Homologs in group_1014

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05155 FBDBKF_05155 100.0 Morganella morganii S1 trpE anthranilate synthase component 1
EHELCC_12435 EHELCC_12435 100.0 Morganella morganii S2 trpE anthranilate synthase component 1
NLDBIP_12775 NLDBIP_12775 100.0 Morganella morganii S4 trpE anthranilate synthase component 1
HKOGLL_11250 HKOGLL_11250 100.0 Morganella morganii S5 trpE anthranilate synthase component 1
F4V73_RS05610 F4V73_RS05610 84.7 Morganella psychrotolerans - anthranilate synthase component 1
PMI_RS06480 PMI_RS06480 59.5 Proteus mirabilis HI4320 - anthranilate synthase component 1

Distribution of the homologs in the orthogroup group_1014

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1014

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P00898 0.0 630 63 6 509 1 trpE Anthranilate synthase component 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P00895 0.0 613 62 4 509 1 trpE Anthranilate synthase component 1 Escherichia coli (strain K12)
P00897 0.0 609 61 3 507 1 trpE Anthranilate synthase component 1 Serratia marcescens
Q9KST2 0.0 602 60 2 502 3 trpE Anthranilate synthase component 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P22099 0.0 592 60 4 500 3 trpE Anthranilate synthase component 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZER9 0.0 582 55 3 505 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Pemphigus spyrothecae
Q89A29 0.0 581 54 3 504 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q44598 0.0 579 53 1 497 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Schlechtendalia chinensis
P42387 0.0 561 51 2 499 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44689 0.0 560 51 3 499 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Rhopalosiphum maidis
Q44697 0.0 551 51 4 501 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Diuraphis noxia
Q44695 0.0 545 52 3 499 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q44691 0.0 535 51 4 500 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Rhopalosiphum padi
P43761 1.68e-180 520 51 6 502 3 trpE Anthranilate synthase component 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZES2 7.48e-166 483 46 6 509 3 trpE Anthranilate synthase component 1 Buchnera aphidicola subsp. Tetraneura caerulescens
P06557 2.47e-154 453 49 10 516 3 trpE Anthranilate synthase component 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P09785 6.93e-149 439 48 7 494 1 phnA Anthranilate synthase component 1, pyocyanine specific Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25869 3.67e-139 414 45 8 496 3 trpE Anthranilate synthase component 1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJU5 6.49e-138 410 44 8 496 3 trpE Anthranilate synthase component 1 Helicobacter pylori (strain J99 / ATCC 700824)
P14953 4.07e-82 266 38 6 377 3 trpE Anthranilate synthase component 1 Acetivibrio thermocellus
P20579 2.41e-78 256 33 10 506 3 trpE Anthranilate synthase component 1 Pseudomonas putida
A0QX93 1.25e-76 253 36 15 504 1 trpE Anthranilate synthase component 1 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P21689 1.32e-76 253 33 13 500 3 trpE Anthranilate synthase component 1 Pseudomonas savastanoi
P03963 1.28e-75 250 36 8 389 3 trpE Anthranilate synthase component 1 Bacillus subtilis (strain 168)
Q08653 7.64e-75 246 37 10 378 3 trpE Anthranilate synthase component 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O66849 2.69e-74 246 38 9 393 3 trpE Anthranilate synthase component 1 Aquifex aeolicus (strain VF5)
P20580 7.29e-74 245 37 7 391 1 trpE Anthranilate synthase component 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P18267 7.92e-74 245 38 7 383 3 trpE Anthranilate synthase component 1 Bacillus pumilus
P9WFX3 4.02e-73 244 36 14 504 1 trpE Anthranilate synthase component 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX2 4.02e-73 244 36 14 504 1 trpE Anthranilate synthase component 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67002 4.02e-73 244 36 14 504 3 trpE Anthranilate synthase component 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X7C5 2.39e-72 242 35 16 514 3 trpE Anthranilate synthase component 1 Mycobacterium leprae (strain TN)
Q9XAZ0 5.71e-71 237 38 5 375 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P56995 2.3e-70 236 38 5 375 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P21690 3.35e-70 235 40 6 343 3 trpE Anthranilate synthase component 1 Spirochaeta aurantia
P23315 3.58e-70 235 38 10 383 3 trpE Anthranilate synthase component 1 Acinetobacter calcoaceticus
P30526 1.92e-69 234 37 9 387 3 trpE Anthranilate synthase component 1 Bacillus caldotenax
Q9X6J4 5.2e-69 233 36 7 388 3 trpE Anthranilate synthase component 1 Geobacillus stearothermophilus
Q9S358 4.01e-68 230 37 5 375 3 trpE Anthranilate synthase component 1 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P05378 7.53e-68 228 37 9 401 3 trpE Anthranilate synthase component 1 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P00899 9.05e-68 229 38 8 381 1 TRP2 Anthranilate synthase component 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P96556 1.19e-67 229 38 12 383 3 trpE Anthranilate synthase component 1 Arthrobacter globiformis
Q9Z4W7 1.85e-67 229 38 7 381 3 trpE Anthranilate synthase component 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O94582 1.97e-66 225 36 9 387 1 trp3 Probable anthranilate synthase component 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9WW00 5.63e-65 221 37 6 375 3 trpE Anthranilate synthase component 1 Neisseria gonorrhoeae
Q5F8B4 5.63e-65 221 37 6 375 3 trpE Anthranilate synthase component 1 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P20170 3.98e-64 219 31 14 516 3 trpE Anthranilate synthase component 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P28820 6.65e-64 218 37 7 367 1 pabB Aminodeoxychorismate synthase component 1 Bacillus subtilis (strain 168)
Q02001 1.15e-63 217 35 9 395 3 trpE Anthranilate synthase component 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q58475 6.35e-62 213 33 6 377 3 trpE Anthranilate synthase component 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5V213 5.76e-61 212 39 15 416 3 trpE2 Anthranilate synthase component 1 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q9YGB3 2.16e-60 208 43 4 276 3 trpE Anthranilate synthase component 1 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A2XNK3 3.99e-59 208 36 13 418 3 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Oryza sativa subsp. indica
Q5V448 1.34e-58 204 38 8 397 3 trpE1 Anthranilate synthase component 1 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q94GF1 1.65e-58 206 36 13 418 1 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Oryza sativa subsp. japonica
O27692 2.03e-57 201 35 8 372 3 trpE Anthranilate synthase component 1 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P26940 9.63e-57 199 34 11 408 3 trpE Anthranilate synthase component 1 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q5V631 4.26e-56 198 35 7 385 3 trpE3 Anthranilate synthase component 1 3 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P95646 6.17e-56 197 46 4 269 3 trpE Anthranilate synthase component 1 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P15395 1.11e-55 201 31 13 505 4 trpE(G) Anthranilate synthase Rhizobium meliloti (strain 1021)
P74130 1.37e-55 196 35 6 367 3 trpE2 Anthranilate synthase component I-like protein Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P32068 2.44e-54 196 33 11 421 1 ASA1 Anthranilate synthase alpha subunit 1, chloroplastic Arabidopsis thaliana
Q06128 1.28e-53 189 33 8 377 1 trpE Anthranilate synthase component 1 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P32069 3.58e-53 193 33 11 421 2 ASA2 Anthranilate synthase alpha subunit 2, chloroplastic Arabidopsis thaliana
Q9XJ29 6.77e-52 189 34 14 425 1 ASA2 Anthranilate synthase alpha subunit 2, chloroplastic Oryza sativa subsp. japonica
Q9HPG5 1.53e-51 186 37 13 417 3 trpE1 Anthranilate synthase component 1 1 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
O28669 7.54e-50 179 39 6 276 3 trpE Anthranilate synthase component 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8LPN3 1.15e-49 186 29 12 456 1 ADCS Aminodeoxychorismate synthase, chloroplastic Arabidopsis thaliana
P50872 2.21e-49 184 31 12 486 4 trpE(G) Anthranilate synthase Azospirillum brasilense
P33975 3.99e-47 174 34 18 517 3 trpE Anthranilate synthase component 1 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P72539 5.32e-47 177 35 7 357 3 papA Aminodeoxychorismate synthase Streptomyces pristinaespiralis
Q8GMH4 5.74e-47 173 38 4 278 1 sgcD 2-amino-4-deoxychorismate synthase Streptomyces globisporus
Q9Y8T0 1.23e-46 171 36 8 332 3 trpE Anthranilate synthase component 1 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P27630 9.34e-46 169 32 19 495 3 pabB Aminodeoxychorismate synthase component 1 Streptomyces lividans
Q6TAS3 4.75e-45 173 31 7 352 1 ADCS Aminodeoxychorismate synthase, chloroplastic Solanum lycopersicum
P12680 3.77e-44 165 32 7 365 3 pabB Aminodeoxychorismate synthase component 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P27629 5.06e-43 162 29 15 458 3 pabB Aminodeoxychorismate synthase component 1 Lactococcus lactis subsp. lactis
Q5Z856 1.06e-42 166 29 10 400 2 ADCS Probable aminodeoxychorismate synthase, chloroplastic Oryza sativa subsp. japonica
P05041 1.5e-42 160 30 6 370 1 pabB Aminodeoxychorismate synthase component 1 Escherichia coli (strain K12)
Q9HS66 1.36e-41 159 35 12 385 3 trpE2 Anthranilate synthase component 1 2 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P12679 1.14e-40 155 31 9 376 3 pabB Aminodeoxychorismate synthase component 1 Klebsiella aerogenes
P32483 1.77e-39 155 32 4 351 3 pabAB Aminodeoxychorismate synthase Streptomyces griseus
P20463 3.26e-39 151 39 6 239 3 trpE Anthranilate synthase component 1 Leptospira biflexa
F2RB79 2.38e-38 152 31 7 376 1 cmlB Aminodeoxychorismate synthase Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745)
O94277 6.23e-23 106 26 6 280 3 SPBP8B7.29 Putative aminodeoxychorismate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P00896 3.26e-22 96 46 3 137 3 trpE Anthranilate synthase component 1 (Fragment) Citrobacter freundii
P23973 5.19e-22 102 27 5 275 3 menF Isochorismate synthase MenF Bacillus subtilis (strain 168)
Q73XV3 1.24e-21 100 28 5 297 3 mbtI Salicylate synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P37254 2.16e-17 89 25 15 378 1 ABZ1 Aminodeoxychorismate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45744 1.19e-15 82 29 7 285 1 dhbC Isochorismate synthase DhbC Bacillus subtilis (strain 168)
Q9M9V6 1.96e-15 82 35 6 175 1 ICS2 Isochorismate synthase 2, chloroplastic Arabidopsis thaliana
Q57527 2.3e-15 80 30 9 215 4 HI_1170 Uncharacterized PabA-like protein HI_1170 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WFW9 8.31e-15 79 29 10 286 1 menF Putative isochorismate synthase MenF Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFW8 8.31e-15 79 29 10 286 3 menF Putative isochorismate synthase MenF Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9S7H8 1.06e-14 80 31 8 227 1 ICS1 Isochorismate synthase 1, chloroplastic Arabidopsis thaliana
Q51508 1.15e-14 79 25 10 375 1 pchA Salicylate biosynthesis isochorismate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WFX1 1.32e-14 79 27 5 261 1 mbtI Salicylate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFX0 1.32e-14 79 27 5 261 3 mbtI Salicylate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYQ1 1.32e-14 79 27 5 261 3 mbtI Salicylate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CPI5 2.33e-14 78 26 13 355 3 menF Isochorismate synthase MenF Pasteurella multocida (strain Pm70)
Q9ZPC0 4.21e-14 78 26 15 379 1 None Isochorismate synthase, chloroplastic Catharanthus roseus
Q51519 2.71e-13 76 27 10 285 4 phzB Anthranilate synthase, phenazine specific Pseudomonas chlororaphis
Q51791 4.47e-13 75 27 11 286 4 phzE Anthranilate synthase, phenazine specific Pseudomonas fluorescens
P44613 8.23e-13 73 23 5 267 3 menF Isochorismate synthase MenF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CKY6 3.34e-12 71 28 10 223 4 PM1464 Uncharacterized PabA-like protein PM1464 Pasteurella multocida (strain Pm70)
O07898 3.75e-11 68 25 7 284 3 vibC Vibriobactin-specific isochorismate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P23300 1.88e-10 66 25 9 287 3 amoA Putative isochorismate synthase Aeromonas hydrophila
P38051 6.88e-10 64 26 10 267 1 menF Isochorismate synthase MenF Escherichia coli (strain K12)
P0AEJ2 4.68e-06 52 27 8 218 1 entC Isochorismate synthase EntC Escherichia coli (strain K12)
P0AEJ3 4.68e-06 52 27 8 218 3 entC Isochorismate synthase EntC Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_12635
Feature type CDS
Gene trpE
Product anthranilate synthase component 1
Location 141556 - 143106 (strand: -1)
Length 1551 (nucleotides) / 516 (amino acids)
In genomic island -

Contig

Accession ZDB_369
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1014
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00425 chorismate binding enzyme
PF04715 Anthranilate synthase component I, N terminal region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0147 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)
EH Anthranilate/para-aminobenzoate synthases component I

Kegg Ortholog Annotation(s)

Protein Sequence

MDSTIFTQHIRTDYPAYQPDPAAVFTALCAQRPATLLLESAEIASRANLKSMLVLHSALRIRCTGHTVTAEALTANGAALLTVLQASLSSGTISGNTLTLHFTVPAAHADEDTRLRAASVFDVLRTLMNLPSQADDRHALFCGGLFSYDLVAAFEALPPVERTNSCPDYCFYLAETLLTIDHQQQTSELVTLTFTADAAEQTRLTAQHQQVLTTLAQPVTGSASVTPVDISVTTSHSDADFCTIVNQLKQSIVQGDIFQVVPSRRFQLPCPSPMAAYRELKTRNPSPYLFFMQDADFTLFGASPESALKYDPATRQIEIYPIAGTRPRGLSADGSVDADKDSRLELDLRTDQKELAEHFMLVDLARNDLARICRPGSRSVAELTKVDRYAFVMHLVSRVTGELRDDLDIFHAYQACMNMGTLTGAPKVRAMELIAQAEKVRRGSYGGAVGYFRGDTTFDTCIVIRSAYVENGIATVQAGGGVVLDSDPQAEADENRNKARAVIRAITRAHHAEETF

Flanking regions ( +/- flanking 50bp)

CCGTGGCGGGTTTTTTTATGGCAAAAAATTCACATAGCAAGGTAATTATCATGGACAGCACGATTTTCACACAACACATCCGGACAGATTATCCGGCTTATCAGCCCGACCCGGCGGCGGTATTCACCGCGCTTTGCGCACAGCGTCCTGCAACGCTGTTATTAGAATCCGCCGAAATCGCATCCAGAGCAAATTTAAAAAGCATGCTGGTGCTGCACAGCGCACTGCGTATCCGCTGCACCGGACACACCGTCACCGCAGAAGCACTGACCGCCAACGGCGCTGCATTGCTGACGGTATTGCAGGCAAGTCTGTCCTCCGGGACTATCAGCGGTAACACACTGACACTGCATTTCACTGTACCGGCCGCCCATGCGGATGAAGATACCCGCCTGCGCGCCGCCTCGGTCTTTGATGTGCTCCGCACCCTGATGAACCTGCCGTCACAGGCAGATGACCGTCACGCGCTGTTCTGCGGCGGACTGTTCAGCTACGACCTGGTCGCGGCTTTTGAGGCACTGCCGCCGGTTGAGCGCACTAACAGCTGCCCGGATTACTGTTTTTATCTGGCGGAAACACTGCTCACCATCGACCACCAGCAGCAGACCAGTGAACTGGTTACCCTGACATTTACAGCGGATGCCGCAGAACAAACCCGCCTGACAGCACAGCATCAGCAGGTATTAACGACTCTGGCACAGCCGGTAACCGGTTCTGCGTCTGTCACACCGGTAGACATCAGCGTGACAACGTCACATTCGGATGCCGATTTCTGCACTATCGTGAATCAGTTAAAACAATCCATTGTTCAGGGTGATATCTTCCAGGTCGTGCCGTCACGCCGCTTTCAGTTACCGTGCCCATCCCCGATGGCCGCTTACCGCGAACTGAAAACCCGCAACCCGAGTCCTTACCTGTTCTTTATGCAGGATGCGGATTTCACTCTGTTCGGCGCATCACCGGAAAGCGCACTGAAATATGACCCGGCAACCCGTCAGATTGAAATCTACCCGATTGCGGGCACCCGTCCGCGCGGTCTGTCAGCAGACGGTTCGGTGGATGCAGATAAAGACAGCCGTCTGGAGCTTGATCTGCGTACGGATCAGAAAGAGCTGGCCGAACACTTCATGCTGGTCGATCTTGCCCGTAATGACCTCGCCCGTATCTGCCGTCCCGGCAGCCGTAGTGTGGCGGAACTGACCAAAGTGGATCGTTATGCGTTTGTGATGCACCTGGTGTCCCGCGTCACCGGTGAATTACGCGACGACCTCGATATTTTCCATGCTTATCAGGCGTGCATGAACATGGGCACCCTGACCGGCGCACCGAAAGTCCGTGCAATGGAACTGATTGCACAGGCCGAGAAAGTCCGTCGCGGCAGCTACGGCGGCGCGGTCGGCTATTTTCGCGGCGATACCACCTTCGATACCTGCATTGTGATCCGCTCTGCCTATGTCGAAAACGGCATTGCCACTGTGCAGGCCGGCGGCGGTGTGGTACTGGATTCCGACCCGCAGGCGGAAGCTGACGAAAACCGCAACAAAGCCCGCGCGGTGATCCGCGCCATCACCCGCGCCCATCATGCAGAGGAGACATTCTGATGGCTGATATTTTACTGCTCGATAATGTCGATTCCTTTACCTATAACCTG