Homologs in group_1546

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10015 FBDBKF_10015 94.6 Morganella morganii S1 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
EHELCC_04815 EHELCC_04815 94.6 Morganella morganii S2 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
NLDBIP_04815 NLDBIP_04815 94.6 Morganella morganii S4 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
LHKJJB_13815 LHKJJB_13815 94.6 Morganella morganii S3 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
HKOGLL_12720 HKOGLL_12720 94.6 Morganella morganii S5 hisJ ABC-type amino acid transport/signal transduction system, periplasmic component/domain
PMI_RS02155 PMI_RS02155 83.2 Proteus mirabilis HI4320 - amino acid ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_1546

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1546

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9ZF60 8.3e-170 475 77 1 301 3 gltI Glutamate/aspartate import solute-binding protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37902 3.57e-164 461 81 0 270 1 gltI Glutamate/aspartate import solute-binding protein Escherichia coli (strain K12)
Q9I402 1.05e-122 356 60 2 295 1 PA1342 L-glutamate/L-aspartate-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34563 3.2e-21 94 26 5 268 2 glnH ABC transporter glutamine-binding protein GlnH Bacillus subtilis (strain 168)
P27676 1.94e-17 83 28 4 217 3 glnH Glutamine-binding protein Geobacillus stearothermophilus
A1VZQ4 5.73e-15 76 24 3 251 3 peb1A Major cell-binding factor Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9X8 7.93e-15 76 24 3 251 1 peb1A Major cell-binding factor Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P58068 5.9e-13 71 24 2 224 3 yhdW Putative amino-acid ABC transporter-binding protein YhdW Escherichia coli O157:H7
P45766 6.49e-13 71 24 2 224 1 yhdW Putative amino-acid ABC transporter-binding protein YhdW Escherichia coli (strain K12)
P02911 1.95e-12 69 25 7 272 1 argT Lysine/arginine/ornithine-binding periplasmic protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09551 2.25e-12 69 26 7 272 1 argT Lysine/arginine/ornithine-binding periplasmic protein Escherichia coli (strain K12)
Q52812 7.31e-11 65 23 5 276 1 aapJ General L-amino acid-binding periplasmic protein AapJ Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P02910 4.8e-10 62 24 4 236 1 hisJ Histidine-binding periplasmic protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEU0 5.8e-10 62 24 4 236 1 hisJ Histidine-binding periplasmic protein Escherichia coli (strain K12)
P0AEU1 5.8e-10 62 24 4 236 3 hisJ Histidine-binding periplasmic protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEU2 5.8e-10 62 24 4 236 3 hisJ Histidine-binding periplasmic protein Escherichia coli O157:H7
P0AEM9 4.58e-09 59 22 5 271 1 tcyJ L-cystine-binding protein TcyJ Escherichia coli (strain K12)
P0AEN0 4.58e-09 59 22 5 271 3 tcyJ L-cystine-binding protein TcyJ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39906 1.11e-08 58 23 3 221 3 aabA Amino-acid-binding protein AabA Dichelobacter nodosus
P54535 1.22e-07 55 22 5 233 1 artP Arginine-binding extracellular protein ArtP Bacillus subtilis (strain 168)
Q52663 4.41e-07 54 23 1 166 3 bztA Glutamate/glutamine/aspartate/asparagine-binding protein BztA Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q01269 1.41e-06 52 24 9 251 1 pheC Cyclohexadienyl dehydratase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52626 6.84e-06 50 25 9 237 3 patH Putative amino-acid ABC transporter-binding protein PatH Vibrio harveyi
P45091 4.79e-05 47 24 8 273 1 artI ABC transporter arginine-binding protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q06758 7.04e-05 47 26 8 223 3 hisJ Probable histidine-binding protein Neisseria gonorrhoeae
A0KJ50 0.000706 44 26 5 141 3 mltF Membrane-bound lytic murein transglycosylase F Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P30860 0.00076 43 22 10 275 1 artJ ABC transporter arginine-binding protein 1 Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00320
Feature type CDS
Gene -
Product glutamate/aspartate ABC transporter substrate-binding protein
Location 74430 - 75332 (strand: -1)
Length 903 (nucleotides) / 300 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1546
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00497 Bacterial extracellular solute-binding proteins, family 3

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0834 Amino acid transport and metabolism (E)
Signal transduction mechanisms (T)		 ET ABC-type amino acid transport/signal transduction system, periplasmic component/domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10001 glutamate/aspartate transport system substrate-binding protein ABC transporters
Two-component system		 -

Protein Sequence

MFMRKLLLSVLITSAALASAAVSAEELTGTLKKINDNGVIVVGHRESSVPFSYYDNQQNVVGYSQDYSNNIVDAIKKTLNKPDLQVKLIPITSQNRIPLLQNGTFDFECGSTTNNLARQQQAAFSNTIFVVGTRLLAGKDSGIKDFADLAGKNVVVTSGTTSEMLLNKLNDEKQMKMRIISAKDHGDAFRTLESGRAVAFMMDDALLAGERAKAKKSDNWVIVGTPQSEEAYGCMLRKDDPQFKALIDKTVADAQTSGKAEKSYTRWFNEPIPPKNLNLKFELSNEMKGLFKAPNDKAFE

Flanking regions ( +/- flanking 50bp)

CACGATCACATGAGCAGTACACATCGTTATGCCTCTTCCCAAAAAAGGAGTTGTTTATGCGCAAGTTACTTTTGTCGGTACTTATCACCAGTGCCGCACTCGCCAGTGCCGCCGTTTCTGCCGAAGAGTTAACCGGTACACTAAAAAAAATCAATGATAACGGTGTCATTGTCGTCGGTCACCGGGAATCATCCGTTCCCTTCTCTTATTATGATAATCAGCAAAATGTGGTCGGGTATTCCCAGGATTACTCCAACAATATTGTTGATGCCATTAAGAAAACACTGAACAAACCGGATCTTCAGGTAAAACTGATCCCGATTACCTCACAAAACCGGATTCCGTTATTACAGAACGGTACGTTCGATTTTGAGTGCGGCTCCACCACCAACAACTTGGCCCGCCAGCAACAGGCTGCATTCTCCAACACCATTTTTGTCGTCGGCACCCGCCTGCTGGCCGGTAAAGATTCCGGTATCAAAGATTTTGCTGATCTCGCCGGTAAAAACGTGGTGGTTACCTCCGGTACGACCTCTGAAATGCTGCTGAATAAGCTCAATGATGAGAAACAGATGAAAATGCGCATTATCAGCGCCAAAGATCACGGGGATGCTTTCCGCACCCTGGAGTCCGGCCGTGCGGTTGCGTTTATGATGGATGATGCCCTGCTCGCCGGTGAGCGCGCCAAAGCGAAAAAATCGGATAACTGGGTGATTGTCGGCACACCTCAGTCCGAAGAAGCTTACGGCTGTATGCTGCGTAAAGATGATCCGCAGTTCAAAGCGCTGATCGACAAAACTGTCGCTGATGCACAGACTTCCGGTAAAGCTGAGAAATCCTATACCCGCTGGTTCAATGAGCCGATTCCGCCTAAAAATCTTAACCTGAAATTTGAATTATCCAATGAAATGAAAGGACTGTTCAAAGCACCGAACGATAAAGCCTTTGAATAATACGGCGTCCGCGCCGGATATGACGGGGGTTTGCCCCGTCCGGATTGCAG