Homologs in group_74

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00165 FBDBKF_00165 45.8 Morganella morganii S1 uspA Nucleotide-binding universal stress protein, UspA family
FBDBKF_11580 FBDBKF_11580 42.3 Morganella morganii S1 uspF universal stress protein UspF
EHELCC_01380 EHELCC_01380 45.8 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_17500 EHELCC_17500 42.3 Morganella morganii S2 uspF universal stress protein UspF
NLDBIP_02080 NLDBIP_02080 45.8 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_18710 NLDBIP_18710 42.3 Morganella morganii S4 uspF universal stress protein UspF
LHKJJB_03595 LHKJJB_03595 45.8 Morganella morganii S3 uspA Nucleotide-binding universal stress protein, UspA family
LHKJJB_17940 LHKJJB_17940 42.3 Morganella morganii S3 uspF universal stress protein UspF
HKOGLL_03450 HKOGLL_03450 45.8 Morganella morganii S5 uspA Nucleotide-binding universal stress protein, UspA family
HKOGLL_18710 HKOGLL_18710 42.3 Morganella morganii S5 uspF universal stress protein UspF
F4V73_RS08100 F4V73_RS08100 42.3 Morganella psychrotolerans uspF universal stress protein UspF

Distribution of the homologs in the orthogroup group_74

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_74

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 2.38e-33 117 40 3 151 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 2.38e-33 117 40 3 151 3 uspF Universal stress protein F Salmonella typhi
P0A4P8 8.4e-33 115 43 3 146 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 8.4e-33 115 43 3 146 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 8.4e-33 115 43 3 146 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 8.4e-33 115 43 3 146 3 uspF Universal stress protein F Escherichia coli O157:H7
P37903 5.28e-32 114 43 3 146 1 uspF Universal stress protein F Escherichia coli (strain K12)
Q8FK07 2.42e-26 99 41 3 149 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39177 9.19e-26 97 41 3 149 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8XBT3 9.39e-26 97 41 3 149 3 uspG Universal stress protein G Escherichia coli O157:H7
Q83M07 5.2e-25 95 40 3 149 3 uspG Universal stress protein G Shigella flexneri
P67093 5.43e-25 95 40 3 149 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 5.43e-25 95 40 3 149 3 uspG Universal stress protein G Salmonella typhi
P74148 3.99e-07 49 30 4 110 3 sll1388 Universal stress protein Sll1388 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O27222 7.14e-07 48 25 1 144 3 MTH_1154 Universal stress protein MTH_1154 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P45680 2.93e-06 47 33 3 112 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q50777 3.66e-06 47 25 1 144 3 MTBMA_c15380 Universal stress protein MTBMA_c15380 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q8LGG8 1.52e-05 45 28 1 60 1 At3g01520 Universal stress protein A-like protein Arabidopsis thaliana
E1VBK4 2.86e-05 44 34 2 79 1 teaD TRAP-T-associated universal stress protein TeaD Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)
P74897 4.94e-05 43 30 4 115 3 None Universal stress protein in QAH/OAS sulfhydrylase 3'region Thermus aquaticus
Q57951 0.00015 43 45 1 53 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04885
Feature type CDS
Gene -
Product universal stress protein
Location 1068889 - 1069323 (strand: -1)
Length 435 (nucleotides) / 144 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_74
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Protein Sequence

MTKTVLVPIDFTELGLLDKVVTHLKALAMADKLNIHFLSVIPSYESFVGFAFGSQDRLANDKQRIEIALSTLNDSLSHIEIPNSTSQSYISVGNPRDRILETAKKIQADLIVIGSRNPGMKTYLLGSTASSVVSYAESSVLVVR

Flanking regions ( +/- flanking 50bp)

TAACAACCCACTAAAGCCCCCAACATATAAAAGGTTAATGAGGAGCCACTATGACAAAAACTGTATTAGTTCCCATCGATTTTACTGAGCTTGGTTTATTGGATAAAGTTGTCACTCATCTCAAAGCATTAGCGATGGCCGATAAACTAAATATCCACTTTTTATCTGTTATTCCTAGCTATGAGTCCTTTGTCGGATTTGCTTTTGGCAGCCAAGACCGTCTTGCCAATGATAAGCAACGTATTGAAATTGCATTATCTACGTTAAATGATAGTTTATCTCATATTGAAATTCCCAATAGCACATCCCAATCTTATATTTCCGTAGGTAACCCACGCGACCGTATTTTAGAGACCGCAAAAAAAATCCAAGCTGATCTGATTGTGATAGGCTCACGCAACCCTGGAATGAAAACCTACTTACTAGGCTCGACAGCTTCTTCTGTTGTTAGCTATGCAGAATCTTCTGTTTTAGTTGTTCGATAACTCAACGCCAAGATTTTTCCTATCAGAAGTCAGGTTACGCCAATAACCTG