Homologs in group_944

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05140 FBDBKF_05140 77.7 Morganella morganii S1 rluB 23S rRNA pseudouridine(2605) synthase RluB
EHELCC_12450 EHELCC_12450 77.7 Morganella morganii S2 rluB 23S rRNA pseudouridine(2605) synthase RluB
NLDBIP_12790 NLDBIP_12790 77.7 Morganella morganii S4 rluB 23S rRNA pseudouridine(2605) synthase RluB
LHKJJB_12650 LHKJJB_12650 77.7 Morganella morganii S3 rluB 23S rRNA pseudouridine(2605) synthase RluB
HKOGLL_11265 HKOGLL_11265 77.7 Morganella morganii S5 rluB 23S rRNA pseudouridine(2605) synthase RluB
F4V73_RS05595 F4V73_RS05595 75.1 Morganella psychrotolerans rluB 23S rRNA pseudouridine(2605) synthase RluB

Distribution of the homologs in the orthogroup group_944

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_944

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZEG0 1.88e-169 475 74 1 301 3 rluB Ribosomal large subunit pseudouridine synthase B Yersinia pestis
P59815 7.52e-163 457 76 0 279 3 rluB Ribosomal large subunit pseudouridine synthase B Shigella flexneri
P37765 9.19e-163 457 76 0 279 1 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli (strain K12)
Q8X4Q8 1.07e-162 457 76 0 279 3 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli O157:H7
Q8FHV4 1.55e-162 457 76 0 279 3 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZP51 1.3e-159 449 74 0 279 3 rluB Ribosomal large subunit pseudouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7D5 3.18e-159 448 74 0 279 3 rluB Ribosomal large subunit pseudouridine synthase B Salmonella typhi
Q9CMY9 1.87e-140 403 66 0 279 3 rluB Ribosomal large subunit pseudouridine synthase B Pasteurella multocida (strain Pm70)
P45104 8.56e-140 402 66 0 279 1 rluB Ribosomal large subunit pseudouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KSS7 7.04e-125 362 59 5 307 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87NB7 1.8e-124 361 60 3 296 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D8C0 1.67e-122 356 56 5 317 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio vulnificus (strain CMCP6)
Q9HZ55 1.56e-89 275 48 5 311 3 rluB Ribosomal large subunit pseudouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57369 1.42e-83 255 49 2 249 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AL1 4.16e-81 248 48 0 245 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P42395 5.56e-78 241 46 2 254 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q87BI2 1.28e-69 226 53 4 249 3 rluB Ribosomal large subunit pseudouridine synthase B Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PAP2 1.39e-69 226 53 4 249 3 rluB Ribosomal large subunit pseudouridine synthase B Xylella fastidiosa (strain 9a5c)
Q8P8M6 2.01e-69 226 48 4 273 3 rluB Ribosomal large subunit pseudouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PK58 1.75e-68 225 49 5 273 3 rluB Ribosomal large subunit pseudouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
P65843 1.09e-39 142 38 5 252 3 BQ2027_MB1738 Uncharacterized RNA pseudouridine synthase Mb1738 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ1 1.09e-39 142 38 5 252 1 Rv1711 Uncharacterized RNA pseudouridine synthase Rv1711 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ0 1.09e-39 142 38 5 252 3 MT1751.1 Uncharacterized RNA pseudouridine synthase MT1751.1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P35159 9.52e-38 137 36 10 250 1 rluB Ribosomal large subunit pseudouridine synthase B Bacillus subtilis (strain 168)
Q4UL59 6.22e-37 134 34 6 230 3 RF_0863 Uncharacterized RNA pseudouridine synthase RF_0863 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZD06 4.21e-36 132 35 5 217 3 RP544 Uncharacterized RNA pseudouridine synthase RP544 Rickettsia prowazekii (strain Madrid E)
Q92HG4 5.57e-35 129 33 5 218 3 RC0807 Uncharacterized RNA pseudouridine synthase RC0807 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1RJR2 5.61e-35 129 33 5 218 3 RBE_0321 Uncharacterized RNA pseudouridine synthase RBE_0321 Rickettsia bellii (strain RML369-C)
Q68WJ1 5.95e-35 130 35 5 217 3 RT0532 Uncharacterized RNA pseudouridine synthase RT0532 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O05668 3.29e-33 125 36 3 227 3 ML1370 Uncharacterized RNA pseudouridine synthase ML1370 Mycobacterium leprae (strain TN)
O66829 1.58e-32 123 33 6 245 3 aq_554 Uncharacterized RNA pseudouridine synthase aq_554 Aquifex aeolicus (strain VF5)
O67444 3.15e-30 117 34 9 248 3 aq_1464 Uncharacterized RNA pseudouridine synthase aq_1464 Aquifex aeolicus (strain VF5)
O51155 6.49e-30 117 32 6 245 3 BB_0129 Uncharacterized RNA pseudouridine synthase BB_0129 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q55578 4.18e-29 114 36 8 225 3 slr0361 Uncharacterized RNA pseudouridine synthase slr0361 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8Z1V3 3.04e-27 110 30 8 262 3 rluF Dual-specificity RNA pseudouridine synthase RluF Salmonella typhi
Q8ZKL1 3.17e-27 110 30 8 262 3 rluF Dual-specificity RNA pseudouridine synthase RluF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZJG0 6.38e-27 109 32 8 238 3 jhp_1352 Uncharacterized RNA pseudouridine synthase jhp_1352 Helicobacter pylori (strain J99 / ATCC 700824)
P55986 3.75e-26 107 30 8 255 3 HP_1459 Uncharacterized RNA pseudouridine synthase HP_1459 Helicobacter pylori (strain ATCC 700392 / 26695)
Q8X4L9 8.31e-26 107 29 7 253 3 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli O157:H7
Q83IR6 9.21e-26 107 29 7 253 3 rluF Dual-specificity RNA pseudouridine synthase RluF Shigella flexneri
P32684 1.36e-25 106 29 7 253 1 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli (strain K12)
O32068 2.33e-25 104 32 5 231 3 ytzG Uncharacterized RNA pseudouridine synthase YtzG Bacillus subtilis (strain 168)
Q8FB47 2.42e-25 105 29 7 253 3 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44827 2.4e-24 102 33 7 221 3 rluE Ribosomal large subunit pseudouridine synthase E Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZGM2 2.18e-23 99 31 5 239 3 rsuA Ribosomal small subunit pseudouridine synthase A Yersinia pestis
Q8L960 6.27e-22 98 28 6 259 1 SVR1 Putative ribosomal large subunit pseudouridine synthase SVR1, chloroplastic Arabidopsis thaliana
P65840 6.19e-21 92 30 8 245 3 rsuA Ribosomal small subunit pseudouridine synthase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65841 6.19e-21 92 30 8 245 3 rsuA Ribosomal small subunit pseudouridine synthase A Salmonella typhi
Q9CPN4 4.13e-20 90 29 6 238 3 rsuA Ribosomal small subunit pseudouridine synthase A Pasteurella multocida (strain Pm70)
P0AA46 5.56e-20 89 30 8 249 3 rsuA Ribosomal small subunit pseudouridine synthase A Shigella flexneri
P0AA43 5.56e-20 89 30 8 249 1 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli (strain K12)
P0AA44 5.56e-20 89 30 8 249 3 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA45 5.56e-20 89 30 8 249 3 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli O157:H7
Q9HX48 7.68e-20 88 35 5 189 3 rluE Ribosomal large subunit pseudouridine synthase E Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZFQ3 1.45e-19 88 37 5 180 3 rluE Ribosomal large subunit pseudouridine synthase E Yersinia pestis
Q8ZPZ1 2.21e-19 88 37 4 181 3 rluE Ribosomal large subunit pseudouridine synthase E Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7G6 2.65e-19 87 36 4 181 3 rluE Ribosomal large subunit pseudouridine synthase E Salmonella typhi
P72581 5.78e-19 87 36 6 166 3 slr0612 Uncharacterized RNA pseudouridine synthase slr0612 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8D8X2 8.27e-19 86 27 5 240 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio vulnificus (strain CMCP6)
Q9I5J6 8.65e-19 86 30 7 239 3 rsuA Ribosomal small subunit pseudouridine synthase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9F855 1.71e-18 85 33 3 181 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DAS3 3.51e-18 85 32 5 181 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio vulnificus (strain CMCP6)
Q9CKK7 4.72e-18 84 31 8 226 3 rluE Ribosomal large subunit pseudouridine synthase E Pasteurella multocida (strain Pm70)
Q8PDR2 5.98e-18 83 38 3 142 3 rluE Ribosomal large subunit pseudouridine synthase E Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9KRK5 9.19e-18 84 28 5 229 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87QY8 1.09e-17 84 33 5 181 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P45124 5.12e-17 81 27 7 242 1 rsuA Ribosomal small subunit pseudouridine synthase A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75966 1.03e-16 80 33 4 188 1 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli (strain K12)
Q83LF6 1.23e-16 80 33 4 188 3 rluE Ribosomal large subunit pseudouridine synthase E Shigella flexneri
Q8X724 1.24e-16 80 33 4 187 3 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli O157:H7
Q87QD4 1.54e-16 80 27 7 233 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8PQN3 1.82e-16 79 38 3 142 3 rluE Ribosomal large subunit pseudouridine synthase E Xanthomonas axonopodis pv. citri (strain 306)
Q8FIB6 2.19e-16 79 33 4 185 3 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06465
Feature type CDS
Gene rluB
Product 23S rRNA pseudouridine(2605) synthase RluB
Location 1418468 - 1419394 (strand: -1)
Length 927 (nucleotides) / 308 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_944
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase
PF01479 S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1187 Translation, ribosomal structure and biogenesis (J) J Pseudouridylate synthase RsuA, specific for 16S rRNA U516 and 23S rRNA U2605

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06178 23S rRNA pseudouridine2605 synthase [EC:5.4.99.22] - -

Protein Sequence

MSDKSQRTEKLQKILARSGHGSRREIEGYLQEGRISIDGVKAKLGDRIDANSTAKIRLDGRILSIREAQKDVCRVLAYYKPEGELCTRSDPQGRPTVFQRLPRLNSARWIAVGRLDVNTSGLLLFTTDGELANRLMHPSREVEREYAVRVFGEIDDAKIRQLTRGVQLEDGPASFRSVSYRGGEGINQWYNVSLTEGRNREVRRMWEAVGVQVSRLIRVRYGDIDLPKGLPRGGWVELGLNQINYLRQLVELNDETVTKVAVEKDQRRIKANQIRRAVKRHTKISARTSTSPAKRASSRRQSAGSKSK

Flanking regions ( +/- flanking 50bp)

AAACTAATTTATTTTATGACGCCTGTGAAGGCGACACATGAGGTTGTTTCATGAGCGATAAATCGCAACGTACTGAAAAATTACAAAAAATTCTTGCTCGTTCTGGTCATGGTTCTCGACGTGAGATTGAAGGCTATCTTCAAGAAGGCCGTATCAGTATTGATGGCGTGAAGGCAAAATTAGGCGATCGTATTGATGCCAATTCTACAGCCAAAATCCGTTTAGATGGTCGTATATTAAGTATTCGCGAAGCACAAAAAGATGTTTGTCGAGTGTTAGCTTATTACAAGCCAGAAGGTGAGCTATGTACACGTAGTGATCCACAGGGCAGACCGACCGTATTCCAACGTCTTCCGCGTTTAAATAGTGCGCGTTGGATAGCCGTTGGTCGTCTTGATGTTAACACCAGTGGTTTATTACTCTTTACCACTGATGGTGAGTTAGCCAATCGCTTAATGCACCCAAGTCGTGAAGTTGAGCGTGAATATGCGGTACGTGTTTTTGGTGAAATTGATGATGCAAAAATTCGTCAATTGACTCGTGGGGTACAATTAGAAGATGGGCCGGCATCATTCCGTTCGGTTTCTTATCGCGGTGGTGAAGGCATTAACCAATGGTACAATGTATCGCTAACGGAAGGACGCAATCGAGAAGTCCGTCGTATGTGGGAAGCGGTAGGTGTGCAGGTTAGTCGCCTTATTCGTGTTCGTTATGGTGATATTGATTTGCCTAAAGGACTTCCACGTGGCGGATGGGTTGAGCTAGGCTTAAATCAAATTAACTATTTACGCCAGCTGGTGGAACTAAACGATGAGACAGTAACCAAAGTGGCTGTCGAAAAAGATCAGCGTCGAATTAAAGCAAATCAAATTCGTCGGGCGGTGAAACGTCATACCAAAATTTCTGCGCGTACTTCAACTTCACCGGCTAAGCGTGCCTCAAGCCGCCGCCAATCAGCGGGAAGTAAAAGCAAATAAACGAATAATTATTGATAAATTCAAATTAAATTTTCAGTTAGATACAGAAG