-57 201 37 5 317 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P54931 2.55e-57 204 44 1 228 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O25408 1.59e-56 196 39 1 251 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
Q6D8R9 4.85e-56 199 42 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0AFU5 7.46e-56 196 40 0 230 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 7.46e-56 196 40 0 230 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q9K4U8 1.16e-55 198 40 1 259 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
G3XCV0 3.58e-55 196 43 1 228 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10576 8.65e-55 194 40 3 250 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P71229 2.2e-54 197 34 2 331 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P19323 3.63e-54 197 34 4 318 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P03028 4.47e-54 194 45 1 227 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
O85057 7.67e-54 193 36 6 316 1 None Limonene hydroxylase Geobacillus stearothermophilus
C0PWN2 8.85e-54 192 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
Q5E3W8 1.99e-53 191 34 6 322 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
A8ANR6 2.61e-53 191 41 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WDR5 2.98e-53 191 41 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B5F363 4.31e-53 191 40 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
P13632 5.24e-53 189 33 2 310 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P45671 7.32e-53 189 40 1 225 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q8Z4C6 7.43e-53 190 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 7.43e-53 190 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 7.43e-53 190 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 7.43e-53 190 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 7.51e-53 190 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 8.32e-53 190 40 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
E1WAA4 9.26e-53 193 32 2 314 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
A4STH5 1.03e-52 189 41 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
B5FSZ0 1.06e-52 189 39 1 252 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P0CL46 1.23e-52 193 32 3 316 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZMJ8 1.39e-52 189 40 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.39e-52 189 40 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
A9MFX7 1.81e-52 189 39 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6TCX4 2.5e-52 189 41 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TF23 4.08e-52 188 40 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
P37931 5.46e-52 182 43 1 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
B5XVA2 1.23e-51 187 41 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P36219 2.86e-51 181 41 1 208 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
B4T3B0 2.89e-51 186 39 2 258 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B5Z370 5.41e-51 185 39 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 5.41e-51 185 39 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
Q32CL9 5.46e-51 185 41 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
Q9K4V0 6.16e-51 185 41 1 235 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P59402 6.7e-51 184 41 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 6.7e-51 184 41 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
A0KEJ0 7.39e-51 184 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P37013 1.39e-50 184 39 1 253 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.39e-50 184 39 1 253 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.39e-50 184 39 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B1LQ27 1.86e-50 183 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
A8GG93 2.88e-50 183 34 4 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
P26316 3.17e-50 177 42 1 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
Q0TEH1 3.44e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MZ04 3.55e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q1R7Z1 3.73e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 3.73e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 3.73e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N6T9 3.85e-50 182 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FEN6 3.85e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHC1 4.09e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P37344 4.53e-50 177 39 2 233 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
Q3YYF5 4.92e-50 182 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B6I695 4.92e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B7NSI9 5.39e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7M9E6 5.45e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
A7ZQD8 6.48e-50 182 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
P37930 7.16e-50 177 43 1 209 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
B7LEC0 7.71e-50 182 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
A8A3I6 8.03e-50 182 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
Q31X73 8.28e-50 181 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B1IUX0 8.28e-50 181 40 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
O31551 9.45e-50 183 41 3 229 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
B7LW25 1.35e-49 181 38 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q9KN48 2.34e-48 178 41 0 225 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P77743 2.25e-47 176 40 8 275 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P10046 2.86e-47 173 36 3 285 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P31908 3.08e-47 174 36 6 330 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q04849 5.27e-47 173 32 6 319 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P28614 1.89e-46 175 44 5 216 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P74839 2.13e-46 173 39 4 243 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87455 1.42e-43 165 37 0 229 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q4UL27 1.09e-41 159 33 5 301 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68WH4 2.23e-41 158 33 6 302 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 2.56e-41 157 33 5 301 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P26408 2.57e-41 158 29 7 354 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q1RJS1 5.38e-41 157 32 7 349 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q92HC2 4.4e-34 137 32 6 309 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P38035 1.33e-33 137 34 5 235 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 2.09e-31 132 26 7 377 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P54156 1.2e-30 125 32 8 266 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P76016 1.9e-29 125 26 9 387 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P09432 1.46e-27 119 31 5 247 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P23914 2.52e-20 98 26 5 212 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P55610 6.65e-19 93 23 4 308 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D0ZLR9 2.65e-15 82 32 4 153 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P06184 6.01e-10 65 23 7 313 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12210
Feature type CDS
Gene tyrR
Product transcriptional regulator TyrR
Location 56084 - 57670 (strand: 1)
Length 1587 (nucleotides) / 528 (amino acids)

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_998
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF18024 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3283 Transcription (K)
Amino acid transport and metabolism (E)		 KE Transcriptional regulator TyrR of aromatic amino acids metabolism

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03721 transcriptional regulator of aroF, aroG, tyrA and aromatic amino acid transport - -

Protein Sequence

MRLEVICQDRIGLTRELLDLLVLQNIDLKGIEIARNGRIYLNFMQIDFSVFQSLMAEIRRIQGVVDVRTVHFMPSEREQRAMWALLESLEDPILSLDLRGNIELANSAALSLFATTEERIRQRNITYYFSQFNFTRWIEDEEPAPYKENITLKGRSYTLSVTPINFDEKDDASATIGAVVLLRTVSESSNGQKRRMQVMHSGSFDDLVAKSAKMRHVVEQAQRMAKMDSPLLLVGETGTGKDVFAKACHLYSVRGNQPFLGLNCASMPDDVVETELFGYAAGAYANSTEPKKGFFEQANGGTVLLDEIAEMSPQMQIKLLRFLNDGTFRRVGEEHEVKVDVRVICATQKNLLELVKEGKFREDLYYRLNVLTLTIPPLREHQEDILPLTRDFVKRFSEEQGCEEPRLAPELGQFLCAYHWPGNVRQLRNVIYQALSSLEGSLLRPQDIVLPELEAEIGFSEDILSGSLDDITKRFECSVLTRLYRHYPSTRKLAKRLNVSHTAIANKLREYGLSQRRGAAKDDEGEEE

Flanking regions ( +/- flanking 50bp)

GTTTCAATTAACGGGAAAATAATAACTTAAGTGTAAATAGGATCGTAACGATGCGATTGGAAGTAATTTGCCAGGACCGAATCGGACTGACGCGGGAGTTATTGGATCTGCTGGTATTACAAAATATCGACCTCAAAGGCATCGAAATTGCCCGTAATGGCCGGATATACCTCAATTTTATGCAGATCGATTTTTCTGTGTTCCAGTCTCTGATGGCTGAGATCCGCCGGATTCAGGGCGTGGTGGATGTCAGAACTGTTCACTTTATGCCGTCTGAGCGCGAACAGCGCGCCATGTGGGCGTTACTCGAATCCCTGGAAGACCCGATTTTATCTCTCGACCTGCGCGGGAATATTGAACTGGCCAACAGCGCGGCACTCTCCCTGTTTGCCACCACCGAAGAGCGCATTCGTCAGCGCAATATCACGTACTATTTCAGCCAGTTCAACTTTACCCGCTGGATTGAGGATGAAGAACCCGCGCCATACAAGGAAAACATCACTCTCAAAGGCCGCTCTTACACCCTGAGTGTGACGCCGATTAATTTTGATGAGAAAGATGATGCCTCCGCCACTATCGGCGCGGTTGTGCTGCTGCGCACTGTCAGTGAGAGCAGCAACGGGCAGAAACGTCGTATGCAGGTGATGCATTCCGGCAGTTTTGATGATTTGGTGGCGAAAAGCGCCAAAATGCGCCATGTGGTCGAACAGGCACAGCGCATGGCAAAAATGGATTCCCCGCTGTTACTGGTCGGTGAAACCGGGACCGGGAAAGATGTGTTTGCCAAAGCCTGTCATCTCTACAGTGTGCGCGGCAATCAGCCGTTCCTCGGGCTGAACTGTGCCTCGATGCCGGATGATGTGGTGGAAACCGAACTGTTCGGTTACGCTGCTGGTGCTTACGCCAACAGTACTGAGCCGAAAAAAGGCTTCTTTGAGCAGGCTAACGGCGGCACCGTTCTGCTGGATGAAATCGCGGAAATGTCCCCGCAGATGCAGATCAAGCTGCTGCGCTTCCTGAATGACGGTACATTCCGCCGTGTCGGGGAAGAGCATGAGGTGAAAGTGGATGTGCGGGTTATCTGTGCGACCCAGAAAAATCTGCTGGAGCTGGTGAAAGAGGGCAAATTCCGTGAGGATCTCTATTACCGCCTCAATGTGCTGACGCTGACCATTCCGCCGCTGCGCGAGCATCAGGAAGATATCCTGCCGCTGACCCGCGATTTCGTGAAACGCTTTTCCGAAGAGCAGGGTTGTGAAGAACCGCGCCTGGCGCCGGAGCTGGGGCAGTTCCTTTGTGCTTATCACTGGCCGGGCAACGTCCGTCAGCTGCGTAATGTGATTTATCAGGCGCTCTCTTCGCTGGAAGGCTCGCTGCTGCGTCCGCAGGACATCGTTCTGCCGGAACTGGAAGCGGAAATCGGTTTCAGTGAGGATATCCTCAGCGGCTCGCTGGATGATATCACCAAACGGTTTGAGTGCTCTGTACTGACACGGCTTTACCGCCACTATCCGAGCACCCGTAAGCTGGCGAAACGCCTGAATGTCTCACATACCGCGATCGCCAATAAACTGCGCGAATACGGGCTGAGTCAGCGGCGTGGCGCGGCAAAAGATGATGAGGGAGAGGAAGAATAATTTTTTCCCCGGTAAAAAAAAACCCCGCGACCGTCACCGGCCGCGGGGTT