Homologs in group_1980

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14575 FBDBKF_14575 74.1 Morganella morganii S1 phoP two-component system response regulator PhoP
EHELCC_15380 EHELCC_15380 74.1 Morganella morganii S2 phoP two-component system response regulator PhoP
NLDBIP_15910 NLDBIP_15910 74.1 Morganella morganii S4 phoP two-component system response regulator PhoP
LHKJJB_15930 LHKJJB_15930 74.1 Morganella morganii S3 phoP two-component system response regulator PhoP
HKOGLL_15050 HKOGLL_15050 74.1 Morganella morganii S5 phoP two-component system response regulator PhoP
F4V73_RS07370 F4V73_RS07370 74.6 Morganella psychrotolerans phoP two-component system response regulator PhoP

Distribution of the homologs in the orthogroup group_1980

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1980

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P23836 9.98e-121 345 71 0 223 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 1.22e-120 344 71 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 1.22e-120 344 71 0 223 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z7H2 9.77e-120 342 69 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q8X738 1.21e-119 342 70 0 223 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
P0DM78 2.25e-119 341 69 0 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 2.25e-119 341 69 0 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 2.25e-119 341 69 0 223 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 2.25e-119 341 69 0 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 2.25e-119 341 69 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC3 6.72e-119 340 69 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q9I4F9 3.72e-73 224 49 0 220 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I0I1 1.55e-49 164 39 2 221 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q70FH0 1.61e-43 149 37 1 218 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P45337 6.31e-42 144 35 1 218 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36556 1.09e-41 144 34 1 218 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52076 2.82e-41 142 36 1 223 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P30843 4.57e-41 142 34 1 218 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q9HV32 5.17e-41 142 35 1 224 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8XBS3 6.69e-41 142 35 1 223 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
A0R3I8 9.45e-41 142 36 1 221 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGN1 1.47e-40 141 36 4 226 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.47e-40 141 36 4 226 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1B3X8 1.52e-40 141 36 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1.52e-40 141 36 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1.52e-40 141 36 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P0DMK7 1.19e-39 139 35 1 224 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 1.19e-39 139 35 1 224 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
A1TEL7 1.65e-39 138 34 1 222 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q8GP20 8.64e-39 136 35 1 218 1 rssB Swarming motility regulation protein RssB Serratia marcescens
L7N689 5.04e-38 135 35 3 224 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0ACZ8 6.98e-38 134 34 2 224 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 6.98e-38 134 34 2 224 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 6.98e-38 134 34 2 224 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q742C1 1.07e-37 134 34 1 221 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.07e-37 134 34 1 221 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
A0PWB4 1.36e-37 134 34 1 223 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P23620 3.24e-37 132 34 3 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9CD68 5.95e-37 132 33 1 221 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P0CL17 6.43e-37 132 34 3 219 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 6.43e-37 132 34 3 219 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
Q47456 8.59e-37 131 33 0 222 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
A1KHB7 9.04e-37 131 33 2 226 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 9.04e-37 131 33 2 226 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGM9 1.43e-36 131 33 2 226 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.43e-36 131 33 2 226 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.43e-36 131 33 2 226 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q02540 1.75e-36 130 34 1 219 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q9ZHD3 1.98e-36 130 35 2 225 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P66795 5.15e-36 129 33 1 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 5.15e-36 129 33 1 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q8FZ93 9.47e-36 129 31 1 219 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 9.47e-36 129 31 1 219 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 9.47e-36 129 31 1 219 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 9.47e-36 129 31 1 219 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 9.47e-36 129 31 1 219 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 9.47e-36 129 31 1 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 9.47e-36 129 31 1 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 9.47e-36 129 31 1 219 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P39663 1.2e-35 129 34 5 232 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q44006 2.99e-35 127 32 1 221 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A6WZ81 3.5e-35 127 31 1 219 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P94413 6.25e-35 127 33 4 227 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P9WGM1 1.66e-34 125 33 1 207 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.66e-34 125 33 1 207 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.66e-34 125 33 1 207 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4I0 1.92e-34 125 29 0 221 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 1.92e-34 125 29 0 221 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P45606 2.03e-34 125 32 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
B8H358 2.11e-34 125 32 1 219 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 2.11e-34 125 32 1 219 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0AFJ5 2.41e-34 125 32 2 225 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 2.41e-34 125 32 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q50136 3.67e-34 125 32 1 207 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P32040 6.06e-34 125 33 5 236 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9F868 6.7e-34 124 33 3 225 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q52990 7.04e-34 124 36 4 227 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
P45189 8.59e-34 124 32 2 222 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45607 8.7e-34 124 32 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q7D9K0 1.3e-33 124 31 0 220 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 1.3e-33 124 31 0 220 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q2FWH6 1.8e-33 123 33 3 223 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q55890 1.88e-33 123 34 3 231 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q01473 2e-33 129 35 1 219 3 rcaC Protein RcaC Microchaete diplosiphon
Q55933 2.16e-33 123 32 2 234 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45605 4.38e-33 122 32 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P9WGL9 6.12e-33 121 32 3 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 6.12e-33 121 32 3 224 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 6.12e-33 121 32 3 224 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q31S42 6.8e-33 122 33 3 231 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P21866 7.21e-33 121 33 3 221 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
P48259 4.96e-32 119 30 4 229 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P0A4I2 7.12e-32 118 33 1 220 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 7.12e-32 118 33 1 220 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O78428 7.56e-32 119 31 4 229 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q4L6C6 9.47e-32 118 34 4 217 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
A0A4P7TS68 1.47e-31 118 31 3 227 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.47e-31 118 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.47e-31 118 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.47e-31 118 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.47e-31 118 31 3 227 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.47e-31 118 31 3 227 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.47e-31 118 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.47e-31 118 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
Q93CB8 1.55e-31 118 35 2 219 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QTK2 1.57e-31 118 35 2 219 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGM7 1.62e-31 118 35 2 219 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 1.62e-31 118 35 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 1.62e-31 118 35 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0C001 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 2.09e-31 117 33 4 218 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 2.09e-31 117 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P28835 4.82e-31 117 30 4 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P28257 6.03e-31 117 31 4 229 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P51358 1.28e-30 116 29 5 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
P37478 1.3e-30 115 34 4 232 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q49VK3 1.92e-30 115 33 2 221 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O06978 1.93e-30 115 30 2 226 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
P76340 2.25e-30 115 30 2 220 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q9CCJ2 2.62e-30 114 34 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q9ZEP4 6.73e-30 114 33 4 231 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1XDC9 7.02e-30 114 28 5 229 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
O69730 8.33e-30 114 32 4 223 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q06239 1.09e-29 113 32 5 228 3 vanR Regulatory protein VanR Enterococcus faecium
P0A9Q4 1.45e-29 113 30 4 228 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 1.45e-29 113 30 4 228 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 1.45e-29 113 30 4 228 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 1.45e-29 113 30 4 228 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
O34903 1.69e-29 112 29 1 219 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q9AE24 1.76e-29 112 29 4 227 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q82EB1 2.17e-29 112 33 4 233 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8CQK0 2.31e-29 112 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 2.31e-29 112 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q99U73 2.82e-29 112 33 5 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P54884 3.25e-29 111 35 3 184 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P44918 3.3e-29 112 28 5 229 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4LAJ9 7.67e-29 111 31 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P38684 1.47e-28 110 32 5 225 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P58357 1.84e-28 110 33 5 224 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q47744 1.87e-28 109 30 5 227 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q49XM7 2.61e-28 109 31 2 217 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A160 2.69e-28 109 31 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9HUI2 2.86e-28 110 31 7 237 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4H8 2.93e-28 109 28 1 218 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.93e-28 109 28 1 218 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4L8L9 4.73e-28 108 29 1 219 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q7A216 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 5.77e-28 108 31 3 225 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 5.77e-28 108 31 3 225 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 5.77e-28 108 31 3 225 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 5.77e-28 108 31 3 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P08368 8.39e-28 108 35 3 181 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
P35163 2.36e-27 107 31 5 234 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
P13792 2.47e-27 107 30 4 236 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
O34951 3.8e-27 106 31 2 221 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q932F1 4.89e-27 106 30 2 221 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A8Z181 5.1e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 5.1e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 5.1e-27 106 30 2 221 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 5.1e-27 106 30 2 221 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 5.1e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
P31079 5.44e-27 106 31 4 225 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q6GJ11 5.5e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
Q7A1L2 5.61e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 5.61e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 5.61e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 5.61e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 5.61e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 5.61e-27 106 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YSS2 6.44e-27 105 30 2 221 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9TLQ4 9.42e-27 106 31 6 236 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q5HLN2 1.73e-26 104 28 1 221 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P42421 2.06e-26 104 29 2 224 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q9K621 2.09e-26 104 29 2 221 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8CQ37 2.23e-26 104 29 3 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 2.23e-26 104 29 3 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A0U4 2.25e-26 105 29 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 2.25e-26 105 29 3 232 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 2.25e-26 105 29 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 2.25e-26 105 29 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 2.25e-26 105 29 3 232 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 2.25e-26 105 29 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 2.25e-26 105 29 3 232 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 2.25e-26 105 29 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8CN92 2.9e-26 104 28 1 221 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q4L481 3.75e-26 103 30 2 221 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
Q8DPL7 4.9e-26 103 32 6 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 4.9e-26 103 32 6 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 4.9e-26 103 32 6 228 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P69228 9.37e-26 103 32 4 227 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 9.37e-26 103 32 4 227 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q44929 3.19e-25 102 31 4 231 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
Q07783 4.02e-25 101 30 4 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q04942 6.32e-25 100 31 2 220 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5HPC3 8e-25 100 31 2 216 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P55701 8.16e-25 100 25 1 222 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P13359 9.94e-25 100 30 5 226 3 virG Regulatory protein VirG Rhizobium rhizogenes
Q8CP82 1.48e-24 99 31 2 216 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P50350 1.87e-24 100 29 3 234 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q49ZT8 2.13e-24 99 30 5 221 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
G3XCY6 5.41e-24 99 29 6 228 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6QJK3 5.35e-23 95 28 2 207 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 5.35e-23 95 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P50351 6.05e-23 95 28 3 235 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7A039 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.23e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE73 1.32e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
P94504 1.66e-22 94 30 6 228 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q2YZ24 1.93e-22 94 28 2 207 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P54443 2.01e-22 94 33 5 227 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q7A1J1 3.55e-22 93 26 4 224 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 3.55e-22 93 26 4 224 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 3.55e-22 93 26 4 224 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 3.55e-22 93 26 4 224 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 3.55e-22 93 26 4 224 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 3.55e-22 93 26 4 224 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 3.55e-22 93 26 4 224 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 3.55e-22 93 26 4 224 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 3.55e-22 93 26 4 224 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 3.55e-22 93 26 4 224 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q9KM23 3.61e-22 94 31 5 223 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P07545 6.05e-22 93 30 5 226 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8CQ17 4.38e-21 90 29 6 227 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 4.38e-21 90 29 6 227 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P42244 5.14e-21 90 26 3 224 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
A0A0H3GGB5 2.95e-20 88 31 3 174 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P44895 3.73e-20 88 28 4 223 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AE90 4.81e-20 88 29 4 226 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 4.81e-20 88 29 4 226 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 4.81e-20 88 29 4 226 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
Q04803 1.06e-19 88 30 3 220 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62722 1.78e-19 87 29 5 226 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
O24973 1.81e-19 86 31 3 166 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
Q07597 5.29e-19 85 27 8 232 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
Q8DN02 9.08e-19 84 26 4 223 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 9.08e-19 84 26 4 223 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P33112 6.78e-18 82 30 5 220 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q44444 9.74e-18 82 29 5 226 3 virG Regulatory protein VirG Rhizobium radiobacter
O31432 2.72e-17 80 27 7 222 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q06065 4.14e-15 77 35 0 112 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
O32192 4.34e-15 74 24 4 222 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P40138 2.38e-14 74 33 2 121 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
P48359 3.1e-13 69 26 1 120 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P51586 7.89e-13 66 34 1 115 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q8KIY1 2.3e-12 69 36 4 132 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
O25918 3.41e-12 66 24 5 222 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
P52108 1.92e-11 64 24 5 231 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
B8GZM2 5.06e-11 65 30 4 122 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 5.06e-11 65 30 4 122 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P43501 5.53e-11 61 28 1 117 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFB8 7.14e-11 64 28 0 111 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 7.14e-11 64 28 0 111 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
T2KMF4 9.58e-11 64 28 5 168 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P41789 1.08e-10 63 28 0 111 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 1.18e-10 63 28 0 108 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 1.24e-10 63 30 0 102 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0DMC6 1.52e-10 63 29 0 108 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 1.85e-10 63 29 0 108 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P18769 2.3e-10 63 33 1 103 1 frzE Gliding motility regulatory protein Myxococcus xanthus
P14375 2.45e-10 62 22 2 204 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P45671 4.65e-10 62 22 3 209 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P72781 5.29e-10 60 27 2 122 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O29221 7.16e-10 61 30 4 133 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P46384 7.44e-10 58 25 1 116 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
E0X9C7 7.76e-10 61 33 3 128 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P03029 8.96e-10 61 29 0 108 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P10577 9.34e-10 61 27 0 108 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q8X613 1.04e-09 60 22 2 204 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
A5W4E3 1.05e-09 61 33 3 128 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q04848 1.09e-09 60 25 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P62646 1.16e-09 60 32 4 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P23221 1.6e-09 58 26 2 165 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q56312 1.72e-09 57 29 1 109 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P28787 2.59e-09 60 28 0 111 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P15940 2.65e-09 58 30 2 120 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P9WGM3 2.76e-09 58 33 2 118 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 2.76e-09 58 33 2 118 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9APD9 3.04e-09 59 30 0 106 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P58402 3.41e-09 59 34 0 103 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P25852 4.29e-09 59 31 0 106 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZM64 4.59e-09 56 25 3 128 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q8Z333 5.32e-09 58 31 0 106 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q9HU19 6.74e-09 58 28 1 130 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O74539 6.85e-09 58 35 3 117 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P30855 7.69e-09 58 29 1 131 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q9K998 8.87e-09 57 30 1 112 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P39486 1.02e-08 57 30 3 107 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q54SP4 1.03e-08 58 33 3 127 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 3.94e-08 56 28 3 128 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q1XDE4 1.05e-08 57 26 5 183 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P0AEV3 1.37e-08 57 30 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.37e-08 57 30 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.37e-08 57 30 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
P10576 1.71e-08 57 25 0 107 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q8D0P1 1.74e-08 54 28 2 106 3 cheY Chemotaxis protein CheY Yersinia pestis
P71403 1.85e-08 54 25 3 128 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q3LWR6 1.96e-08 56 28 4 173 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.96e-08 56 28 4 173 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.96e-08 56 28 4 173 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q00934 2.52e-08 57 30 2 121 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P24908 2.66e-08 55 30 1 107 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4H2 3.24e-08 55 28 1 116 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 3.24e-08 55 28 1 116 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 3.24e-08 55 28 1 116 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9WY30 4.18e-08 56 28 2 117 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P24072 4.32e-08 53 26 1 109 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P51343 4.44e-08 55 30 6 180 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q8FUS8 5.38e-08 55 27 3 155 3 ftcR Flagellar transcriptional regulator FtcR Brucella suis biovar 1 (strain 1330)
Q8YDL7 5.38e-08 55 27 3 155 1 ftcR Flagellar transcriptional regulator FtcR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q576I4 5.38e-08 55 27 3 155 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus biovar 1 (strain 9-941)
Q2YJF8 5.38e-08 55 27 3 155 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus (strain 2308)
B0R4K1 7.16e-08 52 28 0 103 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9I4N3 7.72e-08 55 31 0 102 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q10WZ6 8.1e-08 55 24 4 153 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q68WH4 8.34e-08 55 23 2 133 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P52938 1.2e-07 54 36 4 93 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
P06628 1.24e-07 52 27 0 107 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P52942 1.24e-07 52 27 0 107 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q93P00 1.41e-07 52 27 2 106 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P52931 1.42e-07 53 27 5 128 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
P48027 1.44e-07 55 31 5 129 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q4UL27 1.84e-07 54 22 2 133 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P09432 2.31e-07 53 27 1 137 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q15RF6 2.51e-07 53 28 6 145 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9ZCY9 2.55e-07 53 22 2 133 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P96602 3.14e-07 52 29 3 108 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q92HC2 3.15e-07 53 21 2 133 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1RJS1 3.35e-07 53 23 2 133 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
A1SMR4 3.75e-07 53 26 4 147 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q2RRX2 4.02e-07 53 26 3 142 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q9F8D7 4.28e-07 53 29 3 128 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
O07528 4.4e-07 52 33 1 111 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q9KQD8 4.99e-07 53 32 5 134 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q51455 5.16e-07 50 28 2 124 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5VW00 5.33e-07 52 26 3 155 3 ftcR Flagellar transcriptional regulator FtcR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P52940 6.73e-07 52 33 4 98 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
Q8KR08 8.29e-07 51 25 2 169 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P06534 8.69e-07 52 27 3 135 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q9HV27 1.04e-06 52 35 1 76 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AQ2 1.18e-06 52 26 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0A4H5 1.19e-06 49 23 1 110 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 1.19e-06 49 23 1 110 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q54YH4 1.3e-06 52 25 2 124 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P10958 1.36e-06 50 31 0 99 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
A1W0A5 1.37e-06 49 23 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 1.37e-06 49 23 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 1.37e-06 49 23 2 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9KL96 1.65e-06 50 28 3 124 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O87717 1.74e-06 51 30 8 167 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7WZY4 1.83e-06 50 28 2 131 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q54RP6 1.83e-06 51 28 3 115 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
O83639 2.21e-06 51 29 3 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q5A599 2.41e-06 51 31 4 113 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9KQD5 2.41e-06 48 25 2 121 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 2.41e-06 48 25 2 121 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P96686 2.57e-06 50 25 2 128 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q085K9 3.03e-06 50 30 6 148 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Shewanella frigidimarina (strain NCIMB 400)
O14002 3.17e-06 51 35 5 125 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P52936 3.28e-06 50 30 4 97 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q53228 3.67e-06 49 28 0 107 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P23747 3.68e-06 50 25 0 107 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8NYH3 3.88e-06 49 29 4 134 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MW2)
Q6GCL1 3.88e-06 49 29 4 134 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MSSA476)
Q88RJ6 3.92e-06 50 25 0 107 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8D4U6 4.38e-06 49 26 2 127 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
P60610 4.43e-06 49 29 4 134 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain N315)
P60609 4.43e-06 49 29 4 134 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJB5 4.43e-06 49 29 4 134 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain COL)
P60611 4.43e-06 49 29 4 134 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK09 4.43e-06 49 29 4 134 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain USA300)
Q2ILG8 4.58e-06 50 30 3 105 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3ADA6 4.66e-06 50 27 6 168 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P0AE69 4.95e-06 47 25 2 106 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 4.95e-06 47 25 2 106 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 4.95e-06 47 25 2 106 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q8FGP6 5.05e-06 47 25 2 106 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2SFK0 5.07e-06 50 36 3 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q1IQS9 5.38e-06 50 31 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
Q2KCH7 5.47e-06 47 27 2 118 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O05251 5.51e-06 49 27 5 143 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
O82868 5.78e-06 48 27 0 108 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q2YV67 6e-06 49 28 4 145 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P42508 7.31e-06 48 26 0 107 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q9FAD7 7.74e-06 47 25 2 106 3 cheY Chemotaxis protein CheY Enterobacter cloacae
O14283 8.31e-06 49 33 2 103 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0AXB7 9.04e-06 49 34 4 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P0A2D5 9.07e-06 47 25 2 106 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 9.07e-06 47 25 2 106 3 cheY Chemotaxis protein CheY Salmonella typhi
Q6GK51 1.03e-05 48 29 4 134 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MRSA252)
Q8F6P9 1.23e-05 48 28 6 145 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 1.23e-05 48 28 6 145 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P94586 1.23e-05 48 31 3 100 5 ywpD Putative uncharacterized protein YwpD Bacillus subtilis (strain 168)
Q2YIF7 1.24e-05 46 27 2 120 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
Q12YX1 1.33e-05 48 25 4 133 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q54YZ9 1.47e-05 48 26 3 119 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P95582 1.57e-05 47 26 3 152 3 gacA Response regulator GacA Pseudomonas viridiflava
Q2FMT2 1.6e-05 48 26 4 176 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
P44845 1.71e-05 47 25 2 117 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0AYL3 1.72e-05 48 26 3 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q9KA55 2.33e-05 47 27 2 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q24T61 2.73e-05 47 34 6 122 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
P58253 2.76e-05 47 30 4 103 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P9WMF9 2.88e-05 47 28 2 116 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 2.88e-05 47 28 2 116 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P42012 2.89e-05 47 24 3 137 3 spo0A Stage 0 sporulation protein A Lysinibacillus sphaericus
Q51373 2.92e-05 47 27 2 128 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KS59 3.05e-05 47 21 9 246 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4ZYD3 3.1e-05 47 27 5 137 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. syringae (strain B728a)
Q86AT9 3.11e-05 48 29 2 112 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q9KT84 3.28e-05 47 30 1 92 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87K77 3.35e-05 47 30 5 120 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q52376 3.89e-05 46 25 3 152 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
Q9P896 3.91e-05 47 25 2 110 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q3A5A8 4.14e-05 47 26 4 147 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q30RX5 4.29e-05 47 35 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q48ND9 4.37e-05 47 26 4 133 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q12PJ3 5.13e-05 47 32 5 113 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5V0B3 5.15e-05 47 33 3 105 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5SML5 5.46e-05 47 26 2 123 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 5.51e-05 47 26 2 123 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q47I43 5.54e-05 47 30 2 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
P52941 5.76e-05 46 28 2 119 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P13632 5.83e-05 47 26 0 107 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P94514 5.89e-05 46 25 2 124 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
P10046 6.1e-05 47 25 0 113 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q2T8Y6 6.17e-05 46 31 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3J1W3 6.39e-05 46 30 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P96126 6.71e-05 45 21 2 119 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
Q8KLS5 8.13e-05 46 30 3 105 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Cereibacter sphaeroides
Q9FGT7 8.16e-05 46 24 3 137 2 ARR18 Two-component response regulator ARR18 Arabidopsis thaliana
Q7NSI8 8.74e-05 46 29 2 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1IRH0 9.1e-05 46 25 4 132 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q2IQS6 9.11e-05 46 30 4 106 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
P0A4I4 9.14e-05 45 22 9 205 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 9.14e-05 45 22 9 205 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q89T55 9.36e-05 46 27 3 115 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9KSB1 9.87e-05 46 27 3 116 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45709 0.000108 43 22 1 116 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q4L8V4 0.000113 45 30 3 110 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
Q1QI44 0.000126 45 26 2 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9KM66 0.000136 45 25 1 104 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P33394 0.000158 43 36 0 58 3 rrf1 Protein Rrf1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8E217 0.000162 45 28 3 108 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 0.000162 45 28 3 108 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
P52929 0.000164 44 24 3 122 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
Q888V8 0.000183 45 27 7 148 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9C5U0 0.000189 45 26 5 132 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q3SVA1 0.000194 45 24 2 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7NV40 0.0002 45 28 5 137 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P30198 0.000215 44 25 2 147 4 epiQ Putative epidermin response regulator Staphylococcus epidermidis
Q0HIF6 0.000243 45 28 3 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
Q04849 0.000248 45 25 1 109 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O34723 0.00025 44 24 2 118 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q4L8Q6 0.000256 44 27 2 120 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q7MIQ5 0.000281 44 29 5 134 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain YJ016)
Q4A010 0.000285 44 27 2 117 3 lytR Sensory transduction protein LytR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DB67 0.000288 44 29 5 134 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Vibrio vulnificus (strain CMCP6)
P0C5S5 0.000317 44 29 2 93 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 0.000317 44 29 2 93 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q87MX7 0.000329 44 29 2 93 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q20YL8 0.000359 44 27 2 114 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodopseudomonas palustris (strain BisB18)
Q39T95 0.000362 44 26 3 131 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q87GU5 0.000366 44 29 1 103 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0HKN5 0.000378 44 30 6 133 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-4)
P43016 0.000381 44 31 1 76 3 hilA Transcriptional regulator HilA Salmonella typhi
Q82Z76 0.000385 43 29 3 125 4 lytT Sensory transduction protein LytT Enterococcus faecalis (strain ATCC 700802 / V583)
P52928 0.000398 43 22 9 205 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q0HWY6 0.0004 44 30 6 133 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-7)
Q8DVB7 0.00046 43 28 3 107 3 lytR Sensory transduction protein LytR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P45365 0.000488 44 32 1 75 3 None Uncharacterized 76.5 kDa protein in phbC 3'region Thiocystis violacea
Q0HVI0 0.000521 43 26 2 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q54SK5 0.000536 44 25 4 121 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
Q8RAZ3 0.000537 43 26 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P0AEC4 0.000552 44 26 5 120 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 0.000552 44 26 5 120 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 0.000562 44 26 5 120 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q54Q69 0.000591 44 29 2 113 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P0AEC5 0.000594 43 31 6 117 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04350
Feature type CDS
Gene phoP
Product two-component system response regulator PhoP
Location 977653 - 978327 (strand: -1)
Length 675 (nucleotides) / 224 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1980
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07660 two-component system, OmpR family, response regulator PhoP Cationic antimicrobial peptide (CAMP) resistance
Two-component system
Cationic antimicrobial peptide (CAMP) resistance, protease PgtE

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG004061 two-component system response regulator PhoP VF0111 Regulation

Protein Sequence

MRILIIEDNILLRHHLSVQFRDAGHQVDAAQDAKEADHFIAESTPDVAIVDLGLPDEDGISLIRRWRENNITIPIMVLTARESWQEKVTALNAGADDYVTKPFHFEEIVARVQALMRRNMGIASQILTIAPFELDLSRKEFMILGEQIKLTAFEYTILETLMRNQNKVVSKDVLMRQLYPDAEQRESHTIDVLMGRLRKKILQKYDNDVIVTVRGQGYRFDMKA

Flanking regions ( +/- flanking 50bp)

TTAATTTCTCTTATAGCAACTGATTTTTACTGATGTACACAAGGTGGAATATGCGGATCTTAATTATTGAAGATAATATCTTACTTCGCCATCATTTATCTGTGCAGTTTCGCGATGCAGGACATCAAGTTGATGCAGCACAGGATGCGAAAGAAGCCGATCACTTTATCGCAGAAAGTACACCTGATGTCGCCATTGTTGATTTAGGTCTTCCTGATGAAGATGGTATCAGCCTTATTCGTCGATGGCGGGAAAATAATATTACTATTCCCATTATGGTATTAACGGCTCGAGAAAGCTGGCAGGAAAAAGTGACCGCATTAAATGCCGGTGCTGATGATTATGTGACAAAGCCTTTTCATTTTGAAGAGATCGTGGCACGCGTTCAGGCATTAATGCGAAGAAACATGGGCATTGCATCACAAATACTGACTATTGCCCCTTTTGAGTTGGATTTATCACGTAAAGAGTTCATGATCTTAGGTGAGCAAATCAAGCTCACTGCATTCGAATATACTATTTTAGAAACATTAATGCGTAATCAAAACAAAGTGGTGAGCAAAGATGTGCTAATGCGCCAACTTTATCCTGATGCAGAGCAGCGAGAAAGTCATACCATTGATGTTCTTATGGGGCGTCTGCGCAAAAAAATTCTCCAAAAATATGATAATGATGTCATTGTAACTGTACGTGGACAAGGTTATCGTTTTGATATGAAAGCTTAATATGCATAAAAAACAACGTTCGCCCTTCTCTTTACGAACAAGATTTTTAC