Homologs in group_1546

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10015 FBDBKF_10015 82.7 Morganella morganii S1 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
EHELCC_04815 EHELCC_04815 82.7 Morganella morganii S2 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
NLDBIP_04815 NLDBIP_04815 82.7 Morganella morganii S4 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
LHKJJB_13815 LHKJJB_13815 82.7 Morganella morganii S3 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
HKOGLL_12720 HKOGLL_12720 82.7 Morganella morganii S5 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
F4V73_RS00320 F4V73_RS00320 83.2 Morganella psychrotolerans - glutamate/aspartate ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_1546

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1546

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZF60 4.59e-168 471 75 2 302 3 gltI Glutamate/aspartate import solute-binding protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37902 8.86e-163 457 80 0 271 1 gltI Glutamate/aspartate import solute-binding protein Escherichia coli (strain K12)
Q9I402 2.74e-121 352 59 2 298 1 PA1342 L-glutamate/L-aspartate-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34563 2.07e-22 97 27 6 254 2 glnH ABC transporter glutamine-binding protein GlnH Bacillus subtilis (strain 168)
P27676 8.37e-18 84 31 6 208 3 glnH Glutamine-binding protein Geobacillus stearothermophilus
P45766 6.68e-14 74 24 3 255 1 yhdW Putative amino-acid ABC transporter-binding protein YhdW Escherichia coli (strain K12)
P58068 9.6e-14 73 24 4 255 3 yhdW Putative amino-acid ABC transporter-binding protein YhdW Escherichia coli O157:H7
P0AEM9 3.27e-12 68 24 6 249 1 tcyJ L-cystine-binding protein TcyJ Escherichia coli (strain K12)
P0AEN0 3.27e-12 68 24 6 249 3 tcyJ L-cystine-binding protein TcyJ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39906 5.6e-12 67 24 2 228 3 aabA Amino-acid-binding protein AabA Dichelobacter nodosus
P02911 9.19e-12 67 25 10 277 1 argT Lysine/arginine/ornithine-binding periplasmic protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1VZQ4 9.63e-12 67 23 6 252 3 peb1A Major cell-binding factor Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9X8 1.35e-11 67 23 6 252 1 peb1A Major cell-binding factor Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q52812 4.22e-10 63 23 5 274 1 aapJ General L-amino acid-binding periplasmic protein AapJ Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P09551 1.7e-09 60 24 8 276 1 argT Lysine/arginine/ornithine-binding periplasmic protein Escherichia coli (strain K12)
Q52663 8.35e-09 59 25 4 173 3 bztA Glutamate/glutamine/aspartate/asparagine-binding protein BztA Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P02910 1.62e-08 57 25 7 238 1 hisJ Histidine-binding periplasmic protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEU0 2.42e-08 57 24 6 238 1 hisJ Histidine-binding periplasmic protein Escherichia coli (strain K12)
P0AEU1 2.42e-08 57 24 6 238 3 hisJ Histidine-binding periplasmic protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEU2 2.42e-08 57 24 6 238 3 hisJ Histidine-binding periplasmic protein Escherichia coli O157:H7
Q06758 4.77e-08 56 25 8 227 3 hisJ Probable histidine-binding protein Neisseria gonorrhoeae
P54535 7.72e-08 55 22 4 231 1 artP Arginine-binding extracellular protein ArtP Bacillus subtilis (strain 168)
P54952 1.27e-07 55 23 8 245 1 yxeM Probable amino-acid-binding protein YxeM Bacillus subtilis (strain 168)
P52626 1.33e-07 55 25 8 235 3 patH Putative amino-acid ABC transporter-binding protein PatH Vibrio harveyi
P0AEQ3 1.33e-06 52 23 6 233 1 glnH Glutamine-binding periplasmic protein Escherichia coli (strain K12)
P0AEQ4 1.33e-06 52 23 6 233 3 glnH Glutamine-binding periplasmic protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEQ5 1.33e-06 52 23 6 233 3 glnH Glutamine-binding periplasmic protein Escherichia coli O157:H7
G3XD47 1.73e-05 48 21 5 242 1 aotJ L-arginine-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8ZWR8 0.000125 47 25 3 172 3 mltF Membrane-bound lytic murein transglycosylase F Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02155
Feature type CDS
Gene -
Product amino acid ABC transporter substrate-binding protein
Location 504757 - 505650 (strand: -1)
Length 894 (nucleotides) / 297 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1546
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00497 Bacterial extracellular solute-binding proteins, family 3

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0834 Amino acid transport and metabolism (E)
Signal transduction mechanisms (T)		 ET ABC-type amino acid transport/signal transduction system, periplasmic component/domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10001 glutamate/aspartate transport system substrate-binding protein ABC transporters
Two-component system		 -

Protein Sequence

MRMRKLALSLMILGAAGAVQAEELTGTLKKINDNDIIIVGHRESSVPFSYYDNQQKVVGYSQDYSNLIVEAVKEKLGKPNLQVRLIPITSQNRIPLLQNGTFDFECGSTTNNLARQQQADFSNTIFIVGTRLLAKKDSGIKDFADLAGKNVVVTSGTTSEMLLNKLNDEKKMNMRIISAKDHGDSFRTLESGRAVAFMMDDALLAGERAKAKKPALWEIVGTPQSEEAYGCMLRKGDTQFKSLIDETIANAQKSGAAEKSFNRWFNAPIPPKNLNLEFTISDEMKALFASPNDKALN

Flanking regions ( +/- flanking 50bp)

AAAAAAGTAACACAAAGCAACACATCAATATCACCACGACAGGAGTTATTATGCGCATGCGTAAACTAGCATTATCATTAATGATTTTAGGGGCTGCAGGAGCTGTGCAAGCAGAAGAACTCACTGGTACCTTAAAAAAAATCAACGATAACGATATTATTATTGTTGGTCATCGTGAATCCTCTGTCCCTTTTTCATACTACGATAATCAACAAAAAGTGGTCGGATACTCTCAAGACTATTCCAACCTGATTGTTGAGGCAGTAAAAGAAAAATTAGGCAAACCTAACCTACAAGTTCGTCTTATCCCTATCACTTCTCAGAATCGAATTCCACTATTACAAAATGGTACATTTGACTTTGAGTGTGGCTCAACGACCAATAATCTCGCTCGCCAACAACAAGCTGATTTCTCGAATACTATTTTTATTGTTGGTACACGTTTACTTGCGAAAAAAGACAGTGGAATTAAAGATTTTGCTGATCTTGCGGGCAAAAATGTGGTTGTTACGTCAGGCACCACATCTGAAATGTTACTCAACAAGCTCAATGATGAGAAAAAAATGAATATGCGCATTATTAGCGCAAAAGATCATGGCGACTCATTCCGTACACTTGAATCAGGGCGTGCCGTTGCTTTTATGATGGATGACGCCTTATTAGCGGGTGAACGTGCTAAAGCGAAAAAACCTGCGTTATGGGAGATTGTGGGAACACCTCAATCGGAAGAAGCTTATGGCTGTATGTTACGCAAAGGTGATACACAATTTAAGTCGTTAATTGATGAAACCATTGCTAATGCGCAAAAATCTGGCGCAGCAGAAAAATCGTTCAATCGTTGGTTTAATGCCCCAATTCCACCGAAAAACCTCAATTTAGAATTCACTATCTCGGATGAAATGAAAGCACTCTTTGCATCACCAAATGATAAAGCATTGAACTAACAATGCATATAAGTAATTGATGCAAAATTAATAATTATAAAGTATCTGTT