Homologs in group_1011

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05140 FBDBKF_05140 91.3 Morganella morganii S1 rluB 23S rRNA pseudouridine(2605) synthase RluB
EHELCC_12450 EHELCC_12450 91.3 Morganella morganii S2 rluB 23S rRNA pseudouridine(2605) synthase RluB
NLDBIP_12790 NLDBIP_12790 91.3 Morganella morganii S4 rluB 23S rRNA pseudouridine(2605) synthase RluB
LHKJJB_12650 LHKJJB_12650 91.3 Morganella morganii S3 rluB 23S rRNA pseudouridine(2605) synthase RluB
HKOGLL_11265 HKOGLL_11265 91.3 Morganella morganii S5 rluB 23S rRNA pseudouridine(2605) synthase RluB
PMI_RS06465 PMI_RS06465 75.1 Proteus mirabilis HI4320 rluB 23S rRNA pseudouridine(2605) synthase RluB

Distribution of the homologs in the orthogroup group_1011

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1011

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZEG0 2.48e-162 457 71 2 311 3 rluB Ribosomal large subunit pseudouridine synthase B Yersinia pestis
Q8X4Q8 9.54e-161 452 77 0 280 3 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli O157:H7
P59815 9.86e-161 452 78 0 275 3 rluB Ribosomal large subunit pseudouridine synthase B Shigella flexneri
P37765 1.34e-160 452 77 0 280 1 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli (strain K12)
Q8ZP51 1.39e-160 452 77 0 280 3 rluB Ribosomal large subunit pseudouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FHV4 1.75e-160 451 76 0 280 3 rluB Ribosomal large subunit pseudouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z7D5 5.58e-160 450 76 0 280 3 rluB Ribosomal large subunit pseudouridine synthase B Salmonella typhi
Q9CMY9 1.45e-144 413 71 0 274 3 rluB Ribosomal large subunit pseudouridine synthase B Pasteurella multocida (strain Pm70)
P45104 1.6e-142 409 70 0 274 1 rluB Ribosomal large subunit pseudouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KSS7 3.51e-127 368 61 2 300 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87NB7 7.29e-123 357 63 2 279 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D8C0 7.15e-122 355 63 2 277 3 rluB Ribosomal large subunit pseudouridine synthase B Vibrio vulnificus (strain CMCP6)
Q9HZ55 5.01e-90 276 50 5 300 3 rluB Ribosomal large subunit pseudouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57369 1.9e-84 257 49 2 247 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AL1 1.11e-80 248 48 0 245 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P42395 3.42e-78 241 48 2 254 3 rluB Ribosomal large subunit pseudouridine synthase B Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q87BI2 2.12e-70 228 51 3 260 3 rluB Ribosomal large subunit pseudouridine synthase B Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PAP2 2.74e-70 228 51 3 260 3 rluB Ribosomal large subunit pseudouridine synthase B Xylella fastidiosa (strain 9a5c)
Q8P8M6 3.17e-70 228 51 4 271 3 rluB Ribosomal large subunit pseudouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PK58 3.5e-69 227 51 4 271 3 rluB Ribosomal large subunit pseudouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
Q9ZD06 2.98e-40 143 37 7 229 3 RP544 Uncharacterized RNA pseudouridine synthase RP544 Rickettsia prowazekii (strain Madrid E)
Q68WJ1 5.23e-40 143 38 6 224 3 RT0532 Uncharacterized RNA pseudouridine synthase RT0532 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UL59 2.4e-39 141 35 5 231 3 RF_0863 Uncharacterized RNA pseudouridine synthase RF_0863 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92HG4 5.43e-39 140 35 5 231 3 RC0807 Uncharacterized RNA pseudouridine synthase RC0807 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P35159 1.4e-38 139 38 8 245 1 rluB Ribosomal large subunit pseudouridine synthase B Bacillus subtilis (strain 168)
P65843 5.05e-38 138 40 6 246 3 BQ2027_MB1738 Uncharacterized RNA pseudouridine synthase Mb1738 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ1 5.05e-38 138 40 6 246 1 Rv1711 Uncharacterized RNA pseudouridine synthase Rv1711 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ0 5.05e-38 138 40 6 246 3 MT1751.1 Uncharacterized RNA pseudouridine synthase MT1751.1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1RJR2 3.93e-37 135 34 5 223 3 RBE_0321 Uncharacterized RNA pseudouridine synthase RBE_0321 Rickettsia bellii (strain RML369-C)
O67444 1.4e-32 124 37 9 248 3 aq_1464 Uncharacterized RNA pseudouridine synthase aq_1464 Aquifex aeolicus (strain VF5)
O51155 2.29e-31 120 31 4 245 3 BB_0129 Uncharacterized RNA pseudouridine synthase BB_0129 Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O05668 3.52e-31 120 38 4 225 3 ML1370 Uncharacterized RNA pseudouridine synthase ML1370 Mycobacterium leprae (strain TN)
Q55578 1.83e-30 118 38 5 221 3 slr0361 Uncharacterized RNA pseudouridine synthase slr0361 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O66829 8.49e-29 113 31 4 247 3 aq_554 Uncharacterized RNA pseudouridine synthase aq_554 Aquifex aeolicus (strain VF5)
Q9ZJG0 1.98e-28 113 32 7 256 3 jhp_1352 Uncharacterized RNA pseudouridine synthase jhp_1352 Helicobacter pylori (strain J99 / ATCC 700824)
P55986 4.56e-28 112 31 7 261 3 HP_1459 Uncharacterized RNA pseudouridine synthase HP_1459 Helicobacter pylori (strain ATCC 700392 / 26695)
Q8ZGM2 1.28e-26 107 33 4 233 3 rsuA Ribosomal small subunit pseudouridine synthase A Yersinia pestis
O32068 1.15e-24 102 32 6 229 3 ytzG Uncharacterized RNA pseudouridine synthase YtzG Bacillus subtilis (strain 168)
P65840 1.95e-23 99 32 6 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65841 1.95e-23 99 32 6 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Salmonella typhi
P0AA46 4.69e-23 98 32 6 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Shigella flexneri
P0AA43 4.69e-23 98 32 6 228 1 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli (strain K12)
P0AA44 4.69e-23 98 32 6 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA45 4.69e-23 98 32 6 228 3 rsuA Ribosomal small subunit pseudouridine synthase A Escherichia coli O157:H7
Q8L960 1.49e-22 100 31 7 249 1 SVR1 Putative ribosomal large subunit pseudouridine synthase SVR1, chloroplastic Arabidopsis thaliana
Q9I5J6 1.69e-21 94 31 6 238 3 rsuA Ribosomal small subunit pseudouridine synthase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z1V3 2.35e-21 95 27 7 258 3 rluF Dual-specificity RNA pseudouridine synthase RluF Salmonella typhi
Q8ZKL1 2.71e-21 94 27 7 258 3 rluF Dual-specificity RNA pseudouridine synthase RluF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZPZ1 3.49e-21 92 35 4 201 3 rluE Ribosomal large subunit pseudouridine synthase E Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X4L9 5.53e-21 94 27 7 258 3 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli O157:H7
Q8Z7G6 6.33e-21 92 34 4 201 3 rluE Ribosomal large subunit pseudouridine synthase E Salmonella typhi
Q83IR6 6.56e-21 93 27 7 258 3 rluF Dual-specificity RNA pseudouridine synthase RluF Shigella flexneri
P32684 8.27e-21 93 28 6 247 1 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli (strain K12)
Q8FB47 1.58e-20 92 27 7 258 3 rluF Dual-specificity RNA pseudouridine synthase RluF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44827 1.66e-20 91 29 5 237 3 rluE Ribosomal large subunit pseudouridine synthase E Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8D8X2 2.65e-20 90 28 6 240 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio vulnificus (strain CMCP6)
Q9F855 4.07e-20 90 35 5 182 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87QY8 5.26e-20 90 34 5 182 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CPN4 1.42e-19 89 27 5 238 3 rsuA Ribosomal small subunit pseudouridine synthase A Pasteurella multocida (strain Pm70)
Q9HX48 1.96e-19 87 36 6 186 3 rluE Ribosomal large subunit pseudouridine synthase E Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZFQ3 2.73e-19 87 33 5 209 3 rluE Ribosomal large subunit pseudouridine synthase E Yersinia pestis
Q87QD4 6.17e-19 87 28 7 242 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P45124 9.65e-19 86 26 5 227 1 rsuA Ribosomal small subunit pseudouridine synthase A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P72581 1.26e-18 87 35 4 173 3 slr0612 Uncharacterized RNA pseudouridine synthase slr0612 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8PDR2 6.81e-18 83 39 3 140 3 rluE Ribosomal large subunit pseudouridine synthase E Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8DAS3 8.26e-18 84 31 5 182 3 rluE Ribosomal large subunit pseudouridine synthase E Vibrio vulnificus (strain CMCP6)
Q83LF6 1.84e-17 82 32 5 202 3 rluE Ribosomal large subunit pseudouridine synthase E Shigella flexneri
P75966 1.86e-17 82 32 5 202 1 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli (strain K12)
Q8X724 2.27e-17 82 32 5 201 3 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli O157:H7
Q8FIB6 6.55e-17 81 33 5 194 3 rluE Ribosomal large subunit pseudouridine synthase E Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8PQN3 3.49e-16 78 39 4 140 3 rluE Ribosomal large subunit pseudouridine synthase E Xanthomonas axonopodis pv. citri (strain 306)
Q9CKK7 2.38e-15 77 32 5 171 3 rluE Ribosomal large subunit pseudouridine synthase E Pasteurella multocida (strain Pm70)
Q9KRK5 1.36e-14 75 25 5 238 3 rsuA Ribosomal small subunit pseudouridine synthase A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05595
Feature type CDS
Gene rluB
Product 23S rRNA pseudouridine(2605) synthase RluB
Location 1190611 - 1191543 (strand: -1)
Length 933 (nucleotides) / 310 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1011
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase
PF01479 S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1187 Translation, ribosomal structure and biogenesis (J) J Pseudouridylate synthase RsuA, specific for 16S rRNA U516 and 23S rRNA U2605

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06178 23S rRNA pseudouridine2605 synthase [EC:5.4.99.22] - -

Protein Sequence

MSQKTEKLQKVLAHAGHGSRREIEGYIEAGRISIDGKTATLGDRIDVNTSAKIRFDGRVLGVKDAQKNPCRVLAYYKPEGELCTRNDPDGRPTVFDRLPKISGARWIAVGRLDVNTSGLLLFTTDGELANRLMHPSREVEREYAVRVFGEVDDTKRNQLLKGVQLEDGPASFRALKFKGGEGINQWFNVTLTEGRNREVRRMWEAVGVQVSRLIRVRYGDIDLPKALPRGGWVELNLEKTNYLRELVGLAPEITTKVSVESDKRRIKANQIRRAVKRHALPGAGAPKRTSARPASSRQGTGVTQKRRAGK

Flanking regions ( +/- flanking 50bp)

TTGCGGTTGATTTTCATGACGCCTGTGAAGGCGACAGCAGAGGGTGCTCAATGAGCCAGAAGACAGAAAAGTTACAAAAAGTATTAGCCCATGCAGGGCATGGTTCACGCCGTGAAATTGAAGGCTATATCGAAGCAGGACGCATCTCTATTGACGGAAAAACCGCCACACTTGGCGACCGTATTGATGTGAATACCAGTGCAAAAATCCGTTTTGACGGGCGTGTACTGGGTGTTAAAGACGCACAAAAAAATCCGTGTCGCGTACTGGCATACTACAAACCGGAAGGGGAATTATGTACCCGTAATGATCCGGATGGCCGTCCGACCGTATTTGACCGTTTACCTAAAATTTCAGGGGCACGCTGGATTGCAGTCGGGCGCCTGGATGTTAATACCAGTGGTTTGCTGTTATTCACAACCGACGGTGAGCTGGCAAACCGCCTGATGCACCCGAGCCGTGAAGTGGAACGCGAATATGCGGTGCGTGTATTCGGTGAAGTGGATGACACCAAGCGTAATCAGTTATTGAAAGGTGTTCAGCTGGAAGATGGTCCTGCCTCATTCCGCGCCCTGAAATTTAAGGGCGGTGAAGGGATCAACCAGTGGTTTAATGTCACGCTGACAGAGGGCCGTAACCGGGAAGTCCGCCGTATGTGGGAAGCCGTGGGTGTGCAGGTCAGCCGCCTGATCCGCGTCCGCTACGGGGATATTGATTTACCTAAAGCGCTGCCGCGTGGCGGGTGGGTTGAACTGAACCTGGAAAAAACGAATTACCTGCGCGAATTAGTGGGGCTGGCACCTGAAATAACAACAAAAGTGTCAGTGGAAAGTGATAAGCGCCGGATCAAAGCGAATCAGATTCGCCGTGCGGTGAAACGTCATGCTCTGCCGGGAGCCGGTGCGCCGAAGCGTACTTCTGCCCGTCCTGCCTCTTCCCGCCAGGGAACCGGTGTTACCCAGAAGCGCCGCGCAGGGAAATAACCGCGTTTTTTACGAAAAACACGTATTTTTGTGTGTCCGGATAGCTGAGT