Homologs in group_2466

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00165 FBDBKF_00165 100.0 Morganella morganii S1 uspA Nucleotide-binding universal stress protein, UspA family
EHELCC_01380 EHELCC_01380 100.0 Morganella morganii S2 uspA Nucleotide-binding universal stress protein, UspA family
NLDBIP_02080 NLDBIP_02080 100.0 Morganella morganii S4 uspA Nucleotide-binding universal stress protein, UspA family
LHKJJB_03595 LHKJJB_03595 100.0 Morganella morganii S3 uspA Nucleotide-binding universal stress protein, UspA family
PMI_RS04885 PMI_RS04885 45.8 Proteus mirabilis HI4320 - universal stress protein

Distribution of the homologs in the orthogroup group_2466

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2466

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 2.27e-36 125 46 2 146 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 2.27e-36 125 46 2 146 3 uspF Universal stress protein F Salmonella typhi
P0A4P8 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 4.59e-35 121 47 2 146 3 uspF Universal stress protein F Escherichia coli O157:H7
P37903 8.63e-35 120 47 2 146 1 uspF Universal stress protein F Escherichia coli (strain K12)
Q8XBT3 3.43e-17 75 35 3 146 3 uspG Universal stress protein G Escherichia coli O157:H7
Q83M07 4.73e-17 75 35 3 146 3 uspG Universal stress protein G Shigella flexneri
P39177 6.46e-17 75 35 4 151 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q8FK07 1.08e-16 74 35 3 146 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67093 4.02e-15 70 34 3 146 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 4.02e-15 70 34 3 146 3 uspG Universal stress protein G Salmonella typhi
Q57951 4.38e-07 50 26 5 150 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
E1VBK4 7.3e-05 43 24 2 149 1 teaD TRAP-T-associated universal stress protein TeaD Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_03450
Feature type CDS
Gene uspA
Product Nucleotide-binding universal stress protein, UspA family
Location 281044 - 281484 (strand: -1)
Length 441 (nucleotides) / 146 (amino acids)

Contig

Accession ZDB_680
Length 282413 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2466
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Protein Sequence

MYKNILVPIDTSNKALVNHVIPHIESLSKFDDPHIHFLVVIPSYKMFIGLSYGIEKEIITEDNQRLKLAEADLKNEVSKFNLPEDRVHYHAILDTPIDGILTTAEKIHVDLIIISSRSPNISTKYLLGSTASAVVRYAETSVLVVR

Flanking regions ( +/- flanking 50bp)

ATCAATAATGTCCTATACTTTATAGTGAAAAGCAAACCGGAGAGAAAAGTATGTATAAGAATATTCTGGTACCGATTGACACTTCTAATAAAGCACTGGTTAACCATGTCATCCCTCACATCGAATCTCTTTCAAAGTTTGATGACCCGCACATACATTTTTTAGTCGTTATACCAAGCTACAAAATGTTTATCGGCCTTTCATACGGCATAGAAAAAGAAATCATTACAGAAGATAATCAACGATTGAAGTTAGCAGAAGCTGACCTTAAAAATGAAGTTTCAAAATTTAATCTTCCGGAAGATCGGGTTCATTATCATGCAATTCTTGACACTCCGATAGATGGGATTTTGACTACCGCAGAAAAAATACACGTTGATTTAATAATCATCAGCTCAAGATCACCAAATATTTCAACCAAATATCTACTTGGGTCTACTGCATCAGCTGTAGTCCGCTATGCAGAAACATCCGTCCTGGTTGTCCGCTAATACATATCGCCCGCCATAGCGGGCTTTTTCATATACAATTATGACACTCA