Homologs in group_1014

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05155 FBDBKF_05155 59.5 Morganella morganii S1 trpE anthranilate synthase component 1
EHELCC_12435 EHELCC_12435 59.5 Morganella morganii S2 trpE anthranilate synthase component 1
NLDBIP_12775 NLDBIP_12775 59.5 Morganella morganii S4 trpE anthranilate synthase component 1
LHKJJB_12635 LHKJJB_12635 59.5 Morganella morganii S3 trpE anthranilate synthase component 1
HKOGLL_11250 HKOGLL_11250 59.5 Morganella morganii S5 trpE anthranilate synthase component 1
F4V73_RS05610 F4V73_RS05610 60.1 Morganella psychrotolerans - anthranilate synthase component 1

Distribution of the homologs in the orthogroup group_1014

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1014

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P00898 0.0 608 61 7 513 1 trpE Anthranilate synthase component 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P00895 0.0 596 60 7 519 1 trpE Anthranilate synthase component 1 Escherichia coli (strain K12)
P00897 0.0 591 60 5 518 1 trpE Anthranilate synthase component 1 Serratia marcescens
Q9KST2 0.0 580 56 3 518 3 trpE Anthranilate synthase component 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q44689 0.0 579 55 4 502 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Rhopalosiphum maidis
P42387 0.0 572 54 4 506 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44697 0.0 561 53 6 508 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Diuraphis noxia
Q44598 0.0 560 55 6 508 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Schlechtendalia chinensis
Q44695 0.0 560 54 4 502 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P22099 0.0 558 54 5 516 3 trpE Anthranilate synthase component 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZER9 0.0 558 53 5 510 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Pemphigus spyrothecae
Q44691 0.0 557 53 4 513 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Rhopalosiphum padi
Q89A29 0.0 554 53 4 514 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P43761 5.53e-174 503 50 6 512 3 trpE Anthranilate synthase component 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZES2 2.41e-158 464 46 5 511 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Tetraneura caerulescens
P09785 1.19e-138 414 44 6 502 1 phnA Anthranilate synthase component 1, pyocyanine specific Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06557 1.69e-137 410 44 7 509 3 trpE Anthranilate synthase component 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O25869 5.9e-134 400 43 9 507 3 trpE Anthranilate synthase component 1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJU5 2.22e-132 397 43 9 506 3 trpE Anthranilate synthase component 1 Helicobacter pylori (strain J99 / ATCC 700824)
P14953 1.73e-75 249 36 10 416 3 trpE Anthranilate synthase component 1 Acetivibrio thermocellus
Q9X6J4 2.58e-75 249 38 9 406 3 trpE Anthranilate synthase component 1 Geobacillus stearothermophilus
Q08653 2.19e-74 246 37 10 372 3 trpE Anthranilate synthase component 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P20579 8.81e-74 245 37 9 389 3 trpE Anthranilate synthase component 1 Pseudomonas putida
P30526 1.71e-73 244 38 8 387 3 trpE Anthranilate synthase component 1 Bacillus caldotenax
O66849 3.96e-73 243 33 16 539 3 trpE Anthranilate synthase component 1 Aquifex aeolicus (strain VF5)
P03963 5.39e-72 241 35 12 448 3 trpE Anthranilate synthase component 1 Bacillus subtilis (strain 168)
A0QX93 7.28e-72 241 40 11 380 1 trpE Anthranilate synthase component 1 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9X7C5 1.01e-71 241 35 14 481 3 trpE Anthranilate synthase component 1 Mycobacterium leprae (strain TN)
P9WFX3 2.54e-71 239 40 12 385 1 trpE Anthranilate synthase component 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX2 2.54e-71 239 40 12 385 1 trpE Anthranilate synthase component 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67002 2.54e-71 239 40 12 385 3 trpE Anthranilate synthase component 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P21689 1.6e-70 237 35 12 403 3 trpE Anthranilate synthase component 1 Pseudomonas savastanoi
P23315 5.33e-70 235 36 9 389 3 trpE Anthranilate synthase component 1 Acinetobacter calcoaceticus
P20580 7.57e-70 234 37 9 391 1 trpE Anthranilate synthase component 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P56995 2.78e-69 233 37 7 380 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9XAZ0 5.24e-69 232 37 7 380 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P96556 1.29e-67 230 38 11 384 3 trpE Anthranilate synthase component 1 Arthrobacter globiformis
Q9S358 1.67e-67 228 37 7 380 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P05378 9.17e-67 226 38 11 385 3 trpE Anthranilate synthase component 1 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9WW00 2.16e-66 226 37 7 377 3 trpE Anthranilate synthase component 1 Neisseria gonorrhoeae
Q5F8B4 2.16e-66 226 37 7 377 3 trpE Anthranilate synthase component 1 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q02001 1.99e-65 222 37 6 372 3 trpE Anthranilate synthase component 1 Lactococcus lactis subsp. lactis (strain IL1403)
P20170 1.22e-64 221 37 12 401 3 trpE Anthranilate synthase component 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P18267 1.76e-64 221 36 7 380 3 trpE Anthranilate synthase component 1 Bacillus pumilus
Q58475 2.43e-64 219 36 8 379 3 trpE Anthranilate synthase component 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5V213 1.57e-63 219 39 9 359 3 trpE2 Anthranilate synthase component 1 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
O94582 2.19e-63 218 35 7 374 1 trp3 Probable anthranilate synthase component 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P21690 7.21e-62 213 43 4 270 3 trpE Anthranilate synthase component 1 Spirochaeta aurantia
Q9YGB3 1.08e-61 211 43 4 277 3 trpE Anthranilate synthase component 1 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P00899 1.27e-61 213 35 7 378 1 TRP2 Anthranilate synthase component 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q06128 3.36e-61 210 34 8 395 1 trpE Anthranilate synthase component 1 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P95646 4.09e-61 212 38 7 371 3 trpE Anthranilate synthase component 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9Z4W7 1.3e-60 211 35 10 405 3 trpE Anthranilate synthase component 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O27692 8.87e-60 207 35 8 393 3 trpE Anthranilate synthase component 1 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P26940 3.05e-59 206 35 9 407 3 trpE Anthranilate synthase component 1 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
P28820 1.58e-58 204 34 7 382 1 pabB Aminodeoxychorismate synthase component 1 Bacillus subtilis (strain 168)
Q5V448 5.92e-57 200 34 7 383 3 trpE1 Anthranilate synthase component 1 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P74130 1.41e-56 199 35 8 369 3 trpE2 Anthranilate synthase component I-like protein Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HPG5 4.27e-55 196 36 8 378 3 trpE1 Anthranilate synthase component 1 1 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P32069 9.04e-54 194 34 11 409 2 ASA2 Anthranilate synthase alpha subunit 2, chloroplastic Arabidopsis thaliana
Q5V631 8.95e-53 189 34 7 379 3 trpE3 Anthranilate synthase component 1 3 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P32068 1.47e-52 191 34 10 399 1 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Arabidopsis thaliana
P15395 2.19e-52 192 31 12 481 4 trpE(G) Anthranilate synthase Rhizobium meliloti (strain 1021)
A2XNK3 5.23e-52 189 34 11 399 3 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Oryza sativa subsp. indica
Q94GF1 6.35e-52 189 34 11 399 1 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Oryza sativa subsp. japonica
P50872 3.76e-51 189 29 10 510 4 trpE(G) Anthranilate synthase Azospirillum brasilense
P72539 3.75e-49 183 34 7 357 3 papA Aminodeoxychorismate synthase Streptomyces pristinaespiralis
P33975 6.84e-49 179 38 9 353 3 trpE Anthranilate synthase component 1 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9Y8T0 1.15e-47 174 42 6 259 3 trpE Anthranilate synthase component 1 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q9XJ29 1.72e-47 177 33 10 402 1 ASA2 Anthranilate synthase alpha subunit 2, chloroplastic Oryza sativa subsp. japonica
Q8LPN3 2.41e-47 180 30 6 361 1 ADCS Aminodeoxychorismate synthase, chloroplastic Arabidopsis thaliana
O28669 3.88e-47 172 34 11 378 3 trpE Anthranilate synthase component 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P20463 4.8e-45 167 34 6 294 3 trpE Anthranilate synthase component 1 Leptospira biflexa
Q8GMH4 6.72e-45 168 33 8 363 1 sgcD 2-amino-4-deoxychorismate synthase Streptomyces globisporus
P05041 1.35e-43 163 31 8 374 1 pabB Aminodeoxychorismate synthase component 1 Escherichia coli (strain K12)
Q6TAS3 7.62e-43 167 30 8 364 1 ADCS Aminodeoxychorismate synthase, chloroplastic Solanum lycopersicum
P12680 1.2e-42 161 31 7 367 3 pabB Aminodeoxychorismate synthase component 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P27630 1.86e-42 160 33 10 377 3 pabB Aminodeoxychorismate synthase component 1 Streptomyces lividans
P12679 3.82e-42 159 31 9 373 3 pabB Aminodeoxychorismate synthase component 1 Klebsiella aerogenes
Q5Z856 1.11e-39 157 29 9 384 2 ADCS Probable aminodeoxychorismate synthase, chloroplastic Oryza sativa subsp. japonica
Q9HS66 5.47e-39 151 37 5 268 3 trpE2 Anthranilate synthase component 1 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P32483 2.63e-36 146 30 6 344 3 pabAB Aminodeoxychorismate synthase Streptomyces griseus
F2RB79 4.15e-36 145 30 6 359 1 cmlB Aminodeoxychorismate synthase Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745)
P27629 7.45e-36 142 30 10 374 3 pabB Aminodeoxychorismate synthase component 1 Lactococcus lactis subsp. lactis
O94277 3.4e-23 107 26 8 286 3 SPBP8B7.29 Putative aminodeoxychorismate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23973 4.45e-23 105 28 6 288 3 menF Isochorismate synthase MenF Bacillus subtilis (strain 168)
Q73XV3 3.3e-20 96 29 7 271 3 mbtI Salicylate synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WFW9 1.54e-17 87 28 9 268 1 menF Putative isochorismate synthase MenF Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFW8 1.54e-17 87 28 9 268 3 menF Putative isochorismate synthase MenF Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P37254 2.3e-17 89 26 21 422 1 ABZ1 Aminodeoxychorismate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P00896 2.61e-17 82 40 3 138 3 trpE Anthranilate synthase component 1 (Fragment) Citrobacter freundii
Q57527 4.54e-16 82 31 10 231 4 HI_1170 Uncharacterized PabA-like protein HI_1170 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q51508 1.96e-15 82 26 7 296 1 pchA Salicylate biosynthesis isochorismate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9M9V6 9.06e-15 80 36 6 175 1 ICS2 Isochorismate synthase 2, chloroplastic Arabidopsis thaliana
P9WFX1 2.33e-14 79 28 4 219 1 mbtI Salicylate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX0 2.33e-14 79 28 4 219 3 mbtI Salicylate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYQ1 2.33e-14 79 28 4 219 3 mbtI Salicylate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45744 3.74e-14 77 26 6 279 1 dhbC Isochorismate synthase DhbC Bacillus subtilis (strain 168)
Q9ZPC0 8.27e-14 77 26 13 344 1 None Isochorismate synthase, chloroplastic Catharanthus roseus
Q9S7H8 1.4e-13 77 31 7 225 1 ICS1 Isochorismate synthase 1, chloroplastic Arabidopsis thaliana
O07898 3.08e-13 75 26 8 288 3 vibC Vibriobactin-specific isochorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P38051 8.79e-13 73 27 11 274 1 menF Isochorismate synthase MenF Escherichia coli (strain K12)
Q51519 1.08e-12 74 27 11 287 4 phzB Anthranilate synthase, phenazine specific Pseudomonas chlororaphis
Q9CPI5 1.84e-12 72 25 16 415 3 menF Isochorismate synthase MenF Pasteurella multocida (strain Pm70)
Q51791 2.52e-12 73 27 12 289 4 phzE Anthranilate synthase, phenazine specific Pseudomonas fluorescens
Q9CKY6 6.54e-11 67 29 9 229 4 PM1464 Uncharacterized PabA-like protein PM1464 Pasteurella multocida (strain Pm70)
P44613 1.08e-09 64 22 6 289 3 menF Isochorismate synthase MenF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23300 7.02e-09 61 22 6 280 3 amoA Putative isochorismate synthase Aeromonas hydrophila
P0AEJ2 6.12e-07 55 27 8 228 1 entC Isochorismate synthase EntC Escherichia coli (strain K12)
P0AEJ3 6.12e-07 55 27 8 228 3 entC Isochorismate synthase EntC Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06480
Feature type CDS
Gene -
Product anthranilate synthase component 1
Location 1421585 - 1423162 (strand: 1)
Length 1578 (nucleotides) / 525 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1014
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00425 chorismate binding enzyme
PF04715 Anthranilate synthase component I, N terminal region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0147 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)
EH Anthranilate/para-aminobenzoate synthases component I

Kegg Ortholog Annotation(s)

Protein Sequence

MNTSLAFPLTTKVTALPYHSEPALLFNTLCEHRHHTLLLESAQIDTKANLKSLLIVDSALRISANKNQVTVDALSLNGQHILALLKNALKEKSTLSVERAEQCVFTFASSSFPQDEESKLKAASVFDVLRFFLANSAAKEANAIFVGGLFAYDLVNGFESLPDLEAVFSCPDYCFYLAEQLIVIDHQHHHSQLISVAFTDNPQECQRLDTRQAQLVALAQQPLKQPQRQPLTPQQAVVSSNMNDEEYGAIVEAMKTYIRRGDIFQVVPSRRFQINCPSPLAAYQVLKQKNPSPYLFYMQDALFTVFGASPESALKYQASDRQIEIYPIAGTRPRGRNADGSINADLDSRIELEMRTDTKELSEHLMLVDLARNDLARICQAGSRYVAELTKVDRYAFVMHLVSRVVGTLRHDLDIFHAYQACMNMGTLSGAPKVSAMQLIAQYEKTKRGSYGGAIGYFTGNGDFDTCIVIRSAYVEKDIATIQVGAGIVLDSDPKMEAEETRNKSQAVINAILQAHAETHMQEAC

Flanking regions ( +/- flanking 50bp)

GCCAATTTTGTGCTTATCAGCACCAGAAAAAAGAAAATAGAGCGATAATAATGAACACTTCACTTGCATTCCCATTAACAACTAAGGTAACGGCATTGCCTTATCACAGCGAGCCGGCGTTACTTTTCAATACGTTGTGTGAACATCGTCATCACACCTTATTGTTAGAATCCGCACAAATTGATACCAAAGCCAATTTAAAAAGTTTGTTAATCGTTGATAGTGCATTACGTATTAGTGCAAACAAAAATCAAGTGACTGTCGATGCGTTAAGTCTCAACGGCCAACATATCTTAGCGTTATTAAAAAACGCACTAAAAGAAAAAAGCACACTCTCCGTAGAGCGAGCGGAACAATGTGTATTTACTTTTGCATCATCATCTTTCCCTCAAGATGAAGAGAGCAAGTTAAAAGCGGCTAGCGTATTTGATGTTTTACGTTTTTTCCTAGCAAATAGCGCTGCAAAAGAAGCCAATGCTATTTTTGTGGGAGGGTTATTTGCCTATGATTTAGTGAACGGATTTGAATCCTTACCTGATTTAGAAGCGGTTTTTTCTTGCCCTGACTACTGTTTTTATTTAGCTGAACAGTTAATTGTGATCGACCATCAACATCATCATAGCCAATTAATTTCCGTTGCCTTTACGGATAATCCACAAGAGTGTCAGCGTCTTGATACCCGTCAGGCACAATTAGTTGCACTCGCACAGCAACCTTTAAAACAACCACAACGTCAACCATTAACACCTCAGCAAGCGGTTGTAAGTAGCAATATGAATGACGAAGAGTATGGTGCTATTGTTGAAGCGATGAAAACCTATATTCGTCGTGGCGATATTTTCCAAGTTGTTCCATCACGTCGTTTTCAAATTAACTGCCCTTCACCACTGGCTGCCTATCAAGTTTTGAAACAAAAAAACCCCAGTCCCTATTTGTTTTATATGCAAGATGCGTTATTTACCGTTTTTGGTGCGTCACCTGAAAGTGCGTTGAAATATCAAGCAAGTGATCGCCAAATTGAAATTTATCCTATCGCAGGTACACGCCCAAGAGGTCGCAATGCCGACGGCTCAATCAATGCTGATTTAGATAGCCGCATTGAGCTTGAAATGCGCACAGATACCAAAGAGTTATCAGAACACCTTATGTTGGTTGATTTAGCACGCAACGATTTAGCGCGTATCTGCCAAGCTGGAAGCCGTTATGTCGCCGAATTAACCAAAGTAGATCGCTACGCTTTTGTTATGCACTTAGTATCAAGAGTGGTAGGAACATTACGTCATGACTTAGATATTTTTCATGCCTATCAAGCCTGTATGAATATGGGGACACTCTCAGGAGCACCGAAGGTCAGTGCTATGCAACTGATTGCACAATATGAAAAAACCAAACGAGGCAGTTATGGCGGTGCAATTGGCTACTTTACTGGTAACGGTGATTTTGATACTTGCATAGTTATTCGTTCTGCTTATGTAGAAAAAGATATTGCAACTATTCAAGTGGGCGCTGGTATTGTGCTCGATTCTGATCCCAAAATGGAGGCAGAAGAAACTCGCAATAAATCACAAGCGGTTATCAATGCCATTTTACAGGCGCATGCTGAAACGCATATGCAGGAGGCTTGCTAATGGCGACGCTCTTACTACTCGATAATATCGACTCTTTTACTTATAACTTA