Homologs in group_1014

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05155 FBDBKF_05155 84.7 Morganella morganii S1 trpE anthranilate synthase component 1
EHELCC_12435 EHELCC_12435 84.7 Morganella morganii S2 trpE anthranilate synthase component 1
NLDBIP_12775 NLDBIP_12775 84.7 Morganella morganii S4 trpE anthranilate synthase component 1
LHKJJB_12635 LHKJJB_12635 84.7 Morganella morganii S3 trpE anthranilate synthase component 1
HKOGLL_11250 HKOGLL_11250 84.7 Morganella morganii S5 trpE anthranilate synthase component 1
PMI_RS06480 PMI_RS06480 60.1 Proteus mirabilis HI4320 - anthranilate synthase component 1

Distribution of the homologs in the orthogroup group_1014

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1014

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P00898 0.0 632 62 3 524 1 trpE Anthranilate synthase component 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P00895 0.0 623 63 1 504 1 trpE Anthranilate synthase component 1 Escherichia coli (strain K12)
P00897 0.0 607 60 1 504 1 trpE Anthranilate synthase component 1 Serratia marcescens
Q9KST2 0.0 603 60 1 502 3 trpE Anthranilate synthase component 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P22099 0.0 574 58 4 507 3 trpE Anthranilate synthase component 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q89A29 0.0 571 54 1 502 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q44598 0.0 570 53 0 497 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Schlechtendalia chinensis
Q9ZER9 0.0 558 54 1 503 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Pemphigus spyrothecae
Q44689 0.0 550 52 4 500 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Rhopalosiphum maidis
P42387 0.0 544 51 1 499 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44697 0.0 533 51 3 501 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Diuraphis noxia
P43761 0.0 532 53 7 518 3 trpE Anthranilate synthase component 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q44695 0.0 526 52 4 501 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q44691 2.12e-179 517 50 2 499 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Rhopalosiphum padi
Q9ZES2 1.38e-164 479 47 7 510 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Tetraneura caerulescens
P09785 1.97e-147 436 49 7 498 1 phnA Anthranilate synthase component 1, pyocyanine specific Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06557 1.14e-145 431 48 9 514 3 trpE Anthranilate synthase component 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O25869 5.38e-139 413 46 8 508 3 trpE Anthranilate synthase component 1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJU5 3.63e-138 411 45 8 507 3 trpE Anthranilate synthase component 1 Helicobacter pylori (strain J99 / ATCC 700824)
P14953 5.13e-82 266 39 8 393 3 trpE Anthranilate synthase component 1 Acetivibrio thermocellus
P03963 5.36e-78 256 36 11 437 3 trpE Anthranilate synthase component 1 Bacillus subtilis (strain 168)
A0QX93 1.43e-74 248 36 15 512 1 trpE Anthranilate synthase component 1 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q08653 5.13e-74 244 38 9 378 3 trpE Anthranilate synthase component 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P9WFX3 1.97e-72 242 36 16 513 1 trpE Anthranilate synthase component 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX2 1.97e-72 242 36 16 513 1 trpE Anthranilate synthase component 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67002 1.97e-72 242 36 16 513 3 trpE Anthranilate synthase component 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X6J4 2.57e-72 241 37 9 392 3 trpE Anthranilate synthase component 1 Geobacillus stearothermophilus
O66849 4.01e-72 240 32 14 537 3 trpE Anthranilate synthase component 1 Aquifex aeolicus (strain VF5)
P20579 3.82e-71 238 33 11 505 3 trpE Anthranilate synthase component 1 Pseudomonas putida
Q9X7C5 5.08e-71 238 35 17 514 3 trpE Anthranilate synthase component 1 Mycobacterium leprae (strain TN)
P21689 1.12e-70 237 37 7 380 3 trpE Anthranilate synthase component 1 Pseudomonas savastanoi
P30526 4.36e-70 236 37 8 388 3 trpE Anthranilate synthase component 1 Bacillus caldotenax
P20580 1.02e-69 234 37 8 399 1 trpE Anthranilate synthase component 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P18267 1.66e-69 234 37 7 383 3 trpE Anthranilate synthase component 1 Bacillus pumilus
P23315 4e-69 233 37 9 383 3 trpE Anthranilate synthase component 1 Acinetobacter calcoaceticus
P21690 9.01e-69 231 39 6 352 3 trpE Anthranilate synthase component 1 Spirochaeta aurantia
Q9Z4W7 3.21e-68 231 37 9 403 3 trpE Anthranilate synthase component 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P00899 3.27e-67 228 39 9 380 1 TRP2 Anthranilate synthase component 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O94582 1.61e-66 226 35 10 415 1 trp3 Probable anthranilate synthase component 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P20170 3.58e-66 225 31 16 548 3 trpE Anthranilate synthase component 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9XAZ0 3.88e-66 224 37 7 386 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P05378 4.44e-66 224 36 11 450 3 trpE Anthranilate synthase component 1 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P56995 1.95e-65 223 37 7 386 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P28820 9.63e-65 220 36 10 399 1 pabB Aminodeoxychorismate synthase component 1 Bacillus subtilis (strain 168)
Q02001 1.35e-64 219 35 11 406 3 trpE Anthranilate synthase component 1 Lactococcus lactis subsp. lactis (strain IL1403)
P96556 1.91e-64 221 47 8 269 3 trpE Anthranilate synthase component 1 Arthrobacter globiformis
Q9S358 7.65e-64 219 36 7 386 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q58475 3.75e-63 216 33 9 416 3 trpE Anthranilate synthase component 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9WW00 8.29e-62 213 36 7 386 3 trpE Anthranilate synthase component 1 Neisseria gonorrhoeae
Q5F8B4 8.29e-62 213 36 7 386 3 trpE Anthranilate synthase component 1 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A2XNK3 1.36e-59 209 37 13 418 3 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Oryza sativa subsp. indica
Q94GF1 4.64e-59 208 37 13 418 1 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Oryza sativa subsp. japonica
O27692 8.61e-59 204 34 10 395 3 trpE Anthranilate synthase component 1 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9YGB3 1.39e-58 203 43 4 276 3 trpE Anthranilate synthase component 1 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5V213 3.04e-57 202 38 13 397 3 trpE2 Anthranilate synthase component 1 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P26940 1.77e-56 198 33 10 407 3 trpE Anthranilate synthase component 1 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q06128 8.73e-56 195 34 7 376 1 trpE Anthranilate synthase component 1 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5V448 5.2e-55 195 37 9 383 3 trpE1 Anthranilate synthase component 1 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P95646 2.08e-54 194 44 4 279 3 trpE Anthranilate synthase component 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P32068 6.07e-54 194 34 11 421 1 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Arabidopsis thaliana
P74130 1.52e-53 191 34 7 367 3 trpE2 Anthranilate synthase component I-like protein Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5V631 7.41e-53 189 34 6 385 3 trpE3 Anthranilate synthase component 1 3 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P32069 2.81e-52 190 32 10 415 2 ASA2 Anthranilate synthase alpha subunit 2, chloroplastic Arabidopsis thaliana
P15395 9.01e-52 191 32 9 465 4 trpE(G) Anthranilate synthase Rhizobium meliloti (strain 1021)
P50872 1.29e-51 190 32 11 488 4 trpE(G) Anthranilate synthase Azospirillum brasilense
Q9XJ29 1.38e-51 188 33 14 437 1 ASA2 Anthranilate synthase alpha subunit 2, chloroplastic Oryza sativa subsp. japonica
Q9HPG5 2.73e-50 183 36 13 413 3 trpE1 Anthranilate synthase component 1 1 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
O28669 1.36e-49 179 39 6 277 3 trpE Anthranilate synthase component 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9Y8T0 2.68e-48 176 42 7 278 3 trpE Anthranilate synthase component 1 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8GMH4 1.79e-47 175 38 4 277 1 sgcD 2-amino-4-deoxychorismate synthase Streptomyces globisporus
Q8LPN3 3.2e-46 176 30 8 381 1 ADCS Aminodeoxychorismate synthase, chloroplastic Arabidopsis thaliana
P72539 4.12e-46 175 33 5 357 3 papA Aminodeoxychorismate synthase Streptomyces pristinaespiralis
Q6TAS3 9.15e-46 175 31 7 352 1 ADCS Aminodeoxychorismate synthase, chloroplastic Solanum lycopersicum
P33975 2.16e-45 170 32 18 549 3 trpE Anthranilate synthase component 1 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P27630 3.47e-44 165 34 12 374 3 pabB Aminodeoxychorismate synthase component 1 Streptomyces lividans
P12680 3.03e-43 162 32 9 396 3 pabB Aminodeoxychorismate synthase component 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P20463 1.32e-42 161 33 13 375 3 trpE Anthranilate synthase component 1 Leptospira biflexa
P05041 4.33e-42 159 31 7 367 1 pabB Aminodeoxychorismate synthase component 1 Escherichia coli (strain K12)
P32483 2.43e-41 161 31 5 374 3 pabAB Aminodeoxychorismate synthase Streptomyces griseus
Q5Z856 4.99e-41 161 30 8 369 2 ADCS Probable aminodeoxychorismate synthase, chloroplastic Oryza sativa subsp. japonica
P12679 8.42e-40 153 31 9 382 3 pabB Aminodeoxychorismate synthase component 1 Klebsiella aerogenes
Q9HS66 4.38e-39 152 34 10 382 3 trpE2 Anthranilate synthase component 1 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
F2RB79 4.11e-38 151 30 7 388 1 cmlB Aminodeoxychorismate synthase Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745)
P27629 7.41e-37 145 36 8 271 3 pabB Aminodeoxychorismate synthase component 1 Lactococcus lactis subsp. lactis
O94277 1.48e-24 111 25 5 282 3 SPBP8B7.29 Putative aminodeoxychorismate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23973 1.3e-22 104 28 5 256 3 menF Isochorismate synthase MenF Bacillus subtilis (strain 168)
Q73XV3 1.19e-21 101 27 5 296 3 mbtI Salicylate synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P00896 5.68e-21 92 47 1 134 3 trpE Anthranilate synthase component 1 (Fragment) Citrobacter freundii
P37254 4.14e-17 88 29 11 274 1 ABZ1 Aminodeoxychorismate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9M9V6 1.42e-15 83 35 6 175 1 ICS2 Isochorismate synthase 2, chloroplastic Arabidopsis thaliana
Q9ZPC0 4.96e-15 81 28 11 305 1 None Isochorismate synthase, chloroplastic Catharanthus roseus
Q9S7H8 8.62e-15 80 31 7 225 1 ICS1 Isochorismate synthase 1, chloroplastic Arabidopsis thaliana
P45744 1.34e-14 79 29 7 270 1 dhbC Isochorismate synthase DhbC Bacillus subtilis (strain 168)
Q51508 1.36e-14 79 27 4 265 1 pchA Salicylate biosynthesis isochorismate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WFX1 1.65e-14 79 27 6 261 1 mbtI Salicylate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX0 1.65e-14 79 27 6 261 3 mbtI Salicylate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYQ1 1.65e-14 79 27 6 261 3 mbtI Salicylate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q57527 1.98e-14 77 30 9 215 4 HI_1170 Uncharacterized PabA-like protein HI_1170 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WFW9 2.98e-14 77 30 10 269 1 menF Putative isochorismate synthase MenF Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFW8 2.98e-14 77 30 10 269 3 menF Putative isochorismate synthase MenF Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9CPI5 3.11e-14 78 27 12 348 3 menF Isochorismate synthase MenF Pasteurella multocida (strain Pm70)
O07898 2.56e-13 75 27 10 286 3 vibC Vibriobactin-specific isochorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44613 1.06e-12 73 23 8 288 3 menF Isochorismate synthase MenF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q51519 3.39e-12 72 26 10 285 4 phzB Anthranilate synthase, phenazine specific Pseudomonas chlororaphis
Q9CKY6 5.72e-12 70 29 10 223 4 PM1464 Uncharacterized PabA-like protein PM1464 Pasteurella multocida (strain Pm70)
Q51791 9.86e-12 71 27 12 287 4 phzE Anthranilate synthase, phenazine specific Pseudomonas fluorescens
P38051 5.93e-11 68 26 9 265 1 menF Isochorismate synthase MenF Escherichia coli (strain K12)
P23300 2.61e-10 65 25 9 299 3 amoA Putative isochorismate synthase Aeromonas hydrophila
P0AEJ2 7.42e-07 55 28 9 215 1 entC Isochorismate synthase EntC Escherichia coli (strain K12)
P0AEJ3 7.42e-07 55 28 9 215 3 entC Isochorismate synthase EntC Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05610
Feature type CDS
Gene -
Product anthranilate synthase component 1
Location 1193482 - 1195041 (strand: 1)
Length 1560 (nucleotides) / 519 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1014
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00425 chorismate binding enzyme
PF04715 Anthranilate synthase component I, N terminal region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0147 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)
EH Anthranilate/para-aminobenzoate synthases component I

Kegg Ortholog Annotation(s)

Protein Sequence

MNSPIFTHITLIDYPVYQPDPAAVFTALCAQRPATLLLESAEITSKANLKSLLILHSALRIRCPGHTVTIEALNINGAALLPALHTQLAAKAVCEITENMLTVRFTPPAADTDEDTRLRADSVFDVLRTLMNLPSTPDDRRNLFCGGLFSYDLVAGFEALPAVTSVNNCPDYCFYLAETLLTIDHQQQTSELITLTFTDDKTEQVRLASQHNALLTMLADEITDSAVVSPVDINVTTSHSDEVFCRIVTDLKQSIVQGDIFQVVPSRRFQLPCPSPMAAYRVLKNRNPSPYLFYMQDSDFTLFGASPESALKYDPATRLIEIYPIAGTRPRGLHADGSVDADKDSRLELDLRTDQKELAEHFMLVDLARNDLARICRPGTRSVAELTKVDRYAFVMHLVSRVTGELRNDLDIFHAYQACMNMGTLTGAPKVRAMQLIAQTEKIRRGSYGGAVGYFRGDSTFDTCIVIRSAYVENGIATVQAGGGVVLDSDPQAEADENRNKARAVIRAITRAHHAEETF

Flanking regions ( +/- flanking 50bp)

ATGGCGGGTTTTTTTATGGCAAAAATACTCATGAGATAAGGTAAATAATAATGAACAGCCCGATTTTCACACATATAACCCTGATTGATTATCCGGTCTATCAGCCGGATCCTGCCGCTGTCTTTACCGCACTTTGTGCACAGCGCCCGGCAACGCTGTTATTAGAATCTGCTGAAATAACCTCCAAGGCAAATTTAAAAAGTCTGCTTATTCTGCACAGCGCCCTGCGGATACGCTGCCCGGGTCATACCGTGACCATAGAAGCCCTGAATATAAACGGAGCGGCGCTGTTACCGGCACTGCATACACAACTGGCAGCAAAAGCGGTATGTGAAATCACAGAGAACATGCTGACTGTCCGCTTCACACCCCCTGCGGCAGATACTGATGAAGATACCCGGCTGCGCGCAGATTCTGTATTTGATGTATTGCGCACCCTGATGAACCTGCCGTCAACGCCTGATGACCGCCGGAATTTATTCTGCGGCGGTCTGTTCAGTTATGATTTAGTAGCCGGTTTTGAAGCATTACCGGCTGTAACATCGGTAAATAATTGCCCGGATTACTGCTTTTATCTGGCAGAAACCCTGCTGACCATTGATCACCAACAACAGACCAGCGAGCTTATCACTCTCACATTTACTGACGACAAAACTGAACAGGTACGCCTGGCATCACAGCACAATGCGTTATTAACCATGCTGGCGGATGAAATCACCGATTCTGCGGTTGTGTCTCCGGTGGACATCAATGTGACAACGTCACATTCAGATGAGGTATTCTGCCGTATTGTCACTGACTTAAAACAATCCATTGTTCAGGGTGATATTTTTCAGGTCGTGCCGTCACGCCGCTTTCAGTTACCCTGCCCGTCGCCGATGGCCGCTTACCGGGTCCTGAAAAACCGCAATCCGAGCCCGTATCTGTTCTATATGCAGGACAGCGATTTCACCCTGTTCGGCGCATCACCGGAAAGTGCGCTGAAATATGACCCCGCAACCCGCCTGATTGAAATCTATCCGATTGCAGGTACCCGTCCCCGTGGATTGCATGCAGACGGCAGTGTGGATGCCGATAAAGACAGCCGCCTGGAACTGGATCTGCGCACTGACCAGAAAGAGCTTGCCGAACATTTTATGTTAGTGGATCTCGCCCGTAACGATCTCGCCCGTATCTGCCGCCCCGGCACCCGCAGCGTGGCAGAACTGACAAAAGTGGATCGCTATGCATTTGTGATGCATCTGGTGTCCCGCGTAACCGGCGAATTACGTAATGACCTGGATATTTTTCATGCTTATCAGGCCTGTATGAATATGGGCACACTGACCGGCGCGCCTAAAGTCCGCGCCATGCAACTGATTGCACAGACAGAAAAAATCCGCCGTGGCAGCTACGGTGGCGCGGTCGGCTACTTTCGCGGCGACAGTACATTTGATACCTGCATTGTTATCCGCTCCGCATATGTTGAAAACGGTATCGCCACCGTTCAGGCGGGCGGCGGCGTGGTACTGGATTCCGATCCGCAGGCAGAAGCCGATGAAAACCGCAACAAAGCCCGTGCGGTGATCCGCGCAATTACCCGCGCACATCACGCAGAGGAGACATTCTGATGGCTGATATTTTACTGCTCGATAATGTTGATTCTTTCACCTACAACCTG