Homologs in group_1980

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14575 FBDBKF_14575 100.0 Morganella morganii S1 phoP two-component system response regulator PhoP
NLDBIP_15910 NLDBIP_15910 100.0 Morganella morganii S4 phoP two-component system response regulator PhoP
LHKJJB_15930 LHKJJB_15930 100.0 Morganella morganii S3 phoP two-component system response regulator PhoP
HKOGLL_15050 HKOGLL_15050 100.0 Morganella morganii S5 phoP two-component system response regulator PhoP
F4V73_RS07370 F4V73_RS07370 94.2 Morganella psychrotolerans phoP two-component system response regulator PhoP
PMI_RS04350 PMI_RS04350 74.1 Proteus mirabilis HI4320 phoP two-component system response regulator PhoP

Distribution of the homologs in the orthogroup group_1980

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1980

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X738 1.72e-117 336 72 0 221 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q8Z7H2 5.94e-117 335 71 0 221 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q83RR0 6.19e-117 335 72 0 221 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 6.19e-117 335 72 0 221 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23836 7.62e-117 335 72 0 221 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
P0DM78 1.24e-116 334 71 0 221 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 1.24e-116 334 71 0 221 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 1.24e-116 334 71 0 221 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 1.24e-116 334 71 0 221 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 1.24e-116 334 71 0 221 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC3 8.79e-116 332 71 0 221 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
Q9I4F9 2.61e-79 240 54 0 220 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I0I1 1.14e-46 157 39 2 221 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q70FH0 4.64e-42 145 35 1 224 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P0CL17 4.53e-41 142 36 3 223 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 4.53e-41 142 36 3 223 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P30843 1.06e-40 141 34 1 224 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
P52076 1.06e-40 141 35 1 218 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
P9WGN1 1.52e-40 141 36 3 224 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 1.52e-40 141 36 3 224 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8XBS3 2.05e-40 140 35 1 218 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
Q7D9K0 2.42e-40 141 36 1 226 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 2.42e-40 141 36 1 226 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P45337 2.5e-40 140 35 1 218 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36556 3.43e-40 140 33 1 218 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HV32 5.56e-39 137 37 1 221 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
L7N689 2.26e-38 136 35 2 221 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q1B3X8 7.01e-38 134 35 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 7.01e-38 134 35 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 7.01e-38 134 35 1 221 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
A0R3I8 9.47e-38 134 35 2 222 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8GP20 9.42e-37 131 35 1 218 1 rssB Swarming motility regulation protein RssB Serratia marcescens
A1TEL7 9.48e-37 131 33 1 222 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q02540 1.26e-36 131 36 3 224 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
P66795 1.46e-36 130 33 1 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 1.46e-36 130 33 1 218 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
P9WGL9 7.08e-36 129 35 3 225 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 7.08e-36 129 35 3 225 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 7.08e-36 129 35 3 225 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q742C1 1.35e-35 128 34 1 221 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 1.35e-35 128 34 1 221 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
P39663 2.79e-35 128 34 4 232 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1KHB7 5.63e-35 127 33 1 221 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 5.63e-35 127 33 1 221 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0PWB4 5.92e-35 127 33 1 223 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P0DMK7 6.58e-35 127 33 1 218 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 6.58e-35 127 33 1 218 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
P23620 7.65e-35 126 32 3 221 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGM9 1.04e-34 126 33 1 221 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.04e-34 126 33 1 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.04e-34 126 33 1 221 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P45605 1.31e-34 126 33 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
A6WZ81 1.44e-34 125 33 1 219 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P45189 1.6e-34 125 32 2 223 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CD68 1.89e-34 125 33 1 221 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q01473 2.01e-34 132 34 1 223 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 0.000319 44 24 1 125 3 rcaC Protein RcaC Microchaete diplosiphon
Q8FZ93 4.53e-34 124 33 1 219 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 4.53e-34 124 33 1 219 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 4.53e-34 124 33 1 219 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 4.53e-34 124 33 1 219 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 4.53e-34 124 33 1 219 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 4.53e-34 124 33 1 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 4.53e-34 124 33 1 219 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 4.53e-34 124 33 1 219 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P45606 4.63e-34 124 32 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
Q9F868 4.71e-34 124 34 3 226 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0AFJ5 5.55e-34 124 32 2 224 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 5.55e-34 124 32 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q2FWH6 6.23e-34 124 31 4 223 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
B8H358 1.33e-33 123 33 1 219 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 1.33e-33 123 33 1 219 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q50136 1.7e-33 123 35 1 202 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
O06978 1.98e-33 123 31 3 233 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
P21866 2.08e-33 122 34 3 221 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q52990 2.21e-33 122 34 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q9HUI2 2.28e-33 123 34 8 236 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I0 2.43e-33 122 29 0 221 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 2.43e-33 122 29 0 221 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
P48259 3.44e-33 122 30 6 230 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
P28257 5.76e-33 122 30 5 230 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
P9WGM1 8.91e-33 121 35 1 202 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 8.91e-33 121 35 1 202 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 8.91e-33 121 35 1 202 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45607 1.05e-32 121 31 2 224 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
Q47456 2.58e-32 120 33 2 218 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
O78428 2.61e-32 120 30 4 229 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q44006 6.25e-32 119 31 1 221 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q04942 9.59e-32 118 33 2 221 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4LAJ9 9.96e-32 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q8CQK0 1.05e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 1.05e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A216 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 1.1e-31 118 33 4 225 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 1.1e-31 118 33 4 225 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 1.1e-31 118 33 4 225 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 1.1e-31 118 33 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q55933 1.84e-31 118 33 2 230 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P32040 1.9e-31 118 33 5 234 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P37478 2e-31 118 33 3 225 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
P54884 2.41e-31 116 36 3 185 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
Q4A160 2.66e-31 117 32 4 225 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CQ37 5.81e-31 116 31 2 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 5.81e-31 116 31 2 221 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P28835 5.97e-31 117 29 5 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P76340 8.41e-31 115 30 2 224 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q55890 9.55e-31 116 31 5 228 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0ACZ8 1.15e-30 115 31 1 219 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 1.15e-30 115 31 1 219 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 1.15e-30 115 31 1 219 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q5HLN2 1.74e-30 115 30 1 221 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0C001 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 1.75e-30 115 31 2 217 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 1.75e-30 115 31 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q31S42 1.88e-30 115 32 5 228 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8CN92 3.53e-30 114 30 1 221 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P51358 6.65e-30 114 29 5 229 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q1XDC9 7.8e-30 114 29 5 233 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q2YSS2 1.21e-29 113 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9TLQ4 1.25e-29 113 32 6 233 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
P94413 1.35e-29 113 32 4 227 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q7A1L2 1.46e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 1.46e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 1.46e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 1.46e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 1.46e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 1.46e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q932F1 1.55e-29 112 31 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A4P7TS68 1.61e-29 113 31 3 227 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 1.61e-29 113 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 1.61e-29 113 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 1.61e-29 113 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 1.61e-29 113 31 3 227 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 1.61e-29 113 31 3 227 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 1.61e-29 113 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 1.61e-29 113 31 3 227 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
A8Z181 2.82e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 2.82e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 2.82e-29 112 31 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 2.82e-29 112 31 4 222 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 2.82e-29 112 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q6GJ11 4.45e-29 111 31 4 222 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
P13792 7.15e-29 111 31 3 234 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
Q99U73 8.1e-29 110 30 2 217 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
P35163 8.47e-29 111 31 3 232 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q06239 9.75e-29 110 31 5 228 3 vanR Regulatory protein VanR Enterococcus faecium
Q4L8L9 1.83e-28 110 30 1 219 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
P50350 1.86e-28 110 31 4 233 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P0A9Q4 2.02e-28 110 29 4 228 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 2.02e-28 110 29 4 228 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 2.02e-28 110 29 4 228 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 2.02e-28 110 29 4 228 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P0A4I2 2.53e-28 109 33 1 220 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 2.53e-28 109 33 1 220 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9ZEP4 3.33e-28 109 33 4 233 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O69730 3.63e-28 109 30 3 220 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P69228 4.39e-28 109 32 4 225 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 4.39e-28 109 32 4 225 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q4L6C6 4.92e-28 108 30 4 217 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
Q82EB1 6.51e-28 108 32 3 234 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q4L481 8.85e-28 108 29 2 221 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
Q07783 9.83e-28 108 31 4 235 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q49VK3 1.34e-27 107 29 2 221 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49XM7 1.54e-27 107 32 4 218 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9ZHD3 2.11e-27 107 30 2 221 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
Q47744 2.26e-27 107 29 3 221 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
O34903 2.45e-27 107 28 2 222 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q5HPC3 5.38e-27 105 32 5 218 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P42421 7.08e-27 105 30 4 227 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
P0A4H8 9.54e-27 105 28 1 218 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 9.54e-27 105 28 1 218 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8CP82 1.03e-26 105 32 5 218 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P31079 2.25e-26 104 32 4 225 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P08368 2.27e-26 104 29 2 219 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
P50351 2.3e-26 105 31 4 234 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9AE24 3.05e-26 104 26 2 222 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q8DPL7 3.31e-26 104 30 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 3.31e-26 104 30 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 3.31e-26 104 30 3 227 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P38684 3.66e-26 104 30 6 228 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P44918 4.05e-26 104 27 4 228 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P58357 4.87e-26 103 30 5 225 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
A0QTK2 5.02e-26 103 32 2 219 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9K621 6.42e-26 103 26 2 221 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q93CB8 2.04e-25 102 31 2 219 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
O34951 2.08e-25 102 28 2 221 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
P9WGM7 2.09e-25 102 31 2 219 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 2.09e-25 102 31 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 2.09e-25 102 31 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9CCJ2 2.44e-25 102 31 2 219 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q9KM23 3.69e-25 102 30 4 221 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2YZ24 5.74e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A0U4 8.49e-25 100 29 3 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 8.49e-25 100 29 3 229 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 8.49e-25 100 29 3 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 8.49e-25 100 29 3 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 8.49e-25 100 29 3 229 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 8.49e-25 100 29 3 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 8.49e-25 100 29 3 229 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 8.49e-25 100 29 3 229 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A039 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 9.85e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE73 9.95e-25 100 28 4 223 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
A6QJK3 1.01e-24 100 29 5 227 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.01e-24 100 29 5 227 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P13359 3.95e-24 99 31 5 227 3 virG Regulatory protein VirG Rhizobium rhizogenes
Q7A1J1 1.55e-23 97 30 5 207 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 1.55e-23 97 30 5 207 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 1.55e-23 97 30 5 207 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 1.55e-23 97 30 5 207 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 1.55e-23 97 30 5 207 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 1.55e-23 97 30 5 207 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 1.55e-23 97 30 5 207 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 1.55e-23 97 30 5 207 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 1.55e-23 97 30 5 207 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 1.55e-23 97 30 5 207 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q49ZT8 3.9e-23 96 26 1 219 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O24973 9.06e-23 95 33 4 165 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
P55701 1.72e-22 94 27 2 218 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P42244 1.87e-22 94 26 3 224 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q44929 2.41e-22 94 27 4 228 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P94504 3.05e-22 94 30 5 225 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
P0AE90 5.39e-22 93 32 4 226 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 5.39e-22 93 32 4 226 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 5.39e-22 93 32 4 226 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
P54443 1.55e-21 92 31 6 233 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q04803 1.69e-21 93 30 5 231 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8CQ17 2.39e-21 91 27 3 228 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 2.39e-21 91 27 3 228 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P07545 9.05e-21 90 32 5 227 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
A0A0H3GGB5 1.03e-20 89 31 6 230 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
G3XCY6 1.27e-20 89 28 7 226 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DN02 2.98e-19 85 27 4 221 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 2.98e-19 85 27 4 221 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q07597 1.08e-18 84 26 3 182 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
O31432 1.1e-18 84 29 6 223 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
P62722 3.8e-18 83 32 6 227 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
O32192 8.42e-18 82 24 4 222 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
P44895 5.66e-17 79 27 4 223 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P33112 1.43e-16 78 30 5 205 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
Q44444 1.57e-16 79 32 6 227 3 virG Regulatory protein VirG Rhizobium radiobacter
P40138 3.92e-16 79 32 3 168 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q06065 9.19e-13 70 30 0 107 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P52108 2.45e-12 67 24 4 231 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
P48359 2.63e-12 66 25 1 122 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P43501 6.87e-12 63 29 1 117 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O25918 3.18e-11 63 24 6 224 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q8FUS8 4.96e-11 63 29 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella suis biovar 1 (strain 1330)
Q8YDL7 4.96e-11 63 29 6 186 1 ftcR Flagellar transcriptional regulator FtcR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q576I4 4.96e-11 63 29 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus biovar 1 (strain 9-941)
Q2YJF8 4.96e-11 63 29 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus (strain 2308)
Q9F8D7 1e-10 64 35 6 153 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P0DMC6 1.05e-10 64 33 0 108 1 rcsC Sensor histidine kinase RcsC Escherichia coli
O74539 1.09e-10 64 35 5 137 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0DMC5 1.13e-10 64 33 0 108 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P45671 1.2e-10 63 27 0 128 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P51586 1.67e-10 60 33 1 115 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
P41789 1.81e-10 63 30 0 108 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 2.34e-10 63 32 0 108 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 2.83e-10 63 33 0 106 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFB8 2.85e-10 62 30 0 108 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 2.85e-10 62 30 0 108 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
A5VW00 3.84e-10 61 28 6 186 3 ftcR Flagellar transcriptional regulator FtcR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8KIY1 4.33e-10 62 34 2 117 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8D0P1 4.59e-10 58 29 2 121 3 cheY Chemotaxis protein CheY Yersinia pestis
P46384 5.65e-10 58 25 1 116 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P03029 6.27e-10 61 31 0 106 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
O29221 9.34e-10 60 32 4 133 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P0A4H2 1.1e-09 59 28 1 128 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 1.1e-09 59 28 1 128 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 1.1e-09 59 28 1 128 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P9WGM3 1.38e-09 59 33 2 118 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.38e-09 59 33 2 118 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P18769 1.39e-09 60 32 1 103 1 frzE Gliding motility regulatory protein Myxococcus xanthus
P48027 1.41e-09 60 33 6 160 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q9KL96 1.69e-09 59 33 5 123 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P51343 2.38e-09 58 28 6 183 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
B0R4K1 2.38e-09 56 32 0 103 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9I4N3 3.04e-09 59 31 1 113 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P30198 3.11e-09 58 26 3 149 4 epiQ Putative epidermin response regulator Staphylococcus epidermidis
T2KMF4 3.4e-09 59 25 5 209 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
E0X9C7 3.77e-09 59 33 2 117 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q93P00 3.87e-09 56 28 2 121 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
A5W4E3 4.81e-09 59 33 2 117 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q51455 5.98e-09 55 28 2 124 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P15940 6.67e-09 57 30 2 120 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8NYH3 7.02e-09 57 32 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MW2)
Q6GCL1 7.02e-09 57 32 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MSSA476)
P60610 8.28e-09 57 32 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain N315)
P60609 8.28e-09 57 32 3 129 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJB5 8.28e-09 57 32 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain COL)
P60611 8.28e-09 57 32 3 129 1 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK09 8.28e-09 57 32 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain USA300)
Q56312 1.2e-08 54 31 1 109 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q54SP4 1.4e-08 58 35 2 116 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 8.06e-08 55 30 3 128 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P23221 1.42e-08 56 26 2 163 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HU19 1.49e-08 57 28 1 131 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P24072 1.65e-08 54 29 1 109 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
Q2YV67 1.85e-08 56 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KQD5 1.96e-08 54 26 2 121 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.96e-08 54 26 2 121 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6GK51 2.02e-08 56 31 3 129 3 lytR Transcriptional regulatory protein LytR Staphylococcus aureus (strain MRSA252)
P23747 2.04e-08 57 27 4 162 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28787 2.27e-08 57 28 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P62646 2.54e-08 57 33 4 113 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A1W0A5 2.58e-08 54 26 3 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 2.58e-08 54 26 3 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 2.58e-08 54 26 3 125 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9FAD7 2.66e-08 54 30 3 118 3 cheY Chemotaxis protein CheY Enterobacter cloacae
Q9WY30 3.15e-08 56 31 2 117 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2RRX2 3.17e-08 56 30 4 140 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q00934 3.77e-08 56 31 2 122 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A2D5 3.83e-08 53 31 2 106 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 3.83e-08 53 31 2 106 3 cheY Chemotaxis protein CheY Salmonella typhi
Q1XDE4 3.83e-08 55 25 5 184 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P0AE69 4.03e-08 53 31 2 106 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 4.03e-08 53 31 2 106 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 4.03e-08 53 31 2 106 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
Q8FGP6 4.28e-08 53 31 2 106 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P24908 4.79e-08 55 33 2 109 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B8GZM2 5.04e-08 56 27 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 5.04e-08 56 27 1 118 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q88AQ2 5.3e-08 55 26 4 162 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88RJ6 6.94e-08 55 27 4 162 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q04848 8.69e-08 55 22 0 108 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P09432 9.71e-08 55 26 0 109 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P96602 1.1e-07 54 29 3 111 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
P52940 1.13e-07 54 32 7 134 3 spo0A Stage 0 sporulation protein A homolog Clostridium pasteurianum
P10577 1.16e-07 55 24 0 108 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q54YZ9 1.19e-07 55 30 3 116 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P72781 1.31e-07 53 27 3 135 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P42508 1.52e-07 53 29 0 107 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q87K77 2.34e-07 53 31 3 125 3 VPA0021 Uncharacterized response regulatory protein VPA0021 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P94514 2.57e-07 53 24 5 222 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
P10576 3e-07 53 21 0 107 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q4UL27 3.19e-07 53 27 4 153 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92HC2 4.17e-07 53 26 2 134 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1IQS9 4.29e-07 53 32 4 110 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Koribacter versatilis (strain Ellin345)
P52931 4.31e-07 52 24 4 133 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
P39486 4.93e-07 52 26 1 106 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
P26275 5.08e-07 52 28 3 122 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P71403 6.3e-07 50 25 3 123 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
Q3LWR6 6.4e-07 52 25 5 187 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 6.4e-07 52 25 5 187 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 6.4e-07 52 25 5 187 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q0D3B6 6.96e-07 52 23 2 122 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. japonica
P0AEV3 7.47e-07 52 28 0 103 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 7.47e-07 52 28 0 103 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 7.47e-07 52 28 0 103 3 rssB Regulator of RpoS Escherichia coli O157:H7
A2YQ93 8.31e-07 52 23 2 122 2 PRR37 Two-component response regulator-like PRR37 Oryza sativa subsp. indica
Q9ZM64 9.41e-07 49 25 3 123 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
P52928 9.96e-07 51 24 9 249 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q8EQQ3 1.05e-06 51 25 3 158 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q51373 1.23e-06 50 32 2 111 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9K998 1.35e-06 51 27 1 112 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O83639 1.35e-06 51 28 3 116 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q68WH4 1.42e-06 51 26 4 153 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q86AT9 1.53e-06 52 30 2 110 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q5A599 1.91e-06 51 29 4 114 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0A4H5 2.02e-06 48 26 1 114 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 2.02e-06 48 26 1 114 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P52936 2.07e-06 50 33 5 100 3 spo0A Stage 0 sporulation protein A homolog Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q54Q69 2.23e-06 51 29 2 113 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P58402 2.25e-06 51 29 0 115 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P45365 2.35e-06 51 27 1 118 3 None Uncharacterized 76.5 kDa protein in phbC 3'region Thiocystis violacea
Q1RJS1 2.8e-06 50 25 2 134 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P52938 2.89e-06 50 34 4 91 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
Q9ZCY9 2.96e-06 50 26 4 153 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P14375 3.12e-06 50 25 2 126 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P26319 3.25e-06 49 25 1 129 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FFE0 3.79e-06 49 31 3 118 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A4I4 3.92e-06 50 24 9 249 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 3.92e-06 50 24 9 249 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8D4U6 4.03e-06 49 26 2 127 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
P0AE41 4.22e-06 49 31 3 118 3 ypdB Transcriptional regulatory protein YpdB Shigella flexneri
P0AE39 4.22e-06 49 31 3 118 1 ypdB Transcriptional regulatory protein YpdB Escherichia coli (strain K12)
P0AE40 4.22e-06 49 31 3 118 3 ypdB Transcriptional regulatory protein YpdB Escherichia coli O157:H7
O14002 4.42e-06 50 34 3 115 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P06534 5.08e-06 49 27 3 129 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
O07528 5.09e-06 49 30 1 115 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q8DVB7 5.55e-06 49 32 3 108 3 lytR Sensory transduction protein LytR Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q53228 5.79e-06 48 28 1 120 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O14283 6.6e-06 49 32 0 102 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8X613 8.03e-06 49 27 2 113 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P06628 9.07e-06 47 26 0 107 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
P21649 9.08e-06 48 31 5 134 1 mrkE Protein MrkE Klebsiella pneumoniae
Q10WZ6 9.93e-06 48 24 3 142 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
O05251 1.13e-05 48 28 2 108 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
P0AEL8 1.19e-05 48 25 0 90 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.19e-05 48 25 0 90 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
P95582 1.2e-05 48 31 2 111 3 gacA Response regulator GacA Pseudomonas viridiflava
P30855 1.22e-05 49 28 0 115 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
O82868 1.32e-05 47 29 0 108 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
P58253 1.49e-05 48 30 6 124 3 spo0A Stage 0 sporulation protein A homolog Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4A010 1.67e-05 48 28 3 128 3 lytR Sensory transduction protein LytR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P25852 1.73e-05 48 29 2 108 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26487 1.86e-05 47 25 4 168 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q12YX1 2.18e-05 48 27 3 112 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q8Z333 2.2e-05 48 29 2 108 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P52942 2.24e-05 45 26 0 107 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
Q24T61 2.27e-05 48 35 6 123 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Desulfitobacterium hafniense (strain Y51)
Q54RP6 2.33e-05 48 26 2 115 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q7CQM5 2.33e-05 47 26 1 116 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4L8V4 2.55e-05 47 30 2 110 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
Q5SML5 2.84e-05 48 26 2 123 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
B8B3I4 2.92e-05 48 26 2 123 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q10N34 2.93e-05 48 24 2 122 2 PRR73 Two-component response regulator-like PRR73 Oryza sativa subsp. japonica
P52941 2.93e-05 47 28 3 122 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9HV27 2.94e-05 47 32 1 76 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A2XFB7 2.96e-05 48 24 2 122 2 PRR73 Two-component response regulator-like PRR73 Oryza sativa subsp. indica
Q7WZY4 3.45e-05 47 23 2 123 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q52376 3.47e-05 46 30 2 111 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P44845 3.54e-05 46 27 3 118 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8KR08 4.77e-05 46 22 3 184 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q39T95 4.99e-05 47 28 2 106 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q8E217 5.15e-05 46 32 5 110 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7H3 5.15e-05 46 32 5 110 3 lytR Sensory transduction protein LytR Streptococcus agalactiae serotype III (strain NEM316)
A1A699 5.65e-05 47 27 5 137 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
P32967 6.39e-05 45 30 2 111 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q9APD9 6.54e-05 46 27 2 108 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q8F6P9 6.92e-05 46 25 3 117 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62641 6.92e-05 46 25 3 117 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8L500 7.32e-05 46 27 2 122 1 APRR9 Two-component response regulator-like APRR9 Arabidopsis thaliana
P0AFU5 7.86e-05 46 32 0 100 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 7.86e-05 46 32 0 100 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P45709 7.92e-05 44 25 2 105 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
O87717 8.01e-05 46 29 7 167 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q93WK5 8.04e-05 46 24 2 122 1 APRR7 Two-component response regulator-like APRR7 Arabidopsis thaliana
O34723 8.45e-05 45 23 4 178 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q9LVG4 8.49e-05 46 24 2 122 1 APRR3 Two-component response regulator-like APRR3 Arabidopsis thaliana
P10046 9.06e-05 46 27 0 109 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P0C5S5 9.18e-05 46 25 1 120 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 9.18e-05 46 25 1 120 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P96686 9.43e-05 45 29 3 121 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q9KS59 9.94e-05 46 27 4 116 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87MX7 0.000102 46 25 1 120 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0AYL3 0.000106 45 28 4 106 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2INJ8 0.000106 45 31 2 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q87GU5 0.000107 46 31 1 105 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0C0F6 0.000115 46 29 1 106 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 0.000116 46 29 1 106 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q54YH4 0.000117 46 23 1 124 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q9KT84 0.00015 45 29 0 79 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2KCH7 0.000156 43 27 2 118 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2YIF7 0.000164 43 25 2 120 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
Q551X9 0.00017 45 26 1 113 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P43016 0.000178 45 33 1 74 3 hilA Transcriptional regulator HilA Salmonella typhi
Q8L9Y3 0.000199 45 25 2 135 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
P13632 0.000207 45 25 0 107 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q6LTM2 0.000214 45 26 4 112 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
Q5AHA0 0.000228 45 26 5 121 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q7MM78 0.000232 45 25 0 118 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 0.000232 45 25 0 118 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P0ACZ7 0.000243 44 26 0 71 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 0.000243 44 26 0 71 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 0.000243 44 26 0 71 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 0.000243 44 26 0 71 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
Q47I43 0.000266 44 29 2 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
Q8GVV6 0.00029 42 27 4 111 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. japonica
Q4GZK3 0.00029 42 27 4 111 2 RR8 Two-component response regulator ORR8 Oryza sativa subsp. indica
Q8RAZ3 0.000293 44 28 3 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9KM66 0.000297 45 25 1 104 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q04849 0.000309 44 23 1 109 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q4L8Q6 0.000325 43 25 2 104 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q6LA42 0.00033 44 24 3 132 1 APRR5 Two-component response regulator-like APRR5 Arabidopsis thaliana
P10958 0.000336 43 27 0 102 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q75KW7 0.000358 42 29 2 112 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
P94586 0.000365 44 36 0 55 5 ywpD Putative uncharacterized protein YwpD Bacillus subtilis (strain 168)
Q7NSI8 0.000392 44 29 3 116 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9UYF3 0.000432 44 27 4 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q3J1W3 0.00048 43 29 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q689G6 0.000517 44 25 2 122 2 PRR95 Two-component response regulator-like PRR95 Oryza sativa subsp. japonica
P33394 0.000621 42 33 0 54 3 rrf1 Protein Rrf1 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P43015 0.000625 43 32 1 74 2 hilA Transcriptional regulator HilA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52932 0.000631 43 25 4 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q8KLS5 0.000639 43 29 3 105 1 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Cereibacter sphaeroides
P40759 0.000662 43 28 3 121 3 glnL Transcriptional regulatory protein GlnL Bacillus subtilis (strain 168)
Q5PEB1 0.000666 43 32 1 74 3 hilA Transcriptional regulator HilA Salmonella paratyphi A (strain ATCC 9150 / SARB42)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_15380
Feature type CDS
Gene phoP
Product two-component system response regulator PhoP
Location 39689 - 40363 (strand: 1)
Length 675 (nucleotides) / 224 (amino acids)
In genomic island -

Contig

Accession ZDB_226
Length 116685 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1980
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07660 two-component system, OmpR family, response regulator PhoP Cationic antimicrobial peptide (CAMP) resistance
Two-component system
Cationic antimicrobial peptide (CAMP) resistance, protease PgtE

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG004061 two-component system response regulator PhoP VF0111 Regulation

Protein Sequence

MRVLIVEDNNLLRHHLTVQLRELGHQVDAAEDSKEADYFLQESQPDIAVVDLGLPGEDGMVMIARWRQQQVKIPIMVLTARESWQEKVAALNAGADDYVTKPFQLEEIVARMQALMRRNSGLASQTLELGIFVIDLSRKEFLVDGNAVKLTAFEYTIIETLMRNNGKVVSKDSLMRQLYPDAELRESHTIDVLMGRLRKKIQAFTDIDAIVTVRGQGYRFDAGK

Flanking regions ( +/- flanking 50bp)

CAATTCACATCGTTTCCTGTTGGGATGTCTGTCTTTGTAAGGAATTATGTATGCGCGTGCTCATCGTGGAAGATAACAATTTACTCCGTCATCATCTGACGGTTCAGCTCCGCGAGCTCGGCCATCAGGTTGATGCGGCGGAAGATTCAAAAGAAGCAGATTATTTTCTTCAGGAAAGTCAGCCGGATATCGCAGTGGTTGACCTCGGTCTGCCCGGCGAGGACGGCATGGTGATGATTGCCCGCTGGCGTCAGCAGCAGGTCAAAATCCCGATTATGGTGCTGACCGCCCGTGAAAGCTGGCAGGAAAAAGTCGCCGCGCTGAATGCCGGGGCGGATGATTATGTCACCAAGCCTTTCCAGCTGGAAGAGATTGTTGCCCGTATGCAGGCACTGATGCGCCGTAACAGCGGCCTCGCCTCCCAGACACTGGAACTGGGCATTTTTGTGATCGATCTTTCCCGCAAAGAATTCCTCGTTGACGGTAACGCCGTCAAACTGACCGCATTTGAATACACCATTATTGAAACACTGATGCGGAATAATGGTAAAGTCGTCAGTAAAGATTCCCTGATGCGCCAGCTCTATCCGGATGCCGAACTGCGTGAAAGCCATACCATTGATGTACTGATGGGCCGTCTGCGCAAGAAAATCCAGGCATTTACCGATATTGATGCCATCGTCACTGTCCGCGGACAGGGCTACCGCTTCGACGCAGGGAAGTAACAGACGCCACTTAAGCCACTGAGGTATTGCGCATGACCAGGCGGACAACG