Homologs in group_74

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11580 FBDBKF_11580 50.7 Morganella morganii S1 uspF universal stress protein UspF
EHELCC_01380 EHELCC_01380 100.0 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_17500 EHELCC_17500 50.7 Morganella morganii S2 uspF universal stress protein UspF
NLDBIP_02080 NLDBIP_02080 100.0 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_18710 NLDBIP_18710 50.7 Morganella morganii S4 uspF universal stress protein UspF
LHKJJB_03595 LHKJJB_03595 100.0 Morganella morganii S3 uspA Nucleotide-binding universal stress protein, UspA family
LHKJJB_17940 LHKJJB_17940 50.7 Morganella morganii S3 uspF universal stress protein UspF
HKOGLL_03450 HKOGLL_03450 100.0 Morganella morganii S5 uspA Nucleotide-binding universal stress protein, UspA family
HKOGLL_18710 HKOGLL_18710 50.7 Morganella morganii S5 uspF universal stress protein UspF
F4V73_RS08100 F4V73_RS08100 49.3 Morganella psychrotolerans uspF universal stress protein UspF
PMI_RS04885 PMI_RS04885 45.8 Proteus mirabilis HI4320 - universal stress protein

Distribution of the homologs in the orthogroup group_74

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_74

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 2.27e-36 125 46 2 146 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 2.27e-36 125 46 2 146 3 uspF Universal stress protein F Salmonella typhi
P0A4P8 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Escherichia coli O157:H7
P37903 8.63e-35 120 47 2 146 1 uspF Universal stress protein F Escherichia coli (strain K12)
Q8XBT3 3.43e-17 75 35 3 146 3 uspG Universal stress protein G Escherichia coli O157:H7
Q83M07 4.73e-17 75 35 3 146 3 uspG Universal stress protein G Shigella flexneri
P39177 6.46e-17 75 35 4 151 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8FK07 1.08e-16 74 35 3 146 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67093 4.02e-15 70 34 3 146 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 4.02e-15 70 34 3 146 3 uspG Universal stress protein G Salmonella typhi
Q57951 4.38e-07 50 26 5 150 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
E1VBK4 7.3e-05 43 24 2 149 1 teaD TRAP-T-associated universal stress protein TeaD Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_00165
Feature type CDS
Gene uspA
Product Nucleotide-binding universal stress protein, UspA family
Location 27589 - 28029 (strand: 1)
Length 441 (nucleotides) / 146 (amino acids)
In genomic island GI36

Contig

Accession contig_1
Length 309072 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_74
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Protein Sequence

MYKNILVPIDTSNKALVNHVIPHIESLSKFDDPHIHFLVVIPSYKMFIGLSYGIEKEIITEDNQRLKLAEADLKNEVSKFNLPEDRVHYHAILDTPIDGILTTAEKIHVDLIIISSRSPNISTKYLLGSTASAVVRYAETSVLVVR

Flanking regions ( +/- flanking 50bp)

ATCAATAATGTCCTATACTTTATAGTGAAAAGCAAACCGGAGAGAAAAGTATGTATAAGAATATTCTGGTACCGATTGACACTTCTAATAAAGCACTGGTTAACCATGTCATCCCTCACATCGAATCTCTTTCAAAGTTTGATGACCCGCACATACATTTTTTAGTCGTTATACCAAGCTACAAAATGTTTATCGGCCTTTCATACGGCATAGAAAAAGAAATCATTACAGAAGATAATCAACGATTGAAGTTAGCAGAAGCTGACCTTAAAAATGAAGTTTCAAAATTTAATCTTCCGGAAGATCGGGTTCATTATCATGCAATTCTTGACACTCCGATAGATGGGATTTTGACTACCGCAGAAAAAATACACGTTGATTTAATAATCATCAGCTCAAGATCACCAAATATTTCAACCAAATATCTACTTGGGTCTACTGCATCAGCTGTAGTCCGCTATGCAGAAACATCCGTCCTGGTTGTCCGCTAATACATATCGCCCGCCATAGCGGGCTTTTTCATATACAATTATGACACTCA