Homologs in group_998

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05580 FBDBKF_05580 92.2 Morganella morganii S1 tyrR transcriptional regulator TyrR
EHELCC_12010 EHELCC_12010 92.2 Morganella morganii S2 tyrR transcriptional regulator TyrR
NLDBIP_12350 NLDBIP_12350 92.2 Morganella morganii S4 tyrR transcriptional regulator TyrR
LHKJJB_12210 LHKJJB_12210 92.2 Morganella morganii S3 tyrR transcriptional regulator TyrR
HKOGLL_10825 HKOGLL_10825 92.2 Morganella morganii S5 tyrR transcriptional regulator TyrR
PMI_RS06610 PMI_RS06610 61.8 Proteus mirabilis HI4320 tyrR transcriptional regulator TyrR

Distribution of the homologs in the orthogroup group_998

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_998

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZIB7 0.0 637 59 2 519 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P0A2D7 0.0 623 59 3 519 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 0.0 623 59 3 519 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
O54426 0.0 617 58 3 520 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P07604 0.0 612 58 3 518 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P44694 1.82e-90 283 46 1 312 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q06065 1.96e-67 228 36 3 325 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P12627 7.29e-64 220 37 5 336 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P54529 3.88e-63 222 37 6 372 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P12626 5.18e-63 218 35 4 330 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P24426 7.08e-63 212 44 1 244 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P29267 7.67e-63 216 38 6 325 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P54930 2.5e-61 213 44 1 240 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P0AFB8 6.9e-61 211 35 3 358 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 6.9e-61 211 35 3 358 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P09133 1.08e-60 213 41 1 258 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q00934 1.6e-60 209 35 4 315 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P41789 1.71e-60 209 37 4 344 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9I4N3 1.78e-60 209 42 0 246 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P09570 2.13e-60 211 42 4 257 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P03027 4.7e-60 209 40 4 275 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 5.05e-60 209 40 4 275 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P03029 6.5e-60 208 38 6 330 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q7MM78 7.37e-60 207 42 0 233 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 7.37e-60 207 42 0 233 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q87MX7 8.09e-60 207 41 0 229 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P26047 1.44e-59 211 34 3 350 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q9KT84 2.02e-59 206 41 0 238 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0C5S5 2.52e-59 206 41 0 229 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 2.52e-59 206 41 0 229 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P30667 1.81e-58 207 41 1 248 1 nifA Nif-specific regulatory protein Azospirillum brasilense
Q845S7 2.07e-58 201 39 1 263 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P54929 2.44e-58 207 41 1 248 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P28787 2.78e-58 204 41 0 246 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P27713 3.04e-58 205 39 1 262 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q53206 3.16e-58 206 44 1 244 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9APD9 5e-58 202 35 2 307 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
D5ARW9 6.83e-58 205 41 1 241 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 7.26e-58 205 41 1 241 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
Q7MFY9 9.11e-58 203 42 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P17899 1.49e-57 201 40 0 229 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8D4F9 2.59e-57 202 42 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P10577 3.84e-57 201 40 2 247 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q43965 4.35e-57 202 42 0 227 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P38022 4.94e-57 200 33 4 327 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q3K999 1.28e-56 196 39 0 246 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q9HU19 1.49e-56 199 37 3 308 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P09828 1.81e-56 200 44 2 230 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
O25408 3.04e-56 196 38 1 258 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P54931 4.81e-56 200 44 1 228 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P0AFU5 6.33e-56 197 40 0 230 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 6.33e-56 197 40 0 230 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q88RJ6 9.98e-56 196 40 1 274 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q01265 1.41e-55 191 42 2 227 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q04848 1.49e-55 196 41 5 255 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q46802 1.91e-55 199 28 11 471 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P23747 2.13e-55 195 35 4 318 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8X613 2.89e-55 195 30 3 349 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P14375 2.95e-55 195 35 2 279 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q88AQ2 3.29e-55 195 34 5 364 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P25852 3.49e-55 194 37 0 244 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P05407 5.56e-55 197 44 2 239 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P06519 1.68e-54 196 42 0 228 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q8Z333 1.87e-54 192 33 1 302 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
G3XCV0 1.63e-53 191 43 1 228 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5E3W8 2.03e-53 191 34 5 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9K4U8 5.34e-53 191 40 0 235 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6D8R9 7.95e-53 190 40 0 232 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P71229 2.26e-52 192 34 2 320 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P10576 4.43e-52 187 38 5 263 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
O85057 7.18e-52 188 35 7 320 1 None Limonene hydroxylase Geobacillus stearothermophilus
A4WDR5 4.59e-51 185 36 2 295 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
P45671 5.21e-51 184 37 3 240 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P03028 6.79e-51 185 44 1 227 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
P19323 6.86e-51 188 33 4 319 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P37931 7.88e-51 179 43 1 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
A8ANR6 8.8e-51 184 38 1 249 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0PWN2 1.13e-50 184 38 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
P36219 1.26e-50 179 41 1 208 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
A6TCX4 3.2e-50 183 40 0 230 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
O31551 3.67e-50 184 42 4 230 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
E1WAA4 5.11e-50 186 32 2 314 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
B5F363 6.13e-50 182 37 4 279 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A4STH5 6.55e-50 182 39 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
P0CL46 7.6e-50 185 32 3 316 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5RDG4 8.16e-50 182 37 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8Z4C6 8.85e-50 182 37 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 8.85e-50 182 37 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 8.85e-50 182 37 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 8.85e-50 182 37 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
Q5PF20 9.6e-50 181 37 3 278 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FSZ0 1.07e-49 181 37 2 272 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P37344 1.39e-49 176 38 3 234 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
B5XVA2 1.43e-49 181 39 2 239 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P13632 1.45e-49 180 32 4 333 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q8ZMJ8 1.7e-49 181 37 4 279 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.7e-49 181 37 4 279 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
A9MFX7 4.57e-49 180 39 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TF23 6.26e-49 179 37 4 279 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B5Z370 7.94e-49 179 37 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 7.94e-49 179 37 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
Q32CL9 1.33e-48 178 39 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
P59402 1.72e-48 178 39 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 1.72e-48 178 39 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q9K4V0 1.79e-48 178 40 1 235 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P37013 1.99e-48 178 37 1 253 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.99e-48 178 37 1 253 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.99e-48 178 37 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B1LQ27 2.95e-48 177 37 1 253 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
A8GG93 3.42e-48 177 33 4 321 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B7MZ04 4.21e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q1R7Z1 4.62e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 4.62e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 4.62e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0TEH1 4.81e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B4T3B0 4.89e-48 177 39 5 268 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
Q8FEN6 4.96e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9KN48 5.04e-48 177 41 0 225 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B7UHC1 5.06e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6I695 5.6e-48 177 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B7NSI9 6.52e-48 176 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7M9E6 6.93e-48 176 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q3YYF5 7.37e-48 176 39 2 238 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B7N6T9 8.32e-48 176 39 2 238 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A7ZQD8 8.58e-48 176 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
A0KEJ0 8.95e-48 176 38 0 229 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P26316 9.64e-48 171 41 1 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
B7LEC0 1.31e-47 176 39 2 238 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B1IUX0 1.33e-47 176 39 2 238 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3I6 1.44e-47 176 39 2 238 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
Q31X73 1.52e-47 176 39 2 238 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B7LW25 1.75e-47 175 37 3 262 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P28614 3.73e-47 177 42 5 238 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P10046 7.06e-47 172 32 5 325 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P74839 7.89e-47 174 39 4 239 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37930 1.12e-46 168 42 3 213 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P77743 1.18e-46 174 39 7 279 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P31908 4.15e-45 168 35 6 328 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q04849 1.56e-44 166 32 5 318 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O87455 1.77e-40 156 35 0 238 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q4UL27 1.39e-38 150 31 5 301 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZCY9 3.42e-38 149 31 5 301 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q68WH4 3.85e-38 149 31 6 302 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RJS1 1.22e-37 147 31 6 345 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P26408 9.9e-37 145 28 6 345 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P38035 1.45e-33 137 35 7 240 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 3.23e-32 134 27 10 382 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 5.92e-31 130 28 8 377 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
Q92HC2 1.05e-30 128 31 7 291 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P54156 1.28e-29 122 30 7 266 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P09432 6.51e-25 110 30 5 247 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P23914 2.48e-18 92 30 5 170 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P55610 2.64e-18 92 23 4 317 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
D0ZLR9 9.02e-16 84 32 4 153 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P06184 2.66e-09 62 23 7 313 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03725
Feature type CDS
Gene tyrR
Product transcriptional regulator TyrR
Location 789842 - 791437 (strand: 1)
Length 1596 (nucleotides) / 531 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_998
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF18024 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3283 Transcription (K)
Amino acid transport and metabolism (E)		 KE Transcriptional regulator TyrR of aromatic amino acids metabolism

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03721 transcriptional regulator of aroF, aroG, tyrA and aromatic amino acid transport - -

Protein Sequence

MRLEVICQDRIGLTRELLDLLVLQNIDLKGIEIAPNGRIYLNFMQIDFSVFQSLMAEIRRIQGVVDVRTVHFMPSEREQRAMWVLLESLEDPILSLDLRGNIELANSAALSLFATTEERIQQRNITYYFSQFNFSRWIEQDTPSAHKETLTLKGHTYSLNVTPISFDDKDDASAAIGAVVLLRAENNSVTGQKRRMQVAHSGSFDDLVAKSAKMRHVVEQAQRMAKMDSPLLLVGETGTGKDVFAKACHLYSVRGSQPFLGLNCASMPDDVVETELFGYAAGAYANSTEPKKGFFEQANGGTVLLDEIAEMSSQMQIKLLRFLNDGTFRRVGEEHEVKVDVRVICATQKNLLELVKEGKFREDLYYRLNVLTLTIPPLRDHQEDILPLTRDLVKRFSDEQECEEPRLAPELGPFLSAYHWPGNVRQLRNVIYQALSSLEGALLRPQDIVLPELEAEIGFSEDILSGSLDDITKRFECSVLTRLYRHYPSTRKLAKRLNVSHTAIANKLREYGLSRARGSAKNNGSDEDEEA

Flanking regions ( +/- flanking 50bp)

GTTCAATTAGCCGGAAAATAATAACTGTAAGTGTAAATAGGATCGTAATGATGCGATTGGAAGTAATTTGCCAGGACCGAATCGGACTGACGCGGGAGTTATTGGATCTGCTGGTATTGCAAAATATCGACCTGAAAGGCATTGAAATTGCCCCGAACGGTCGGATTTACCTTAATTTCATGCAGATTGATTTTTCTGTATTTCAGTCCCTTATGGCTGAGATCCGCCGTATTCAGGGCGTGGTGGATGTCAGAACCGTTCATTTTATGCCTTCAGAGCGCGAACAACGGGCGATGTGGGTATTACTCGAATCCCTGGAAGACCCGATTTTATCGTTGGATTTGCGCGGTAATATCGAGCTTGCCAACAGTGCGGCGCTGTCTCTGTTTGCCACCACAGAAGAGCGCATTCAGCAGCGCAATATCACCTATTACTTCAGCCAGTTTAATTTCAGCCGCTGGATTGAGCAGGATACCCCGTCTGCGCATAAAGAAACCCTGACACTCAAAGGGCACACTTACAGCCTGAACGTCACACCAATCAGCTTTGATGACAAAGACGATGCTTCTGCGGCTATCGGTGCGGTTGTTTTGTTGCGCGCAGAGAATAACAGCGTAACCGGGCAGAAACGCCGTATGCAGGTGGCCCACTCAGGCAGCTTTGATGATTTGGTGGCAAAAAGCGCCAAAATGCGCCATGTGGTTGAACAGGCGCAGCGCATGGCAAAAATGGACTCCCCGCTGTTACTGGTTGGTGAAACCGGTACCGGGAAAGACGTGTTTGCCAAAGCCTGCCACCTTTACAGTGTGCGCGGCAGCCAGCCGTTCCTGGGACTCAACTGCGCCTCCATGCCGGATGATGTGGTGGAAACCGAACTGTTTGGTTACGCCGCAGGGGCATACGCCAACAGCACCGAACCGAAAAAAGGCTTCTTTGAGCAAGCCAACGGCGGCACCGTCCTTCTGGATGAAATTGCCGAAATGTCATCACAGATGCAGATAAAACTGCTGCGGTTTCTCAATGACGGCACTTTTCGCCGTGTCGGGGAAGAGCATGAAGTAAAAGTGGATGTGCGGGTTATCTGTGCGACACAAAAAAATCTGCTGGAGCTGGTAAAAGAGGGGAAATTCCGCGAAGACCTTTATTACCGCCTCAATGTGCTGACGCTTACCATTCCGCCGCTGCGTGATCACCAGGAAGATATTCTTCCGCTGACCCGCGATTTGGTTAAGCGTTTTTCTGACGAGCAGGAGTGTGAAGAACCGCGCCTTGCCCCGGAGCTGGGGCCGTTTTTATCTGCCTATCACTGGCCGGGTAATGTCCGTCAGTTACGCAACGTGATTTATCAGGCACTTTCCTCACTGGAAGGTGCGCTGTTACGTCCGCAGGATATTGTTTTACCGGAGCTGGAAGCGGAAATTGGTTTCAGTGAGGACATTCTCAGCGGCTCGCTGGATGATATCACCAAGCGGTTTGAATGCTCGGTACTGACCCGTTTGTACCGCCACTATCCGAGTACCCGTAAGTTGGCGAAACGGCTTAATGTCTCCCATACCGCGATCGCAAATAAGTTGCGTGAATACGGGCTGAGCCGGGCGCGCGGCAGTGCAAAGAATAATGGCAGTGACGAAGACGAAGAAGCCTGAGTTATCTGTGGTGTAAAAAGTGCTGTAAAAAGAACCCCGCACCTTTTCCG