Homologs in group_1943

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14575 FBDBKF_14575 94.2 Morganella morganii S1 phoP two-component system response regulator PhoP
EHELCC_15380 EHELCC_15380 94.2 Morganella morganii S2 phoP two-component system response regulator PhoP
NLDBIP_15910 NLDBIP_15910 94.2 Morganella morganii S4 phoP two-component system response regulator PhoP
LHKJJB_15930 LHKJJB_15930 94.2 Morganella morganii S3 phoP two-component system response regulator PhoP
HKOGLL_15050 HKOGLL_15050 94.2 Morganella morganii S5 phoP two-component system response regulator PhoP
PMI_RS04350 PMI_RS04350 74.6 Proteus mirabilis HI4320 phoP two-component system response regulator PhoP

Distribution of the homologs in the orthogroup group_1943

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1943

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X738 2.07e-116 333 71 0 223 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q83RR0 6.25e-116 332 71 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 6.25e-116 332 71 0 223 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23836 8.21e-116 332 71 0 223 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q8Z7H2 1.83e-114 329 69 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
P0DM78 4.07e-114 328 69 0 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 4.07e-114 328 69 0 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 4.07e-114 328 69 0 223 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 4.07e-114 328 69 0 223 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 4.07e-114 328 69 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC3 2.73e-113 326 68 0 223 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q9I4F9 3.12e-76 232 51 0 224 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I0I1 1.1e-46 157 39 2 225 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P30843 3.25e-42 145 35 1 223 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q70FH0 8.96e-42 144 35 1 218 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
Q7D9K0 7.88e-40 140 36 0 220 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 7.88e-40 140 36 0 220 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P36556 1.57e-39 138 33 1 218 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45337 3.28e-39 137 34 1 218 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52076 3.42e-39 137 34 1 223 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q8XBS3 9.02e-39 136 33 1 223 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q9HV32 1.55e-38 135 36 1 224 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1B3X8 2.46e-37 133 34 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 2.46e-37 133 34 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 2.46e-37 133 34 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
P9WGN1 3.3e-37 132 34 3 224 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 3.3e-37 132 34 3 224 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A1TEL7 5.09e-37 132 33 1 222 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P0CL17 1.31e-36 131 36 3 218 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.31e-36 131 36 3 218 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
A0R3I8 1.74e-36 130 34 2 222 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45605 4.55e-36 129 33 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P66795 8.72e-36 129 33 1 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 8.72e-36 129 33 1 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q02540 3.01e-35 127 35 3 225 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
L7N689 3.45e-35 128 34 3 224 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q742C1 4.36e-35 127 33 1 221 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 4.36e-35 127 33 1 221 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P45606 5.09e-35 127 32 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0AFJ5 5.43e-35 127 32 2 225 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 5.43e-35 127 32 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
A1KHB7 1.34e-34 126 33 1 221 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 1.34e-34 126 33 1 221 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8GP20 2.05e-34 125 33 1 218 1 rssB Swarming motility regulation protein RssB Serratia marcescens
P9WGM9 2.37e-34 125 33 1 221 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 2.37e-34 125 33 1 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 2.37e-34 125 33 1 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P0A4I0 2.98e-34 125 29 0 224 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2.98e-34 125 29 0 224 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
Q9CD68 3.2e-34 125 33 1 221 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
P45189 4.57e-34 124 32 2 223 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P21866 5.46e-34 124 33 4 225 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
A0PWB4 8.62e-34 124 32 1 223 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P45607 1.06e-33 123 31 2 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q44006 2.78e-33 122 31 1 223 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P0DMK7 5.91e-33 121 32 1 224 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 5.91e-33 121 32 1 224 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P39663 8.67e-33 122 33 4 232 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2FWH6 1.02e-32 121 31 2 202 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q52990 1.13e-32 120 34 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
O06978 3.43e-32 120 31 3 229 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
P9WGL9 6.23e-32 119 33 4 229 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 6.23e-32 119 33 4 229 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 6.23e-32 119 33 4 229 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23620 6.34e-32 119 30 3 225 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HUI2 2.29e-31 118 32 7 237 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28257 2.93e-31 118 29 5 230 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q01473 3.66e-31 123 32 1 225 3 rcaC Protein RcaC Microchaete diplosiphon
Q8FZ93 6.42e-31 116 32 1 219 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 6.42e-31 116 32 1 219 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 6.42e-31 116 32 1 219 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 6.42e-31 116 32 1 219 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 6.42e-31 116 32 1 219 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 6.42e-31 116 32 1 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 6.42e-31 116 32 1 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 6.42e-31 116 32 1 219 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q9F868 8.93e-31 116 33 4 230 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q31S42 1.03e-30 116 32 6 238 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6WZ81 1.11e-30 115 31 1 219 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P48259 1.46e-30 115 30 6 230 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
O78428 1.53e-30 116 30 4 229 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q47456 1.74e-30 115 33 2 218 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
Q7A216 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 2.15e-30 115 32 4 227 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 2.15e-30 115 32 4 227 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 2.15e-30 115 32 4 227 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 2.15e-30 115 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ9 3.98e-30 114 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
P32040 4.05e-30 115 33 5 234 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P37478 5.51e-30 114 32 3 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
B8H358 5.51e-30 114 31 1 219 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 5.51e-30 114 31 1 219 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8CQK0 5.66e-30 114 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 5.66e-30 114 32 4 227 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55933 5.86e-30 114 33 2 230 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q50136 6.86e-30 114 33 1 202 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
Q4A160 1.29e-29 113 32 5 226 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQ37 1.32e-29 112 30 2 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 1.32e-29 112 30 2 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P28835 1.42e-29 113 29 5 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q5HLN2 1.55e-29 112 29 1 221 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YSS2 2.35e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A0A4P7TS68 2.36e-29 112 33 6 233 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 2.36e-29 112 33 6 233 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 2.36e-29 112 33 6 233 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 2.36e-29 112 33 6 233 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 2.36e-29 112 33 6 233 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 2.36e-29 112 33 6 233 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 2.36e-29 112 33 6 233 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 2.36e-29 112 33 6 233 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
Q8CN92 2.91e-29 112 29 1 221 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A1L2 2.94e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 2.94e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 2.94e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 2.94e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 2.94e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 2.94e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WGM1 3.11e-29 112 33 1 202 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 3.11e-29 112 33 1 202 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 3.11e-29 112 33 1 202 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q932F1 3.24e-29 112 31 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A8Z181 5.4e-29 111 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 5.4e-29 111 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 5.4e-29 111 31 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 5.4e-29 111 31 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 5.4e-29 111 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
P51358 7.42e-29 111 29 5 233 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q9TLQ4 8.14e-29 111 32 6 233 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q1XDC9 8.98e-29 111 29 5 233 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q6GJ11 1.14e-28 110 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
Q55890 1.22e-28 110 31 5 228 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9AE24 1.22e-28 110 28 5 228 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q04942 1.34e-28 110 33 2 222 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P94413 1.75e-28 110 32 6 228 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
P0ACZ8 3.81e-28 109 30 1 219 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 3.81e-28 109 30 1 219 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 3.81e-28 109 30 1 219 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
P54884 7.91e-28 107 35 3 185 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P31079 8.88e-28 108 33 4 225 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q4L481 1.08e-27 108 29 2 221 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
O34903 1.29e-27 107 28 2 222 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P0C001 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 1.41e-27 107 30 2 217 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 1.41e-27 107 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
P13792 1.72e-27 107 31 3 231 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P42421 2.64e-27 107 31 5 229 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q06239 2.65e-27 107 29 5 228 3 vanR Regulatory protein VanR Enterococcus faecium
P76340 4.12e-27 106 28 2 222 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
P50350 5.34e-27 106 31 4 233 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q9ZEP4 6.15e-27 106 32 4 233 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P69228 8.6e-27 105 32 5 230 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 8.6e-27 105 32 5 230 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q82EB1 9.11e-27 105 32 4 234 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9ZHD3 1.69e-26 105 30 2 221 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q4L8L9 2.16e-26 104 30 1 219 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q07783 2.38e-26 105 33 5 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q99U73 2.59e-26 103 29 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q9K621 4.83e-26 103 27 2 221 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P08368 5.02e-26 103 29 2 219 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q49VK3 7.38e-26 103 29 2 221 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0A4I2 9.7e-26 102 31 1 220 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 9.7e-26 102 31 1 220 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O69730 1.32e-25 102 29 3 220 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A6QJK3 2.06e-25 102 29 5 227 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 2.06e-25 102 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P0A9Q4 3.46e-25 101 28 4 228 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 3.46e-25 101 28 4 228 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 3.46e-25 101 28 4 228 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 3.46e-25 101 28 4 228 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
Q2YZ24 4.41e-25 101 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P35163 4.51e-25 101 29 4 233 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q6GE73 4.65e-25 101 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q7A039 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 5.01e-25 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P50351 9.53e-25 100 31 4 238 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q44929 1.09e-24 100 28 5 236 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
Q47744 1.1e-24 100 28 3 221 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
Q4L6C6 1.25e-24 99 29 4 217 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q7A0U4 1.63e-24 100 28 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 1.63e-24 100 28 3 232 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 1.63e-24 100 28 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 1.63e-24 100 28 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 1.63e-24 100 28 3 232 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 1.63e-24 100 28 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 1.63e-24 100 28 3 232 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 1.63e-24 100 28 3 232 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P0A4H8 2.98e-24 99 27 1 218 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.98e-24 99 27 1 218 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DPL7 4.77e-24 98 30 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 4.77e-24 98 30 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 4.77e-24 98 30 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9KM23 1.26e-23 97 29 4 221 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44918 1.95e-23 97 26 4 228 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q49XM7 3.51e-23 96 30 4 218 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HPC3 5.75e-23 95 30 5 218 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49ZT8 7.74e-23 95 27 1 219 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O34951 8.51e-23 95 26 2 221 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q8CP82 1.04e-22 94 30 5 218 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A0QTK2 1.34e-22 94 31 2 219 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O24973 2.73e-22 94 33 4 165 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
P38684 4.02e-22 93 28 6 228 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P58357 4.66e-22 93 28 5 225 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
Q93CB8 5.24e-22 93 30 2 219 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 5.4e-22 93 30 2 219 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 5.4e-22 93 30 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 5.4e-22 93 30 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CCJ2 6.73e-22 92 30 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
P13359 7.08e-22 93 30 5 227 3 virG Regulatory protein VirG Rhizobium rhizogenes
P94504 4.03e-21 90 29 6 228 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q8CQ17 4.38e-21 90 30 6 208 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 4.38e-21 90 30 6 208 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P54443 7.52e-21 90 31 8 245 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q7A1J1 1.62e-20 89 30 5 204 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.62e-20 89 30 5 204 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.62e-20 89 30 5 204 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.62e-20 89 30 5 204 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.62e-20 89 30 5 204 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.62e-20 89 30 5 204 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.62e-20 89 30 5 204 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.62e-20 89 30 5 204 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.62e-20 89 30 5 204 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.62e-20 89 30 5 204 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q04803 1.73e-19 87 31 3 220 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P55701 2e-19 86 26 2 218 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P42244 2.85e-19 85 25 3 224 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q8DN02 4.62e-19 85 27 4 221 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 4.62e-19 85 27 4 221 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P07545 1.08e-18 85 31 5 227 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q07597 7.91e-18 82 26 3 182 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
A0A0H3GGB5 8.6e-18 82 31 3 174 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE90 1.05e-17 82 31 3 174 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 1.05e-17 82 31 3 174 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 1.05e-17 82 31 3 174 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P44895 2.35e-17 80 27 4 223 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
G3XCY6 2.61e-17 80 27 7 231 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31432 1.07e-16 79 28 7 224 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
P40138 1.36e-16 80 33 2 154 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
P62722 2.44e-16 79 31 6 227 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
O32192 2.14e-15 75 22 4 222 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P33112 4.96e-15 74 31 3 177 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q44444 1.07e-14 74 31 6 227 3 virG Regulatory protein VirG Rhizobium radiobacter
P52108 2.71e-14 72 27 7 227 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q06065 2.13e-12 68 30 0 107 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P48359 2.88e-12 66 24 1 122 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
O25918 4.71e-11 63 23 6 227 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
P43501 6.13e-11 61 27 1 117 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9F8D7 6.94e-11 64 35 6 142 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P0DMC6 1.89e-10 63 32 0 108 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 1.94e-10 63 32 0 108 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P51586 2.2e-10 59 32 1 115 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
O74539 2.4e-10 63 33 4 133 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8KIY1 2.42e-10 63 30 4 162 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P18769 3.44e-10 62 32 1 103 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q56128 4.31e-10 62 31 0 108 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 5.3e-10 62 32 0 106 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8D0P1 5.41e-10 58 28 2 121 3 cheY Chemotaxis protein CheY Yersinia pestis
P41789 6.15e-10 61 29 0 108 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45671 8.81e-10 61 25 0 128 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P0AFB8 9.57e-10 61 29 0 108 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 9.57e-10 61 29 0 108 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P48027 1.33e-09 60 34 7 155 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P46384 1.34e-09 57 25 1 116 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4H2 1.57e-09 58 27 2 147 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 1.57e-09 58 27 2 147 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 1.57e-09 58 27 2 147 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P9WGM3 1.99e-09 58 28 2 142 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.99e-09 58 28 2 142 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q54SP4 2.35e-09 60 33 2 136 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.6e-07 55 29 3 128 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P03029 2.4e-09 60 30 0 106 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
T2KMF4 3.63e-09 59 29 6 160 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
B0R4K1 3.81e-09 56 31 0 103 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q93P00 4.16e-09 56 28 2 121 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
Q56312 4.43e-09 56 32 1 109 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2RRX2 4.89e-09 58 32 4 140 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
O29221 5.37e-09 58 31 4 133 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P28787 7.27e-09 58 29 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q51455 8.62e-09 55 27 2 124 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KL96 9.57e-09 57 32 5 123 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9I4N3 1.06e-08 58 30 1 113 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P51343 1.3e-08 56 28 2 128 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P24072 1.32e-08 54 29 1 109 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
P62646 1.71e-08 57 31 3 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8FUS8 1.9e-08 56 27 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella suis biovar 1 (strain 1330)
Q8YDL7 1.9e-08 56 27 6 186 1 ftcR Flagellar transcriptional regulator FtcR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q576I4 1.9e-08 56 27 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus biovar 1 (strain 9-941)
Q2YJF8 1.9e-08 56 27 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus (strain 2308)
E0X9C7 2.4e-08 57 32 2 117 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P15940 2.83e-08 55 30 2 120 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P96602 3.06e-08 55 26 4 137 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q9KQD5 3.06e-08 53 25 2 121 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 3.06e-08 53 25 2 121 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A5W4E3 3.23e-08 57 32 2 117 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9FAD7 3.39e-08 53 29 3 118 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P24908 4.26e-08 55 31 1 107 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1W0A5 4.32e-08 53 24 3 130 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 4.32e-08 53 24 3 130 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 4.32e-08 53 24 3 130 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P39486 4.65e-08 55 25 3 143 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
B8GZM2 4.67e-08 56 27 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 4.67e-08 56 27 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1XDE4 5.29e-08 55 25 5 183 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P0A2D5 5.29e-08 53 30 2 106 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 5.29e-08 53 30 2 106 3 cheY Chemotaxis protein CheY Salmonella typhi
P0AE69 5.34e-08 53 30 2 106 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 5.34e-08 53 30 2 106 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 5.34e-08 53 30 2 106 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q8FGP6 5.56e-08 53 30 2 106 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9HU19 5.73e-08 55 28 0 102 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WY30 6.31e-08 55 33 2 106 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8NYH3 7.51e-08 54 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MW2)
Q6GCL1 7.51e-08 54 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MSSA476)
Q00934 8.03e-08 55 31 2 122 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54YZ9 8.57e-08 55 27 1 118 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P60610 8.84e-08 54 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain N315)
P60609 8.84e-08 54 31 3 129 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJB5 8.84e-08 54 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain COL)
P60611 8.84e-08 54 31 3 129 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK09 8.84e-08 54 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain USA300)
P30198 1.26e-07 53 24 3 149 4 epiQ Putative epidermin response regulator Staphylococcus epidermidis
A5VW00 1.33e-07 53 27 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P42508 1.58e-07 53 29 0 107 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q2YV67 1.84e-07 53 30 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P23747 1.94e-07 54 28 3 141 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6GK51 2.14e-07 53 30 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MRSA252)
P26275 2.25e-07 53 28 3 122 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04848 2.27e-07 54 21 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q88AQ2 2.29e-07 53 28 2 127 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P72781 2.45e-07 53 26 2 121 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P10577 2.5e-07 53 23 0 108 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q9K998 3.01e-07 52 27 1 112 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P23221 3.51e-07 52 24 2 163 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q87K77 4.18e-07 52 30 3 125 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q88RJ6 4.47e-07 53 28 2 127 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O83639 5.08e-07 53 29 3 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
P52936 5.17e-07 52 29 7 137 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q54Q69 5.48e-07 53 29 2 113 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P58402 7.34e-07 52 28 0 115 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q92HC2 7.56e-07 52 25 3 156 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P52940 7.76e-07 52 30 7 133 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
P09432 7.88e-07 52 24 0 109 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q5A599 8.01e-07 52 30 4 114 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P10576 8.18e-07 52 20 0 107 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P71403 8.43e-07 50 24 3 123 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P0A4H5 1.02e-06 49 26 1 114 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 1.02e-06 49 26 1 114 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P0AEV3 1.17e-06 51 28 0 103 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.17e-06 51 28 0 103 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.17e-06 51 28 0 103 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q0D3B6 1.23e-06 52 22 2 122 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
P94514 1.27e-06 51 26 5 180 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
Q9ZM64 1.35e-06 49 24 3 123 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
A2YQ93 1.37e-06 52 22 2 122 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
Q1IQS9 1.45e-06 51 33 5 110 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
P52931 1.58e-06 50 25 3 127 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
P45365 1.65e-06 51 27 1 118 3 None Uncharacterized 76.5 kDa protein in phbC 3'region Thiocystis violacea
O07528 1.68e-06 50 30 1 115 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q4UL27 1.74e-06 51 26 4 154 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P52938 1.84e-06 50 34 4 91 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q86AT9 2.42e-06 51 30 2 110 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q51373 2.5e-06 50 30 3 137 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O05251 2.6e-06 50 26 4 142 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
P58253 2.71e-06 50 29 6 134 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7CQM5 2.98e-06 49 26 1 116 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O14283 3.18e-06 50 31 0 102 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P30855 3.34e-06 50 27 0 115 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q8EQQ3 3.4e-06 50 24 3 158 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P26319 3.98e-06 49 27 0 100 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q24T61 4.61e-06 50 35 6 123 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
Q1RJS1 4.8e-06 50 25 4 154 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q53228 5.25e-06 48 28 1 120 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3LWR6 6.62e-06 48 25 6 191 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 6.62e-06 48 25 6 191 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 6.62e-06 48 25 6 191 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q68WH4 6.62e-06 49 23 2 131 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8DVB7 8.19e-06 48 32 3 108 3 lytR Sensory transduction protein LytR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q0AYL3 8.25e-06 49 27 3 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P95582 8.95e-06 48 28 3 146 3 gacA Response regulator GacA Pseudomonas viridiflava
P14375 9.66e-06 49 26 2 113 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q12YX1 1.03e-05 48 27 3 112 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q8FFE0 1.03e-05 48 32 3 118 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X613 1.08e-05 48 26 2 113 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P0AE41 1.09e-05 48 32 3 118 3 ypdB Transcriptional regulatory protein YpdB Shigella flexneri
P0AE39 1.09e-05 48 32 3 118 1 ypdB Transcriptional regulatory protein YpdB Escherichia coli (strain K12)
P0AE40 1.09e-05 48 32 3 118 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O157:H7
P0AEL8 1.12e-05 48 25 0 90 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.12e-05 48 25 0 90 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
P06534 1.14e-05 48 27 3 129 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
O82868 1.17e-05 47 29 0 108 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q9ZCY9 1.21e-05 48 23 2 131 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P06628 1.65e-05 46 26 0 107 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P52942 1.65e-05 46 26 0 107 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q39T95 1.69e-05 48 28 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P21649 1.7e-05 48 31 5 134 1 mrkE Protein MrkE Klebsiella pneumoniae
Q8D4U6 1.77e-05 48 25 2 127 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
Q9HV27 1.92e-05 48 32 1 76 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P25852 2.32e-05 48 28 2 108 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8F6P9 2.41e-05 47 27 3 117 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 2.41e-05 47 27 3 117 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8Z333 2.79e-05 47 28 2 108 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q52376 2.81e-05 47 28 3 146 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
Q2ILG8 2.82e-05 47 31 3 105 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
P52941 3.16e-05 47 28 3 122 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q10WZ6 3.31e-05 47 23 4 148 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P45709 3.52e-05 45 25 2 108 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q4L8V4 3.78e-05 47 30 2 110 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
Q4A010 3.78e-05 47 28 2 110 3 lytR Sensory transduction protein LytR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q3ADA6 3.81e-05 47 32 4 110 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P96686 3.86e-05 46 27 2 120 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P0A4I4 3.87e-05 47 26 4 132 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 3.87e-05 47 26 4 132 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8RAZ3 4.19e-05 47 29 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P44845 4.49e-05 46 26 3 118 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9APD9 4.87e-05 47 26 2 108 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q5SML5 4.94e-05 47 25 2 123 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 4.94e-05 47 25 2 123 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q5AHA0 5.27e-05 47 25 3 120 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P52928 5.42e-05 46 25 4 132 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
O14002 5.44e-05 47 31 2 115 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0AFU5 5.86e-05 47 31 0 100 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 5.86e-05 47 31 0 100 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q8E217 5.99e-05 46 32 5 110 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 5.99e-05 46 32 5 110 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
Q54RP6 7.62e-05 47 25 2 115 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q10N34 7.9e-05 46 23 2 122 2 PRR73 Two-component response regulator-like PRR73 Oryza sativa subsp. japonica
Q7MM78 8.15e-05 46 26 1 112 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 8.15e-05 46 26 1 112 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q7WZY4 8.18e-05 45 23 2 123 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
A2XFB7 8.35e-05 46 23 2 122 2 PRR73 Two-component response regulator-like PRR73 Oryza sativa subsp. indica
Q87GU5 8.52e-05 46 31 1 105 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KT84 9.99e-05 46 29 0 79 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1A699 0.000111 46 26 5 137 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
P0ACZ7 0.000128 45 26 0 71 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 0.000128 45 26 0 71 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 0.000128 45 26 0 71 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 0.000128 45 26 0 71 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
Q888V8 0.000136 45 28 5 132 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
O34723 0.000136 45 23 2 130 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q47I43 0.000139 45 29 2 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
P0C0F7 0.000157 45 28 1 106 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q2INJ8 0.000158 45 31 2 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
P0C0F6 0.000158 45 28 1 106 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9KS59 0.000163 45 27 4 116 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2YIF7 0.000164 43 25 2 120 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
Q0AWZ8 0.000165 45 29 4 107 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P0C5S5 0.000195 45 23 0 121 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 0.000195 45 23 0 121 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P10046 0.000198 45 26 0 109 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q9KM66 0.000199 45 25 2 104 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87MX7 0.00021 45 23 0 121 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LTM2 0.000212 45 26 3 108 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
P40759 0.000223 45 28 3 121 3 glnL Transcriptional regulatory protein GlnL Bacillus subtilis (strain 168)
P94586 0.000257 44 30 1 71 5 ywpD Putative uncharacterized protein YwpD Bacillus subtilis (strain 168)
P43016 0.000287 45 32 1 81 3 hilA Transcriptional regulator HilA Salmonella typhi
Q54YH4 0.000342 45 22 1 124 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q3J1W3 0.000358 44 30 4 110 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q2IQS6 0.000391 44 31 4 106 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q4ZYD3 0.000426 44 27 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. syringae (strain B728a)
Q2T8Y5 0.000439 44 28 2 105 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P32967 0.00044 43 28 2 111 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P13632 0.000444 44 24 0 107 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q75KW7 0.000466 42 28 2 112 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
Q8KLS5 0.000481 43 30 4 110 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Cereibacter sphaeroides
Q2SFK0 0.000487 43 33 3 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q54SK5 0.000512 44 23 2 121 3 dhkM Hybrid signal transduction histidine kinase M Dictyostelium discoideum
P33394 0.000521 42 28 2 81 3 rrf1 Protein Rrf1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0HIF6 0.000525 43 27 2 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-4)
Q04849 0.000526 43 22 1 109 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q0HVI0 0.00053 43 27 2 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella sp. (strain MR-7)
Q93WK5 0.00054 44 22 2 122 1 APRR7 Two-component response regulator-like APRR7 Arabidopsis thaliana
Q8L9Y3 0.000573 43 24 2 135 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
Q8KR08 0.000603 43 23 1 126 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P26487 0.000604 43 24 4 168 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q48ND9 0.000615 43 27 3 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P10958 0.000627 43 26 0 102 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q2KCH7 0.000639 42 26 2 118 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0A9Z5 0.00064 43 26 4 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1CWZ9 0.000696 43 32 2 108 3 cheB5 Protein-glutamate methylesterase/protein-glutamine glutaminase 5 Myxococcus xanthus (strain DK1622)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07370
Feature type CDS
Gene phoP
Product two-component system response regulator PhoP
Location 1537853 - 1538527 (strand: 1)
Length 675 (nucleotides) / 224 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1943
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07660 two-component system, OmpR family, response regulator PhoP Cationic antimicrobial peptide (CAMP) resistance
Two-component system
Cationic antimicrobial peptide (CAMP) resistance, protease PgtE

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG004061 two-component system response regulator PhoP VF0111 Regulation

Protein Sequence

MRVLIVEDNNLLRHHLMVQIRELGHQVDAAEDSKEADYFLQESQPDIAVVDLGLPGEDGMTMIARWRQQQVKIPIMVLTARESWQEKVAALNAGADDYVTKPFQLEEIVARMQALMRRNSGLASQQLELGIFTIDLSRKEFLVGDNAVKLTAFEYTIIETLMRDNGKVVSKDSLMRQLYPDAELRESHTIDVLMGRLRKKILVFTDVDAIVTVRGQGYRFDAKA

Flanking regions ( +/- flanking 50bp)

AATTCACGTCAGTTTTCTATCGGAATATCTGTATTTGTAAGGGATTGTGTATGCGCGTACTTATTGTTGAAGATAACAACTTACTTCGTCATCACCTGATGGTTCAGATCCGTGAACTCGGGCATCAGGTGGACGCTGCGGAAGATTCAAAAGAAGCAGATTATTTCCTTCAGGAAAGTCAGCCGGATATCGCGGTGGTTGACCTCGGGCTGCCCGGTGAAGATGGCATGACTATGATCGCCCGCTGGCGTCAGCAGCAGGTAAAAATCCCGATTATGGTTCTCACTGCCCGCGAAAGCTGGCAGGAGAAAGTCGCCGCCCTCAATGCCGGTGCAGATGATTACGTGACAAAACCTTTCCAGCTTGAAGAAATCGTTGCCCGGATGCAGGCATTAATGCGCCGTAACAGCGGGCTTGCCTCACAGCAACTGGAACTGGGTATTTTTACTATTGATCTCTCCCGTAAAGAATTTCTGGTCGGTGACAATGCGGTCAAACTGACTGCGTTTGAATACACTATTATTGAAACACTGATGCGCGATAATGGTAAAGTGGTCAGTAAAGATTCCCTGATGCGCCAGCTCTACCCGGATGCCGAATTGCGTGAAAGCCACACCATTGATGTCCTGATGGGACGGTTGCGTAAAAAAATCCTGGTCTTTACAGACGTGGATGCCATCGTCACTGTCCGTGGTCAGGGTTACCGTTTCGACGCCAAAGCATAATATTACGCCACAGAGGTAATTCGCATGACAATGCGAACCAAAAGTCCGTT